Using Real-time PCR technology, a highly specific and sensitive method for detecting DNA residues of Escherichia coli host cells in levodopa was established, validated, and preliminarily applied. Escherichia coli strain MB6 16S ribosomal RNA gene was selected as the target gene to design multiple pairs of primers and the target fragment by specific amplification of PCR was obtained. The target fragment was cloned into the pLENTI-BSD-CON vector and the recombinant plasmid was constructed and named pLENTI-BSD-CON-E.coli-16S. A quantitative PCR detection method (SYBR Green method) with magnetic bead extraction and purification methods was established with the reference standard of the recombinant plasmid. Furthermore, the established method was validated, including linear and range, accuracy, precision, specificity, and quantification limit, and applied to the detection of levodopa raw materials. Meanwhile, the detection method was compared with the Taqman probe method by the commercial kit. The primer sequences of the quantitative PCR detection method (SYBR Green method) were TTCGATGCAACGCGAAGAAC (forward) and GTGTAGCCCTGGTCGTAAGG (reverse). The standard curve of DNA was in the range of 10 fg/μL to 3 ng/μL with good linearity (R2≥ 0.98). The quantitative limit was 10 fg/μL. In addition, the detection recovery rate was in the range of 59.7% to 80.7%, with RSD at less than 15%. Nine batches of levodopa were detected by this method, and the amount of E.coli DNA residue was below the limit. The developed qPCR method can be used for quantitative detection of residual DNA in biological products produced by E.coli as host cells, such as levodopa . The results indicate that the sensitivity of the detection method for recombinant plasmid construction standards is superior than the reagent kit detection method.

Objective: To explore the iodine nutrition status of children in Wuhan from 2019 to 2023, and to evaluate the effect of iodine deficiency disorders control in focus groups in Wuhan, so as to provide a basis for consolidating elimination of iodine deficiency disorders. Methods: A total of 13 000 non boarding primary school students aged 8-10 were selected from 13 districts of Wuhan by stratified random sampling method.Household salt samples were collected to measure salt iodine content, random urine samples were analyzed for urinary iodine concentration. And B ultrasound was used to measure thyroid volume in students. The median of salt iodine, coverage rate of iodized salt, consumption rate of qualified iodized salt, median of urinary iodine, and the goiter rate were calculated. And Mann-Whitney U- test, Kruskal-Wallis H- test and Chi-square test were applied to compare between groups. Chi-square trend test was used to analyze the changing trends of coverage rate of iodized salt, consumption rate of qualified iodized salt and goiter rate among children in Wuhan. Results: The median of iodine content of children s household salt was 23.8 (21.7, 26.1) mg/kg, and the coverage rate of iodized salt was 98.7%, and the consumption rate of qualified iodized salt was 94.5 %. The consumption rates of qualified iodized salt showed an overall upward trend from 2019 to 2023 ( χ 2 trend =5.57， P <0.05). The median of urinary iodine of children was 220.1 (136.7, 326.0) μg/L,and boys had higher median of urinary iodine than girls [228.3(143.2, 336.0),210.2(129.1, 315.7) μg/L] ( Z =6.60, P <0.01). The median of urinary iodine of children in suburbs was higher than those in urban areas [236.3 (150.7, 342.2) , 207.1 (124.5, 309.8) μg/L]( Z =11.00, P <0.01). A total of 4 600 children were examined for thyroid volume, and the range of goiter rates were 1.1% to 3.4%, with an average goiter rate of 2.5%, which showed an overall downward trend from 2019 to 2023 ( χ 2 trend =5.11, P <0.05). Conclusions The iodine nutrition is sufficient and iodine nutrition status is good among children in Wuhan. It should continue to carry out monitoring and evaluation of children s iodine nutrition, guide the public to supplement iodine scientifically,so as to maintain the appropriate level of iodine for children.

This study aims to evaluate the efficacy of Chinese medicine injections in treating transient ischemic attack(TIA) based on network Meta-analysis. Randomized controlled trial(RCT) about Chinese medicine injections in treating TIA were retrieved from PubMed, Web of Science, Cochrane Library, EMbase, CNKI, VIP, Wanfang, and SinoMed with the time interval from inception to March 1, 2024. The methodological quality of the included articles was assessed by ROB 2.0, and the GRADE system was employed to evaluate the quality of evidence. The gemtc package of R 4.1.2 was used to perform the network Meta-analysis. Finally, 63 RCTs with a total sample size of 5 750 cases were included, involving 11 Chinese medicine injections(Shuxuetong Injection, Danhong Injection, Shuxuening Injection, Ginkgo Damo Injection, Shenxiong Glucose Injection, Ligustrazine Injection, Salviae Miltiorrhizae and Ligustrazine Hydrochloride Injection, Salvianolic Acids for Injection, Dengzhan Xixin Injection, Guhong Injection, and Xueshuantong Injection). All patients received conventional western medicine treatment, and the experimental group was additionally treated with Chinese medicine injection. Network Meta-analysis yielded the following results.(1) In terms of improving the clinical total response rate, 11 Chinese medicine injections combined with conventional western medicine outperformed conventional western medicine alone, and Dengzhan Xixin Injection + conventional western medicine had the best effect.(2) In terms of reducing plasma viscosity, 7 Chinese medicine injections combined with conventional western medicine outperformed conventional western medicine alone, and Shenxiong Glucose Injection + conventional western medicine had the best effect.(3) In terms of reducing whole blood high shear viscosity, 6 Chinese medicine injections combined with conventional western medicine outperformed conventional western medicine alone, and Guhong Injection + conventional western medicine had the best effect.(4) In terms of reducing whole blood low shear viscosity, 6 Chinese medicine injections combined with conventional western medicine outperformed conventional western medicine alone, and Shuxuening Injection + conventional western medicine had the best effect.(5) In terms of reducing fibrinogen, 9 Chinese medicine injections combined with conventional western medicine outperformed conventional western medicine alone, and Ginkgo Damo Injection + conventional western medicine had the best effect.(6) In terms of increasing the average blood flow velocity, 3 Chinese medicine injections combined with conventional western medicine outperformed conventional western medicine alone, and Shuxuening Injection + conventional western medicine had the best effect. In summary, compared with conventional western medicine alone, Chinese medicine injections combined with conventional western medicine were effective in improving the clinical total response rate and the average blood flow velocity, as well as reducing plasma viscosity, whole blood high shear viscosity, whole blood low shear viscosity, and fibrinogen. However, due to the limited quality and quantity of the included articles, the above conclusions need to be verified by more high-quality, multi-center, and large-sample RCT.
Humans ; Drugs, Chinese Herbal/administration & dosage* ; Injections ; Ischemic Attack, Transient/drug therapy* ; Randomized Controlled Trials as Topic ; Treatment Outcome

Patients with periodontal disease often require combined periodontal-orthodontic interventions to restore periodontal health, function, and aesthetics, ensuring both patient satisfaction and long-term stability. Managing these patients involving orthodontic tooth movement can be particularly challenging due to compromised periodontal soft and hard tissues, especially in severe cases. Therefore, close collaboration between orthodontists and periodontists for comprehensive diagnosis and sequential treatment, along with diligent patient compliance throughout the entire process, is crucial for achieving favorable treatment outcomes. Moreover, long-term orthodontic retention and periodontal follow-up are essential to sustain treatment success. This expert consensus, informed by the latest clinical research and practical experience, addresses clinical considerations for orthodontic treatment of periodontal patients, delineating indications, objectives, procedures, and principles with the aim of providing clear and practical guidance for clinical practitioners.
Humans ; Consensus ; Orthodontics, Corrective/standards* ; Periodontal Diseases/complications* ; Tooth Movement Techniques/methods* ; Practice Guidelines as Topic

Periodontal bone defects, primarily caused by periodontitis, are highly prevalent in clinical settings and manifest as bone fenestration, dehiscence, or attachment loss, presenting a significant challenge to oral health. In regenerative medicine, harnessing developmental principles for tissue repair offers promising therapeutic potential. Of particular interest is the condensation of progenitor cells, an essential event in organogenesis that has inspired clinically effective cell aggregation approaches in dental regeneration. However, the precise cellular coordination mechanisms during condensation and regeneration remain elusive. Here, taking the tooth as a model organ, we employed single-cell RNA sequencing to dissect the cellular composition and heterogeneity of human dental follicle and dental papilla, revealing a distinct Platelet-derived growth factor receptor alpha (PDGFRA) mesenchymal stem/stromal cell (MSC) population with remarkable odontogenic potential. Interestingly, a reciprocal paracrine interaction between PDGFRA⁺ dental follicle stem cells (DFSCs) and CD31⁺ Endomucin⁺ endothelial cells (ECs) was mediated by Vascular endothelial growth factor A (VEGFA) and Platelet-derived growth factor subunit BB (PDGFBB). This crosstalk not only maintains the functionality of PDGFRA⁺ DFSCs but also drives specialized angiogenesis. In vivo periodontal bone regeneration experiments further reveal that communication between PDGFRA⁺ DFSC aggregates and recipient ECs is essential for effective angiogenic-osteogenic coupling and rapid tissue repair. Collectively, our results unravel the importance of MSC-EC crosstalk mediated by the VEGFA and PDGFBB-PDGFRA reciprocal signaling in orchestrating angiogenesis and osteogenesis. These findings not only establish a framework for deciphering and promoting periodontal bone regeneration in potential clinical applications but also offer insights for future therapeutic strategies in dental or broader regenerative medicine.
Receptor, Platelet-Derived Growth Factor alpha/metabolism* ; Humans ; Neovascularization, Physiologic/physiology* ; Dental Sac/cytology* ; Single-Cell Analysis ; Transcriptome ; Mesenchymal Stem Cells/metabolism* ; Bone Regeneration ; Animals ; Dental Papilla/cytology* ; Periodontium/physiology* ; Stem Cells/metabolism* ; Regeneration ; Angiogenesis

Glutamine provides carbon and nitrogen to support the proliferation of cancer cells. However, the precise reason why cancer cells are particularly dependent on glutamine remains unclear. In this study, we report that glutamine modulates the tumor suppressor F-box and WD repeat domain-containing 7 (FBW7) to promote cancer cell proliferation and survival. Specifically, lysine 604 (K604) in the sixth of the 7 substrate-recruiting WD repeats of FBW7 undergoes glutaminylation (Gln-K604) by glutaminyl tRNA synthetase. Gln-K604 inhibits SCFFBW7-mediated degradation of c-Myc and Mcl-1, enhances glutamine utilization, and stimulates nucleotide and DNA biosynthesis through the activation of c-Myc. Additionally, Gln-K604 promotes resistance to apoptosis by activating Mcl-1. In contrast, SIRT1 deglutaminylates Gln-K604, thereby reversing its effects. Cancer cells lacking Gln-K604 exhibit overexpression of c-Myc and Mcl-1 and display resistance to chemotherapy-induced apoptosis. Silencing both c-MYC and MCL-1 in these cells sensitizes them to chemotherapy. These findings indicate that the glutamine-mediated signal via Gln-K604 is a key driver of cancer progression and suggest potential strategies for targeted cancer therapies based on varying Gln-K604 status.
Glutamine/metabolism* ; Myeloid Cell Leukemia Sequence 1 Protein/genetics* ; Humans ; Proto-Oncogene Proteins c-myc/genetics* ; Cell Proliferation ; Signal Transduction ; Neoplasms/pathology* ; F-Box-WD Repeat-Containing Protein 7/genetics* ; Cell Survival ; Cell Line, Tumor ; Apoptosis

Background/Aims: Endoscopic radiofrequency ablation (ERFA) is a treatment option for superficial esophageal squamous cell neoplasia (ESCN), with a relatively low risk of stenosis; however, the long-term outcomes remain unclear. We aimed to compare the long-term outcomes of patients with widespread superficial ESCN who underwent endoscopic submucosal dissection (ESD) or ERFA. Methods: We retrospectively analyzed the clinical data of patients with superficial ESCN who underwent ESD or ERFA between January 2015 and December 2021. The primary outcome measure was recurrence-free survival. Results: Ninety-two and 33 patients with superficial ESCN underwent ESD and ERFA, respectively. The en bloc, R0, and curative resection rates for ESD were 100.0%, 90.2%, and 76.1%, respectively. At 12 months, the complete response rate was comparable between the two groups (94.6% vs 90.9%, p=0.748). During a median follow-up of 66 months, recurrence-free survival was significantly longer in the ESD group than in the ERFA group (p=0.004), while no significant differences in overall survival (p=0.845) and disease-specific survival (p=0.494) were observed.Preoperative diagnosis of intramucosal cancer (adjusted hazard ratio, 5.55; vs high-grade intraepithelial neoplasia) was an independent predictor of recurrence. Significantly fewer patients in the ERFA group experienced stenosis compare to ESD group (15.2% vs 38.0%, p=0.016). Conclusions The risk of recurrence was higher for ERFA than ESD for ESCN but overall survival was not affected. The risk of esophageal stenosis was significantly lower for patients who underwent ERFA.

Background/Aims: Endoscopic radiofrequency ablation (ERFA) is a treatment option for superficial esophageal squamous cell neoplasia (ESCN), with a relatively low risk of stenosis; however, the long-term outcomes remain unclear. We aimed to compare the long-term outcomes of patients with widespread superficial ESCN who underwent endoscopic submucosal dissection (ESD) or ERFA. Methods: We retrospectively analyzed the clinical data of patients with superficial ESCN who underwent ESD or ERFA between January 2015 and December 2021. The primary outcome measure was recurrence-free survival. Results: Ninety-two and 33 patients with superficial ESCN underwent ESD and ERFA, respectively. The en bloc, R0, and curative resection rates for ESD were 100.0%, 90.2%, and 76.1%, respectively. At 12 months, the complete response rate was comparable between the two groups (94.6% vs 90.9%, p=0.748). During a median follow-up of 66 months, recurrence-free survival was significantly longer in the ESD group than in the ERFA group (p=0.004), while no significant differences in overall survival (p=0.845) and disease-specific survival (p=0.494) were observed.Preoperative diagnosis of intramucosal cancer (adjusted hazard ratio, 5.55; vs high-grade intraepithelial neoplasia) was an independent predictor of recurrence. Significantly fewer patients in the ERFA group experienced stenosis compare to ESD group (15.2% vs 38.0%, p=0.016). Conclusions The risk of recurrence was higher for ERFA than ESD for ESCN but overall survival was not affected. The risk of esophageal stenosis was significantly lower for patients who underwent ERFA.

Background/Aims: Endoscopic radiofrequency ablation (ERFA) is a treatment option for superficial esophageal squamous cell neoplasia (ESCN), with a relatively low risk of stenosis; however, the long-term outcomes remain unclear. We aimed to compare the long-term outcomes of patients with widespread superficial ESCN who underwent endoscopic submucosal dissection (ESD) or ERFA. Methods: We retrospectively analyzed the clinical data of patients with superficial ESCN who underwent ESD or ERFA between January 2015 and December 2021. The primary outcome measure was recurrence-free survival. Results: Ninety-two and 33 patients with superficial ESCN underwent ESD and ERFA, respectively. The en bloc, R0, and curative resection rates for ESD were 100.0%, 90.2%, and 76.1%, respectively. At 12 months, the complete response rate was comparable between the two groups (94.6% vs 90.9%, p=0.748). During a median follow-up of 66 months, recurrence-free survival was significantly longer in the ESD group than in the ERFA group (p=0.004), while no significant differences in overall survival (p=0.845) and disease-specific survival (p=0.494) were observed.Preoperative diagnosis of intramucosal cancer (adjusted hazard ratio, 5.55; vs high-grade intraepithelial neoplasia) was an independent predictor of recurrence. Significantly fewer patients in the ERFA group experienced stenosis compare to ESD group (15.2% vs 38.0%, p=0.016). Conclusions The risk of recurrence was higher for ERFA than ESD for ESCN but overall survival was not affected. The risk of esophageal stenosis was significantly lower for patients who underwent ERFA.

Psoraleae Fructus is derived from the dried fruit of the Psoralea corylifolia L. It has the effects of tonifying the kidney, strengthening the Yang, warming the spleen and stopping diarrhea, and is used for the treatment of kidney deficiency and impotence, lumbar soreness and cold pain, osteoporosis and other diseases, and it is a commonly used tonic traditional Chinese medicine in Chinese medicine clinics in China. However, in recent years, the clinical adverse reactions of Psoraleae Fructus (PF) and related preparations have been increasingly reported, especially hepatotoxicity, which has become a bottleneck in the clinical application of PF and associated preparations. The safety of PF was rarely recorded in ancient texts, but modern clinical and experimental research has shown that PF not only has direct toxicity but also has immune-idiosyncratic toxicity. For this reason, this study comprehensively analyzes the evolution of PF effect/toxicity records in ancient and modern canonical literature, and combines with the progress of modern pharmacology and toxicology research, to conduct an in-depth discussion on the clinical characteristics, causative mechanisms and risk factors of PF hepatotoxicity. On this basis, based on the three-dimensional "human-medicine-use" precise prevention and control strategy for the safety risk of traditional Chinese medicine proposed by the author's team, safety risk prevention and control measures for PF and related preparations were developed, aiming at guiding the safe and rational use of PF and related preparations in the clinic and promoting the healthy and sustainable development of PF-related industries.