Stroke is the leading cause of death and disability among adults in China， and its common complications include digestive system abnormalities， cognitive impairment， depression， stroke-associated pneumonia， and hemiplegia. The combination of traditional Chinese and Western medicine has great potential in treating post-stroke complications. Xinglou Chengqitang （XLCQT） is a representative prescription of alleviating the disease in the upper part by treating the lower part. It has definite therapeutic effect and high safety. Clinically， XLCQT is often used to treat stroke and its complications. However， the quantity and quality of clinical trials of XLCQT in treating post-stroke complications need to be improved. Additionally， since the basic research is weak， the material basis and multi-target mechanism for the efficacy of this prescription are unknown. This article reviews XLCQT in terms of the pharmacodynamic basis， medicinal properties， safety evaluation， and progress in clinical research and mechanisms in treating post-stroke complications. This article summarizes 22 key active ingredients of XLCQT in treating acute stroke complicated with syndrome of phlegm heat and fu-organ excess. Among these key active ingredients， resveratrol， kaempferol， luteolin， chrysoeriol， apigenin， （+）-catechin， and adenosine have good pharmacokinetic properties and high bioavailability. The mechanisms of XLCQT in treating post-stroke complications are complex， including inflammatory response， brain-gut axis， hypothalamic-pituitary-adrenal （HPA） axis， intestinal flora， neurotrophic factors， autophagy， oxidative stress， and free radical damage. This review helps to deeply understand the pharmacodynamic basis and mechanisms of XLCQT in treating post-stroke complications and provides a theoretical basis for the clinical application of XLCQT against post-stroke complications and the development of drugs.

Objective: To explore the early effects of birth weight at different gestational ages on blood pressure trajectory among primary school students, so as to provide evidence for incorporating gestational age birth weight into individualized early warning and intervention strategies for childhood hypertension. Methods: From May to November 2023, a purposeful sampling method was used to recruit 1 676 students in grade 1-3 from three primary schools in a certain urban district of Chongqing. Follow up assessments were conducted in May 2024(T1), November 2024(T2), and May 2025(T3). General demographic and birth related information were collected via self administered questionnaires, while height, weight and blood pressure were obtained through physical examinations. Linear mixed effects model was used to analyze the associations between birth weight at different gestational ages and blood pressure trajectories. Results: During the T1-T3 period, the systolic blood pressure of boys were 98.5 (93.0, 104.5 ),98.5 (93.5, 105.0), and 97.5 (92.5, 103.5)mmHg, respectively, while the diastolic blood pressure were 60.5 (56.5, 65.0), 61.5 ( 57.0 , 65.5), and 60.0 (56.0, 64.0)mmHg, respectively. For girls, the systolic blood pressure were 95.5 (90.0, 102.0),95.5 (90.5, 101.5), and 96.0 (90.5, 101.5)mmHg, respectively, and the diastolic blood pressure were 60.5 (56.0, 64.5 ),61.5 (57.5, 65.5), and 59.5 (56.0, 63.0)mmHg, respectively. Through Friedman test within both boys and girls, diostolic blood pressure were statistically significant across three measurements( χ 2=48.85，81.54，both P <0.01). The proportion of normal blood pressure increased , and the proportion of prehypertension and hypertension decreased with time( χ 2=39.72，25.62，both P < 0.01 ). Linear mixed effects model analysis revealed that after adjusting for age, sex, household income monthly, parental education, family history of hypertension and maternal pregnancy complications, large for gestational age had significantly higher trajectories of systolic ( β = 1.50) and diastolic( β =0.94) blood pressure compared to appropriate for gestational age(both P <0.01). Conclusion Large for gestational age is associated with elevated blood pressure trajectories during school age, and it may be considered as an early indicator for individualized screening and intervention for childhood hypertension.

ObjectiveTo explore the efficacy and mechanisms of Sini San in the treatment of depression and liver injury based on gut microbiota. MethodsThirty-two male Sprague-Dawley （SD） rats were randomly divided into a normal group， model group （M）， Sini San group （MS， 2.5 g·kg^-1）， and fluoxetine group （MF， 2 mg·kg^-1）. Except for the normal group， rats in the other three groups were subjected to chronic unpredictable mild stress （CUMS）. After 8 weeks， the open-field test and sucrose preference test were conducted. Enzyme-linked immunosorbent assay （ELISA） was used to detect serum corticosterone （CORT）， adrenocorticotropic hormone （ACTH）， corticotropin-releasing factor （CRF）， lipopolysaccharide （LPS）， Zonulin， interleukin-6 （IL-6）， tumor necrosis factor-α （TNF-α）， interleukin-1β （IL-1β）， γ-aminobutyric acid （GABA） levels in the hippocampus and prefrontal cortex， and brain-derived neurotrophic factor （BDNF） levels in the hippocampus. Real-time quantitative polymerase chain reaction （Real-time PCR） was used to detect hippocampal BDNF mRNA expression. Serum alanine aminotransferase （ALT） and aspartate aminotransferase （AST） levels were measured using the ultraviolet lactate dehydrogenase method. The ultrastructure of the intestinal epithelium was observed by electron microscopy， and gut microbiota in rat feces were analyzed using 16S rDNA high-throughput sequencing. ResultsCompared with the normal group， the sucrose preference of rats in the model group was significantly reduced （P0.01）， whereas it was significantly increased in the Sini San group compared with the model group （P0.05）. Compared with the normal group， hippocampal GABA protein levels and BDNF mRNA expression in the model group were significantly decreased （P0.05）， and compared with the model group， both were significantly increased in the Sini San group （P0.05， P0.01）. Compared with the normal group， serum LPS and Zonulin levels in the model group were significantly increased （P0.05， P0.01）， and compared with the model group， Zonulin levels in the Sini San group were significantly decreased （P0.05）. No obvious changes were observed in the ultrastructure of the jejunal mucosa among groups. Compared with the normal group， widened and blurred tight junctions， sparse and shortened microvilli， and mitochondrial swelling with cristae disruption in epithelial cells were observed in the ileal and colonic mucosa of the model group， which were markedly improved in the Sini San and fluoxetine groups. The results of 16S rDNA high-throughput sequencing showed that Sini San improved CUMS-induced dysbiosis of Bacteroidetes and Proteobacteria. Correlation analysis indicated that Bacteroidetes and Proteobacteria were significantly correlated with depression-related indicators， liver function， and intestinal mucosal permeability. ConclusionSini San exerts antidepressant and hepatoprotective effects by improving Bacteroidetes and Proteobacteria and inhibiting the increase in intestinal mucosal permeability in CUMS rats.

ObjectiveTo explore the efficacy and mechanisms of Sini San in the treatment of depression and liver injury based on gut microbiota. MethodsThirty-two male Sprague-Dawley （SD） rats were randomly divided into a normal group， model group （M）， Sini San group （MS， 2.5 g·kg^-1）， and fluoxetine group （MF， 2 mg·kg^-1）. Except for the normal group， rats in the other three groups were subjected to chronic unpredictable mild stress （CUMS）. After 8 weeks， the open-field test and sucrose preference test were conducted. Enzyme-linked immunosorbent assay （ELISA） was used to detect serum corticosterone （CORT）， adrenocorticotropic hormone （ACTH）， corticotropin-releasing factor （CRF）， lipopolysaccharide （LPS）， Zonulin， interleukin-6 （IL-6）， tumor necrosis factor-α （TNF-α）， interleukin-1β （IL-1β）， γ-aminobutyric acid （GABA） levels in the hippocampus and prefrontal cortex， and brain-derived neurotrophic factor （BDNF） levels in the hippocampus. Real-time quantitative polymerase chain reaction （Real-time PCR） was used to detect hippocampal BDNF mRNA expression. Serum alanine aminotransferase （ALT） and aspartate aminotransferase （AST） levels were measured using the ultraviolet lactate dehydrogenase method. The ultrastructure of the intestinal epithelium was observed by electron microscopy， and gut microbiota in rat feces were analyzed using 16S rDNA high-throughput sequencing. ResultsCompared with the normal group， the sucrose preference of rats in the model group was significantly reduced （P<0.01）， whereas it was significantly increased in the Sini San group compared with the model group （P<0.05）. Compared with the normal group， hippocampal GABA protein levels and BDNF mRNA expression in the model group were significantly decreased （P<0.05）， and compared with the model group， both were significantly increased in the Sini San group （P<0.05， P<0.01）. Compared with the normal group， serum LPS and Zonulin levels in the model group were significantly increased （P<0.05， P<0.01）， and compared with the model group， Zonulin levels in the Sini San group were significantly decreased （P<0.05）. No obvious changes were observed in the ultrastructure of the jejunal mucosa among groups. Compared with the normal group， widened and blurred tight junctions， sparse and shortened microvilli， and mitochondrial swelling with cristae disruption in epithelial cells were observed in the ileal and colonic mucosa of the model group， which were markedly improved in the Sini San and fluoxetine groups. The results of 16S rDNA high-throughput sequencing showed that Sini San improved CUMS-induced dysbiosis of Bacteroidetes and Proteobacteria. Correlation analysis indicated that Bacteroidetes and Proteobacteria were significantly correlated with depression-related indicators， liver function， and intestinal mucosal permeability. ConclusionSini San exerts antidepressant and hepatoprotective effects by improving Bacteroidetes and Proteobacteria and inhibiting the increase in intestinal mucosal permeability in CUMS rats.

Background Microparticles (MPs) are one of the main medium of inflammatory reaction with an important role in atherosclerotic progression. Studies on association of air pollution exposure and levels of peripheral blood MPs are limited among human. Objective To evaluate the effects of short-term exposure to air pollution on levels of peripheral blood MPs. Method A panel of 73 healthy adults was followed with 4 repeated follow-ups in Beijing, China, from November 2014 to January 2016. During each visit, we collected questionnaire information, fasting venous blood, urine, and exposures to fine particulate matter (PM_2.5), black carbon, nitric oxide, nitrogen dioxide, nitrogen oxide, sulfur dioxide, carbon monoxide, and ozone. We used linear mixed-effect models to analyze associations of air pollution exposure with levels of total MPs (TMPs) and MPs derived from various cells. Stratified analysis was conducted by levels of C-reactive protein (CRP) and malondialdehyde (MDA). Results The results showed significant associations between air pollution exposure and peripheral blood TMPs at 2 h-6 d prior to the follow-ups (P<0.05), while no statistical associations were found for MPs derived from different cell types. Significant increases in TMPs of 7.8% (95%CI: 0.7%, 15.3%) and 14.3% (95%CI: 2.8%, 27.2%) were observed with each interquartile range (IQR) increase in PM_2.5 (IQR=64.9 μg·m⁻³) at prior 18 h and NO (IQR=40.5 μg·m⁻³) at prior 48 h. Among participants with low levels of CRP and MDA, significantly positive associations were observed between air pollution exposure and levels of TMPs (P<0.05). Conclusion Short-term exposure to air pollution is significantly associated with increased levels of circulating MPs in healthy adults, and in people with lower systemic inflammation, peripheral blood MPs levels are more easily affected after exposure to air pollutants.

Objective To gain insights into the biological characteristics of different populations of Culex tritaeniorhynchus within and around the Yellow Sea wetland from the perspective of the occurrence of resistance, we investigated the levels of resistance to deltamethrin and kdr gene mutation in the wetland and its peripheral areas. Methods Specimens were collected from Cx. tritaeniorhynchus populations at two monitoring sites in the Rare Bird National Nature Reserve and Tiaozi Ni Wetland Scenic Area, and also from two populations in Yancheng City and the Liuhe District of Nanjing, and the resistance of these mosquitoes to deltamethrin was determined using the CDC biotest bottle method. For each concentration of deltamethrin assessed, a random subset of exposed specimens was selected for amplification of the kdr gene fragment, followed by Sanger sequencing to identify and analyze resistance-associated mutations. Results The LC50 levels of deltamethrin among mosquitoes from the four populations in Luhe, Yancheng, the Rare Bird National Nature Reserve and the Tiaozi Ni Wetland Scenic Area were 2.048 5, 7.798 2, 3.473 3, and 17.695 5 mg/mL, respectively, with corresponding concentrations of deltamethrin ranging from 0.005 to 5.000,0.050 to 50.000,0.050 to 25.000 and 0.050 to 50.000 mg/mL, respectively. Furthermore, the ranges of the KT50 values were 11.76-107.43, 67.05-216.30,29.77-107.43 and 28.40-329.51 min; the 1-h knockdown rates were 34.58%-99.15%, 9.52%-43.80%, 55.09%-73.01%, and 10.09%-68.07%; and the 24-h mortality rates were 12.15%-67.52%,9.52%-79.56%,13.17%-82.21%, and 11.01%-78.99%, respectively. With respect to kdr gene mutation, we assayed a total of 63,70,59, and 57 mosquitoes for the four populations, for which we detected L1014F mutation frequencies of 14.29%, 35.00%, 20.34%, and 31.58%, respectively, with a majority of these mutations being heterozygous for resistance. In addition, five adult mosquitoes were identified has having synonymous mutations at site 1011[i. e. , AAT(asparagine)mutation to AAC(asparagine)]. Conclusions Our findings revealed the clear resistance of Cx. tritaeniorhynchus to deltamethrin in the Yancheng region of the Yellow Sea wetland, and the resistance phenotype and kdr frequency of Cx. tritaeniorhynchus in the wetland environment were comparable to those of Cx. tritaeniorhynchus in the wetland environment, thereby indicating that the resistance of different populations of Cx. tritaeniorhynchus was homogeneous under the pressure of different insecticide selection within and around the wetland. However, the underlying mechanisms need to be further studied.

Objective: To assess the status of sexual behaviors, HIV/AIDS knowledge awareness, and novel synthetic drug use among school attending young students in Guangdong Province, so as to provide evidence base for formulating targeted intervention strategies. Methods: From September to December 2024, a convenience sampling method was employed to conduct an anonymous online survey among 41 119 students from 20 higher education institutions and vocational colleges in Guangdong Province. Chi square test was utilized for rate comparisons and univariate analysis, and a multivariate Logistic regression model was applied to analyze factors associated with novel synthetic drug use. Results: The self reported rate of sexual behavior was 5.2%. Among sexually active students, the rates of unprotected sexual intercourse, having temporary sexual partners, and having commercial sexual partners were 32.4%, 34.5%, and 26.3%, respectively. The awareness rate of HIV related knowledge was 75.7%. The overall use rate of novel psychoactive substances(NPS) was 1.0%, and among sexually active students it was 6.5%. Multivariate Logistic regression analysis showed that students with sexual experience ( OR =4.15) and those with HIV testing history ( OR =9.38) had higher risks of NPS use; among sexually active students, those with unprotected sexual intercourse ( OR =6.83) and those with commercial sexual partners ( OR = 4.68 ) had higher risks of NPS use (all P <0.05). Conclusions The HIV/AIDS knowledge level among surveyed students needs further improvement, and high risk sexual behaviors are cross linked with novel synthetic drug use. It is recommended to carry out integrated health education for all students and implement comprehensive targeted interventions for sexually active students.

BackgroundPatients with bipolar disorder exhibit persistent cognitive impairment across multiple domains， including executive function， memory， and attention. Furthermore， those with mixed features tend to have a poorer prognosis. Currently， research evidence regarding the characteristics of cognitive function and event-related potential P300， as well as their correlation， in patients with depressive episodes of bipolar disorder with mixed features remains limited. ObjectiveTo explore the correlation between cognitive function and event-related potential P300 in patients with depressive episodes of bipolar disorder with mixed features， analyze the influencing factors of cognitive function， so as to provide references for the improvement of cognitive function in this subtype of patients. MethodsA total of 73 patients who met the diagnostic criteria for depressive episodes of bipolar disorder in the Diagnostic and Statistical Manual of Mental Disorders， fifth edition （DSM-5） were enrolled from the outpatient and inpatient departments of Tianjin Anding Hospital from November 2021 to April 2024. The Hamilton Depression Scale-17 item（HAMD-17） was used to assess the severity of depressive symptoms， and the Clinically Useful Depression Outcome Scale Supplemented with Questions for the DSM-5 Mixed Features Specifier （CUDOS-M） was used to evaluate whether patients presented with mixed features. Based on the CUDOS-M total scores， patients were divided into two groups： the mixed features group （n=34） and the non-mixed features group （n=39）. The MATRICS Consensus Cognitive Battery （MCCB） was used to assess cognitive function， and auditory event-related potential P300 testing was performed. Spearman correlation analysis was used to examine the correlations between P300 indicators and MCCB scores. Multiple linear regression analysis was conducted to investigate the influencing factors of cognitive function. ResultsPatients with depressive episodes of bipolar disorder with mixed features had a longer total illness duration than those without mixed features， and the difference was statistically significant （t=2.030， P<0.05）. Analysis of covariance showed that the MCCB scores for processing speed， attention/vigilance， and reasoning and problem solving were all lower in the mixed features group than those in the non-mixed features group （F=3.650， 3.520， 4.213， P<0.01）. However， no significant difference was found between the two groups in P300 latency or amplitude （P>0.05）. Correlation analysis revealed that the MCCB attention/vigilance score was negatively correlated with P300 latency in patients with depressive episodes of bipolar disorder with mixed features （r_s=-0.576， P<0.01）. Multiple linear regression analysis showed that， in the mixed features group， years of education positively predicted processing speed （β=0.378， P<0.05）， while P300 latency （β=-0.699， P<0.01） and age （β=-0.424， P<0.01） negatively predicted attention/vigilance function. ConclusionPatients with depressive episodes of bipolar disorder with mixed features have a longer illness duration and more severe impairment in three cognitive domains： processing speed， attention/vigilance， and reasoning and problem solving. P300 latency may be an influencing factor of attention/vigilance function in patients with depressive episodes of bipolar disorder with mixed features ［Funded by Tianjin Key Medical Discipline Construction Project （number， TJYXZDXK-3-015B）； Hospital-level Scientific Research Project of Tianjin Anding Hospital （number， ADYKHT2021010）］

Objective: To investigate the effects of different storage temperatures and durations on the activities of coagulation factor Ⅷ (Factor Ⅷ, FⅧ) and coagulation factor Ⅸ (Factor Ⅸ, FⅨ) after whole blood collection, so as to provide data support for the optimal storage conditions. Methods: A total of 16 mL of whole blood was collected from each of the 20 healthy volunteers at our blood center and aliquoted into 8 sodium citrate anticoagulant tubes. Two tubes were immediately centrifuged for the measurement of FⅧ and FⅨ activity levels. The remaining 6 tubes of whole blood were respectively stored under room temperature and low-temperature conditions. At 2, 4, and 6 h, the whole blood samples were centrifuged and analyzed for FⅧ and FⅨ activity levels. The mean values of the two immediately tested tubes were used as the control group, while other tubes were designated as the experimental groups for comparison. Statistical analysis was performed using SPSS 26.0. Results: The activity of FⅧ in whole blood remained stable after 4 hours of storage at both room temperature and low temperature (116.53±25.95 vs 125.22±27.33, 109.77±23.23 vs 125.22±27.33) (P>0.05 for both). However, by 6 hours, FⅧ activity showed a statistically significant decline compared to the control group (108.65±22.92 vs 125.22±27.33, 100.46±20.19 vs 125.22±27.33) (P<0.05 for both), though the room temperature group results were closer to the control values. The activity of FⅨ in whole blood remained stable after 6 hours of storage under both conditions (97.14±19.48 vs 96.76±19.67, 97.10±17.45 vs 96.76±19.6) (P>0.05 for all comparisons). Conclusion: For whole blood samples after collection, storage at either room temperature or low temperature for up to 4 hours does not compromise the accuracy of test results. When stored for 6 hours, FⅨ activity remains stable, whereas FⅧ activity decreases significantly. Notably, FⅧ activity demonstrates better stability at room temperature than under low-temperature conditions within the 6-hour storage.

Using Real-time PCR technology, a highly specific and sensitive method for detecting DNA residues of Escherichia coli host cells in levodopa was established, validated, and preliminarily applied. Escherichia coli strain MB6 16S ribosomal RNA gene was selected as the target gene to design multiple pairs of primers and the target fragment by specific amplification of PCR was obtained. The target fragment was cloned into the pLENTI-BSD-CON vector and the recombinant plasmid was constructed and named pLENTI-BSD-CON-E.coli-16S. A quantitative PCR detection method (SYBR Green method) with magnetic bead extraction and purification methods was established with the reference standard of the recombinant plasmid. Furthermore, the established method was validated, including linear and range, accuracy, precision, specificity, and quantification limit, and applied to the detection of levodopa raw materials. Meanwhile, the detection method was compared with the Taqman probe method by the commercial kit. The primer sequences of the quantitative PCR detection method (SYBR Green method) were TTCGATGCAACGCGAAGAAC (forward) and GTGTAGCCCTGGTCGTAAGG (reverse). The standard curve of DNA was in the range of 10 fg/μL to 3 ng/μL with good linearity (R2≥ 0.98). The quantitative limit was 10 fg/μL. In addition, the detection recovery rate was in the range of 59.7% to 80.7%, with RSD at less than 15%. Nine batches of levodopa were detected by this method, and the amount of E.coli DNA residue was below the limit. The developed qPCR method can be used for quantitative detection of residual DNA in biological products produced by E.coli as host cells, such as levodopa . The results indicate that the sensitivity of the detection method for recombinant plasmid construction standards is superior than the reagent kit detection method.