Objective To analyze the characteristics of adverse drug reactions （ADR） reported in Sixth People’s Hospital South Campus, Shanghai Jiaotong University from 2021 to 2023, to provide reference for promoting rational clinical drug use. Methods ADR data reported in our hospital were collected retrospectively, including patients’ basic information, drugs causing adverse reactions, types of adverse reactions and outcomes. Descriptive analysis methods were used to summarize and analyze the data. Results A total of 979 cases of ADR were reported in our hospital from 2021 to 2023. The highest proportion of patients with ADR occurred in the age range of 31 to 50, and more male patients （63.5%）. The top five drugs involved with adverse reactions were antibiotics （48.8%）, Chinese medicine injections（19.2%）, vitamins（7.5%）, Chinese traditional medicine（7.2%）, equine tetanus immunoglobulin（6.3%）. Among antibiotics, cefuroxime, ceftazidime and cefotiam were the majority. The organs/systems involved in all ADR were mainly skin and accessories damage （55.4%）. The clinical manifestations were rash, itching, and maculopapular rash. Conclusion From 2021 to 2023, the most common drugs causing adverse drug reactions in our hospital were mainly antibacterial drugs, and the rational clinical use of antibacterial drugs still needs to be concerned.

Background/Aims: Endoscopic radiofrequency ablation (ERFA) is a treatment option for superficial esophageal squamous cell neoplasia (ESCN), with a relatively low risk of stenosis; however, the long-term outcomes remain unclear. We aimed to compare the long-term outcomes of patients with widespread superficial ESCN who underwent endoscopic submucosal dissection (ESD) or ERFA. Methods: We retrospectively analyzed the clinical data of patients with superficial ESCN who underwent ESD or ERFA between January 2015 and December 2021. The primary outcome measure was recurrence-free survival. Results: Ninety-two and 33 patients with superficial ESCN underwent ESD and ERFA, respectively. The en bloc, R0, and curative resection rates for ESD were 100.0%, 90.2%, and 76.1%, respectively. At 12 months, the complete response rate was comparable between the two groups (94.6% vs 90.9%, p=0.748). During a median follow-up of 66 months, recurrence-free survival was significantly longer in the ESD group than in the ERFA group (p=0.004), while no significant differences in overall survival (p=0.845) and disease-specific survival (p=0.494) were observed.Preoperative diagnosis of intramucosal cancer (adjusted hazard ratio, 5.55; vs high-grade intraepithelial neoplasia) was an independent predictor of recurrence. Significantly fewer patients in the ERFA group experienced stenosis compare to ESD group (15.2% vs 38.0%, p=0.016). Conclusions The risk of recurrence was higher for ERFA than ESD for ESCN but overall survival was not affected. The risk of esophageal stenosis was significantly lower for patients who underwent ERFA.

Background/Aims: Endoscopic radiofrequency ablation (ERFA) is a treatment option for superficial esophageal squamous cell neoplasia (ESCN), with a relatively low risk of stenosis; however, the long-term outcomes remain unclear. We aimed to compare the long-term outcomes of patients with widespread superficial ESCN who underwent endoscopic submucosal dissection (ESD) or ERFA. Methods: We retrospectively analyzed the clinical data of patients with superficial ESCN who underwent ESD or ERFA between January 2015 and December 2021. The primary outcome measure was recurrence-free survival. Results: Ninety-two and 33 patients with superficial ESCN underwent ESD and ERFA, respectively. The en bloc, R0, and curative resection rates for ESD were 100.0%, 90.2%, and 76.1%, respectively. At 12 months, the complete response rate was comparable between the two groups (94.6% vs 90.9%, p=0.748). During a median follow-up of 66 months, recurrence-free survival was significantly longer in the ESD group than in the ERFA group (p=0.004), while no significant differences in overall survival (p=0.845) and disease-specific survival (p=0.494) were observed.Preoperative diagnosis of intramucosal cancer (adjusted hazard ratio, 5.55; vs high-grade intraepithelial neoplasia) was an independent predictor of recurrence. Significantly fewer patients in the ERFA group experienced stenosis compare to ESD group (15.2% vs 38.0%, p=0.016). Conclusions The risk of recurrence was higher for ERFA than ESD for ESCN but overall survival was not affected. The risk of esophageal stenosis was significantly lower for patients who underwent ERFA.

Background/Aims: Endoscopic radiofrequency ablation (ERFA) is a treatment option for superficial esophageal squamous cell neoplasia (ESCN), with a relatively low risk of stenosis; however, the long-term outcomes remain unclear. We aimed to compare the long-term outcomes of patients with widespread superficial ESCN who underwent endoscopic submucosal dissection (ESD) or ERFA. Methods: We retrospectively analyzed the clinical data of patients with superficial ESCN who underwent ESD or ERFA between January 2015 and December 2021. The primary outcome measure was recurrence-free survival. Results: Ninety-two and 33 patients with superficial ESCN underwent ESD and ERFA, respectively. The en bloc, R0, and curative resection rates for ESD were 100.0%, 90.2%, and 76.1%, respectively. At 12 months, the complete response rate was comparable between the two groups (94.6% vs 90.9%, p=0.748). During a median follow-up of 66 months, recurrence-free survival was significantly longer in the ESD group than in the ERFA group (p=0.004), while no significant differences in overall survival (p=0.845) and disease-specific survival (p=0.494) were observed.Preoperative diagnosis of intramucosal cancer (adjusted hazard ratio, 5.55; vs high-grade intraepithelial neoplasia) was an independent predictor of recurrence. Significantly fewer patients in the ERFA group experienced stenosis compare to ESD group (15.2% vs 38.0%, p=0.016). Conclusions The risk of recurrence was higher for ERFA than ESD for ESCN but overall survival was not affected. The risk of esophageal stenosis was significantly lower for patients who underwent ERFA.

Psoraleae Fructus is derived from the dried fruit of the Psoralea corylifolia L. It has the effects of tonifying the kidney, strengthening the Yang, warming the spleen and stopping diarrhea, and is used for the treatment of kidney deficiency and impotence, lumbar soreness and cold pain, osteoporosis and other diseases, and it is a commonly used tonic traditional Chinese medicine in Chinese medicine clinics in China. However, in recent years, the clinical adverse reactions of Psoraleae Fructus (PF) and related preparations have been increasingly reported, especially hepatotoxicity, which has become a bottleneck in the clinical application of PF and associated preparations. The safety of PF was rarely recorded in ancient texts, but modern clinical and experimental research has shown that PF not only has direct toxicity but also has immune-idiosyncratic toxicity. For this reason, this study comprehensively analyzes the evolution of PF effect/toxicity records in ancient and modern canonical literature, and combines with the progress of modern pharmacology and toxicology research, to conduct an in-depth discussion on the clinical characteristics, causative mechanisms and risk factors of PF hepatotoxicity. On this basis, based on the three-dimensional "human-medicine-use" precise prevention and control strategy for the safety risk of traditional Chinese medicine proposed by the author's team, safety risk prevention and control measures for PF and related preparations were developed, aiming at guiding the safe and rational use of PF and related preparations in the clinic and promoting the healthy and sustainable development of PF-related industries.

Background/Aims: Endoscopic radiofrequency ablation (ERFA) is a treatment option for superficial esophageal squamous cell neoplasia (ESCN), with a relatively low risk of stenosis; however, the long-term outcomes remain unclear. We aimed to compare the long-term outcomes of patients with widespread superficial ESCN who underwent endoscopic submucosal dissection (ESD) or ERFA. Methods: We retrospectively analyzed the clinical data of patients with superficial ESCN who underwent ESD or ERFA between January 2015 and December 2021. The primary outcome measure was recurrence-free survival. Results: Ninety-two and 33 patients with superficial ESCN underwent ESD and ERFA, respectively. The en bloc, R0, and curative resection rates for ESD were 100.0%, 90.2%, and 76.1%, respectively. At 12 months, the complete response rate was comparable between the two groups (94.6% vs 90.9%, p=0.748). During a median follow-up of 66 months, recurrence-free survival was significantly longer in the ESD group than in the ERFA group (p=0.004), while no significant differences in overall survival (p=0.845) and disease-specific survival (p=0.494) were observed.Preoperative diagnosis of intramucosal cancer (adjusted hazard ratio, 5.55; vs high-grade intraepithelial neoplasia) was an independent predictor of recurrence. Significantly fewer patients in the ERFA group experienced stenosis compare to ESD group (15.2% vs 38.0%, p=0.016). Conclusions The risk of recurrence was higher for ERFA than ESD for ESCN but overall survival was not affected. The risk of esophageal stenosis was significantly lower for patients who underwent ERFA.

Using Real-time PCR technology, a highly specific and sensitive method for detecting DNA residues of Escherichia coli host cells in levodopa was established, validated, and preliminarily applied. Escherichia coli strain MB6 16S ribosomal RNA gene was selected as the target gene to design multiple pairs of primers and the target fragment by specific amplification of PCR was obtained. The target fragment was cloned into the pLENTI-BSD-CON vector and the recombinant plasmid was constructed and named pLENTI-BSD-CON-E.coli-16S. A quantitative PCR detection method (SYBR Green method) with magnetic bead extraction and purification methods was established with the reference standard of the recombinant plasmid. Furthermore, the established method was validated, including linear and range, accuracy, precision, specificity, and quantification limit, and applied to the detection of levodopa raw materials. Meanwhile, the detection method was compared with the Taqman probe method by the commercial kit. The primer sequences of the quantitative PCR detection method (SYBR Green method) were TTCGATGCAACGCGAAGAAC (forward) and GTGTAGCCCTGGTCGTAAGG (reverse). The standard curve of DNA was in the range of 10 fg/μL to 3 ng/μL with good linearity (R2≥ 0.98). The quantitative limit was 10 fg/μL. In addition, the detection recovery rate was in the range of 59.7% to 80.7%, with RSD at less than 15%. Nine batches of levodopa were detected by this method, and the amount of E.coli DNA residue was below the limit. The developed qPCR method can be used for quantitative detection of residual DNA in biological products produced by E.coli as host cells, such as levodopa . The results indicate that the sensitivity of the detection method for recombinant plasmid construction standards is superior than the reagent kit detection method.

Objective: To explore the iodine nutrition status of children in Wuhan from 2019 to 2023, and to evaluate the effect of iodine deficiency disorders control in focus groups in Wuhan, so as to provide a basis for consolidating elimination of iodine deficiency disorders. Methods: A total of 13 000 non boarding primary school students aged 8-10 were selected from 13 districts of Wuhan by stratified random sampling method.Household salt samples were collected to measure salt iodine content, random urine samples were analyzed for urinary iodine concentration. And B ultrasound was used to measure thyroid volume in students. The median of salt iodine, coverage rate of iodized salt, consumption rate of qualified iodized salt, median of urinary iodine, and the goiter rate were calculated. And Mann-Whitney U- test, Kruskal-Wallis H- test and Chi-square test were applied to compare between groups. Chi-square trend test was used to analyze the changing trends of coverage rate of iodized salt, consumption rate of qualified iodized salt and goiter rate among children in Wuhan. Results: The median of iodine content of children s household salt was 23.8 (21.7, 26.1) mg/kg, and the coverage rate of iodized salt was 98.7%, and the consumption rate of qualified iodized salt was 94.5 %. The consumption rates of qualified iodized salt showed an overall upward trend from 2019 to 2023 ( χ 2 trend =5.57， P <0.05). The median of urinary iodine of children was 220.1 (136.7, 326.0) μg/L,and boys had higher median of urinary iodine than girls [228.3(143.2, 336.0),210.2(129.1, 315.7) μg/L] ( Z =6.60, P <0.01). The median of urinary iodine of children in suburbs was higher than those in urban areas [236.3 (150.7, 342.2) , 207.1 (124.5, 309.8) μg/L]( Z =11.00, P <0.01). A total of 4 600 children were examined for thyroid volume, and the range of goiter rates were 1.1% to 3.4%, with an average goiter rate of 2.5%, which showed an overall downward trend from 2019 to 2023 ( χ 2 trend =5.11, P <0.05). Conclusions The iodine nutrition is sufficient and iodine nutrition status is good among children in Wuhan. It should continue to carry out monitoring and evaluation of children s iodine nutrition, guide the public to supplement iodine scientifically,so as to maintain the appropriate level of iodine for children.

Aim To investigate the effects of multi-gly-cosides of Tripterygium wilfordii(GTW)on mitochon-drial dynamics-related proteins and the mechanism of nephroprotective effects in IgA nephrophathy(IgAN)rats.Methods SPF grade male SD rats were random-ly divided into the Control group,modelling group,prednisone group(6.25 mg·kg·d-1)and GTW group(6.25 mg·kg·d-1).The IgAN rat model was established by the method of"bovine serum albumin(BSA)+carbon tetrachloride(CCl4)+lipopolysac-charide(LPS)".The total amount of urinary protein(24 h-UTP)and erythrocyte count in urine were meas-ured in 24 h urine.Blood biochemistry of serum albu-min(ALB),alanine aminotransferase(ALT),urea ni-trogen(BUN),and creatinine(Scr)were measured in abdominal aorta of the rats;immunofluorescence and HE staining were used to observe the histopathology of the kidneys;RT-PCR and Western blotting were used to detect the mRNA and protein expression levels of key proteins regulating mitochondrial division and fu-sion:dynamin-related protein 1(Drp1),mitochondrial fusion protein 1(Mfn1),and mitochondrial fusion pro-tein 2(Mfn2),and PTEN-induced putative kinase 1(Pink1),in the kidney tissue of rats.Results GTW significantly reduced urinary erythrocyte count and 24 h-UTP,decreased serum ALT,BUN and Scr levels,in-creased serum ALB levels,improved renal histopatho-logical status in IgAN rats,increased the protein and mRNA expression levels of Mfn1,Mfn2,and Pink1,and decreased the protein and mRNA expression levels of Drp1 in renal tissues.Conclusions GTW may regu-late mitochondrial structure and maintain the dynamic balance of mitochondrial dynamics by promoting the ex-pression of Mfn1,Mfn2,Pink1 and decreasing Drp1.This may result in a reduction in urinary erythrocyte counts and proteinuria,and an improvement in renal function.

Aim To explore the mechanism of action of Tripterygium glycosides tablets on kidney of rats with IgA nephropathy based on inflammation-related path-ways.Methods Forty-five male SD rats of SPF grade were randomly divided into control group and modeling group.In addition to the blank group,the modeling group used the combination of bovine serum albumin(BSA)+carbon tetrachloride(CC14)+lipopolysac-charide(LPS)to establish the IgA nephropathy rat model.Successfully modeled rats were randomly divid-ed into the model group,the prednisone group and Tripterygium glycosides tablets group,and the treat-ment group was given the drug by gavage from the 13 th week,and the 24 hours urine,blood and kidney tis-sues of the rats were collected and examined after 4 weeks of the administration of the drug.Urine erythro-cyte count,quantitative 24-h urine protein(24 h-UTP),urea nitrogen(BUN),and blood creatinine(Scr)were detected in each group;serum interleukin 1β(IL-1β)and tumor necrosis factor α(TNF-α)were detected by enzyme-linked immunosorbent assay(Elisa);the pathological changes in the renal tissues of the rats in each group were observed by horizontal hematoxylin-eosin(HE)staining;and the renal tis-sues in each group were observed by Western blotting.The expressions of LIGHT,HVEM,LTβR proteins and their mRNAs in rat kidney tissue were detected by Western blot and real-time fluorescence quantitative polymerase chain reaction(RT-PCR).Results Tripterygium glycosides tablets significantly reduced the levels of urinary erythrocyte count,24 h-UTP,BUN,and Scr in IgA nephropathy rats(P＜0.01),improved renal histopathology,lowered the levels of se-rum inflammatory factors IL-1β and TNF-α(P＜0.01),and lowered the levels of LIGHT,HVEM,LTβR proteins and their mRNA expression in renal tis-sues(P＜0.01).Conclusions Tripterygium glyco-sides tablets may inhibit the immune response and re-duce the release of inflammatory factors by down-regu-lating the LIGHT-HVEM/LT(3R pathway,thus reduc-ing the inflammatory response,lowering the urinary e-rythrocytes and urinary proteins,improving the renal nephron pathologic injury,and protecting the renal function.