1.Metabolomics combined with network pharmacology reveals mechanism of Jiaotai Pills in treating depression.
Guo-Liang DAI ; Ze-Yu CHEN ; Yan-Jun WANG ; Xin-Fang BIAN ; Yu-Jie CHEN ; Bing-Ting SUN ; Xiao-Yong WANG ; Wen-Zheng JU
China Journal of Chinese Materia Medica 2025;50(5):1340-1350
This study aims to explore the mechanism of Jiaotai Pills in treating depression based on metabolomics and network pharmacology. The chemical constituents of Jiaotai Pills were identified by UHPLC-Orbitrap Exploris 480, and the targets of Jiaotai Pills and depression were retrieved from online databases. STRING and Cytoscape 3.7.2 were used to construct the protein-protein interaction network of core targets of Jiaotai Pills in treating depression and the "compound-target-pathway" network. DAVID was used for Gene Ontology(GO) function and Kyoto Encyclopedia of Genes and Genomes(KEGG) pathway enrichment analyses of the core targets. The mouse model of depression was established with chronic unpredictable mild stress(CUMS) and treated with different doses of Jiaotai Pills. The behavioral changes and pathological changes in the hippocampus were observed. UHPLC-Orbitrap Exploris 120 was used for metabolic profiling of the serum, from which the differential metabolites and related metabolic pathways were screened. A "metabolite-reaction-enzyme-gene" network was constructed for the integrated analysis of metabolomics and network pharmacology. A total of 34 chemical components of Jiaotai Pills were identified, and 143 core targets of Jiaotai Pills in treating depression were predicted, which were mainly involved in the arginine and proline, sphingolipid, and neurotrophin metabolism signaling pathways. The results of animal experiments showed that Jiaotai Pills alleviated the depression behaviors and pathological changes in the hippocampus of the mouse model of CUMS-induced depression. In addition, Jiaotai Pills reversed the levels of 32 metabolites involved in various pathways such as arginine and proline metabolism, sphingolipid metabolism, and porphyrin metabolism in the serum of model mice. The integrated analysis showed that arginine and proline metabolism, cysteine and methionine metabolism, and porphyrin metabolism might be the key pathways in the treatment of depression with Jiaotai Pills. In conclusion, metabolomics combined with network pharmacology clarifies the antidepressant mechanism of Jiaotai Pills, which may provide a basis for the clinical application of Jiaotai Pills in treating depression.
Animals
;
Drugs, Chinese Herbal/chemistry*
;
Depression/genetics*
;
Mice
;
Network Pharmacology
;
Metabolomics
;
Male
;
Disease Models, Animal
;
Humans
;
Protein Interaction Maps/drug effects*
;
Antidepressive Agents
2.Tetrahydropalmatine acts on α7nAChR to regulate inflammation and polarization of BV2 microglia.
Yan-Jun WANG ; Guo-Liang DAI ; Pei-Yao CHEN ; Hua-Xi HANG ; Xin-Fang BIAN ; Yu-Jie CHEN ; Wen-Zheng JU
China Journal of Chinese Materia Medica 2025;50(11):3117-3126
Based on the α7 nicotinic acetylcholine receptor(α7nAChR), this study examined how tetrahydropalmatine(THP) affected BV2 microglia exposed to lipopolysaccharide(LPS), aiming to clarify the possible mechanism underlying the anti-depression effect of THP from the perspectives of preventing inflammation and regulating polarization. First, after molecular docking and determination of the content of Corydalis saxicola Bunting total alkaloids, THP was initially identified as a possible anti-depression component. The BV2 microglia model of inflammation was established with LPS. BV2 microglia were allocated into a normal group, a model group, low-and high-dose(20 and 40 μmol·L~(-1), respectively) THP groups, and a THP(20 μmol·L~(-1))+α7nAChR-specific antagonist MLA(1 μmol·L~(-1)) group. The CCK-8 assay was used to screen the safe concentration of THP. A light microscope was used to examine the morphology of the cells. Western blot and immunofluorescence were used to determine the expression of α7nAChR. qRT-PCR was performed to determine the mRNA levels of inducible nitric oxide synthase(iNOS), cluster of differentiation 86(CD86), suppressor of cytokine signaling 3(SOCS3), arginase-1(Arg-1), cluster of differentiation 206(CD206), tumor necrosis factor(TNF)-α, interleukin(IL)-6, and IL-1β. Enzyme-linked immunosorbent assay(ELISA) was employed to measure the levels of TNF-α, IL-6, and IL-1β in the cell supernatant. The experimental results showed that THP at concentrations of 40 μmol·L~(-1) and below had no effect on BV2 microglia. THP improved the morphology of BV2 microglia, significantly up-regulated the protein level of α7nAChR, significantly down-regulated the mRNA levels of iNOS, CD86, SOCS3, TNF-α, IL-6, and IL-1β, significantly up-regulated the mRNA levels of Arg-1 and CD206, and dramatically lowered the levels of TNF-α, IL-6, and IL-1β in the cell supernatant. However, the antagonist MLA abolished the above-mentioned ameliorative effects of THP on LPS-treated BV2 microglia. As demonstrated by the aforementioned findings, THP protected LPS-treated BV2 microglia by regulating the M1/M2 polarization and preventing inflammation, which might be connected to the regulation of α7nAChR on BV2 microglia.
Berberine Alkaloids/chemistry*
;
alpha7 Nicotinic Acetylcholine Receptor/chemistry*
;
Microglia/metabolism*
;
Mice
;
Animals
;
Cell Line
;
Corydalis/chemistry*
;
Humans
;
Molecular Docking Simulation
;
Inflammation/drug therapy*
;
Nitric Oxide Synthase Type II/immunology*
;
Tumor Necrosis Factor-alpha/immunology*
3.Innovation and application of traditional Chinese medicine dispensing promoted through integration of whole-process data elements.
Huan-Fei YANG ; Si-Yu LI ; Chen-Qian YU ; Jian-Kun WU ; Fang LIU ; Li-Bin JIANG ; Chun-Jin LI ; Xiang-Fei SU ; Wei-Guo BAI ; Hua-Qiang ZHAI ; Shi-Yuan JIN ; Yong-Yan WANG
China Journal of Chinese Materia Medica 2025;50(11):3189-3196
As a new type of production factor that can empower the development of new quality productivity, the data element is an important engine to promote the high quality development of the industry. Traditional Chinese medicine(TCM) dispensing is the most basic work of TCM clinical pharmacy, and its quality directly affects the clinical efficacy of TCM. The integration of data elements and TCM dispensing can stimulate the innovation and vitality of the TCM dispensing industry and promote the high-quality and sustainable development of the industry. A large-scale, detailed, and systematic study on TCM dispensing was conducted. The innovative practice path of data fusion construction in the whole process of TCM dispensing was investigated by integrating the digital resources "nine full activities" of TCM dispensing, creating the digital dictionary of "TCM clinical information data elements", and exploring innovative applications of TCM dispensing driven by data and technology, so as to promote the standardized, digital, and intelligent development of TCM dispensing in medical health services. The research content of this project was successfully selected as the second batch of "Data element×" typical cases of National Data Administration in 2024, which is the only selected case in the field of TCM.
Medicine, Chinese Traditional/methods*
;
Drugs, Chinese Herbal
;
Humans
4.Quality evaluation of Bidentis Herba derived from different original plants based on HPLC fingerprints, characteristic chromatograms, multi-component content determination combined with chemical pattern recognition.
Guo-Li SHI ; Yun MA ; Feng-Xia SHEN ; Han-Wen DU ; Cong-Min LIU ; Rui-Xia WEI ; Yan-Fang LI ; Jian-Wei FAN ; Yong-Xia GUAN
China Journal of Chinese Materia Medica 2025;50(15):4284-4292
This study established the HPLC fingerprints, characteristic chromatograms, and a multi-component content determination method for Bidens bipinnata and B. biternata. The chemical pattern recognition analysis was then employed to clarify the characteristic indexes of quality differences between the two original plants of Bidentis Herba, providing a reference for establishing the quality standards of Bidentis Herba. HPLC was launched on an Agilent Poroshell 120 EC-C_(18) chromatographic column(4.6 mm×250 mm, 4 μm) by gradient elution with a mobile phase of 0.1% aqueous phosphoric acid-acetonitrile at a flow rate of 0.7 mL·min~(-1), detection wavelength of 270 nm, column temperature of 25 ℃, and an injection volume of 5 μL. The similarity between the fingerprints of 18 batches of Bidentis Herba samples and the common pattern(R) ranged from 0.572 to 0.933. A total of 23 chromatographic peaks were calibrated. Through comparison with the reference substances, six components(neochlorogenic acid, chlorogenic acid, isochlorogenic acid A, isochlorogenic acid B, rutin, and hyperoside) were identified and subjected to quantitative analysis. The characteristic fingerprints of B. bipinnata and B. biternata were calibrated with 20 and 17 characteristic peaks, respectively. Among them, peaks 8, 9, 22, and 23 were the characteristic peaks of B. bipinnata, and peak 7 was the characteristic peak of B. biternata, which can be used to distinguish the two original plants of Bidentis Herba. The relative standard deviation of the content of the above-mentioned six components ranged from 36% to 123%. The cluster analysis, principal component analysis, and orthogonal partial least squares-discriminant analysis(OPLS-DA) classified the 18 batches of Bidentis Herba samples into two categories. Additionally, through the analysis of variable importance in projection(VIP) under OPLS-DA, three characteristic indexes, rutin, isochlorogenic acid A, and isochlorogenic acid B, were identified. The analytical method established in this study can comprehensively evaluate the consistency of Bidentis Herba samples derived from different original plants, specifically identify the differential components between them, and effectively distinguish the two original plants of Bidentis Herba, providing a basis for the differentiation between different original plants and the quality control of Bidentis Herba.
Chromatography, High Pressure Liquid/methods*
;
Drugs, Chinese Herbal/chemistry*
;
Quality Control
;
Bidens/chemistry*
5.Ablation of IGFBP5 expression alleviates neurogenic erectile dysfunction by inducing neurovascular regeneration
Jiyeon OCK ; Guo Nan YIN ; Fang-Yuan LIU ; Yan HUANG ; Fitri Rahma FRIDAYANA ; Minh Nhat VO ; Ji-Kan RYU
Investigative and Clinical Urology 2025;66(1):74-86
Purpose:
To investigate the therapeutic potential of eliminating insulin-like growth factor-binding protein 5 (IGFBP5) expression in improving erectile function in mice with cavernous nerve injury (CNI)-induced erectile dysfunction (ED).
Materials and Methods:
Eight-week-old male C57BL/6 mice were divided into four groups: a sham-operated group and three CNI-induced ED groups. The CNI-induced ED groups were treated with intracavernous injections 3 days before the CNI procedure.These injections included phosphate-buffered saline, scrambled control short hairpin RNA (shRNA), or shRNA targeting mouse IGFBP5 lentiviral particles. One week after CNI, erectile function was evaluated and the penile tissue was then harvested for histological examination and western blot analysis. Additionally, the major pelvic ganglia (MPG) and dorsal root ganglia (DRG) were cultured for ex vivo neurite outgrowth assays.
Results:
Following CNI, IGFBP5 expression in the cavernous tissues significantly increased, reaching its peak at day 7. First, ablation of IGFBP5 expression promotes neurite sprouting in MPG and DRG when exposed to lipopolysaccharide. Second, ablating IGFBP5 expression in CNI-induced ED mice improved erectile function, likely owing to increased neurovascular contents, including endothelial cells, pericytes, and neuronal processes. Third, ablating IGFBP5 expression in CNI-induced ED mice promoted neurovascular regeneration by increasing cell proliferation, reducing apoptosis, and decreasing Reactive oxygen species production. Finally, western blot analysis demonstrated that IGFBP5 ablation attenuated the JNK/c-Jun signaling pathway, activated the PI3K/AKT signaling pathway, and increased vascular endothelial growth factor and neurotrophic factor expression.
Conclusions
Ablating IGFBP5 expression enhanced neurovascular regeneration and ultimately improved erectile function in CNI-induced ED mice.
6.Detection of residual DNA in host cells of Escherichia coli in levodopa by Real-time PCR
Bingyu XU ; YAN LIU ; Xinyao GUO ; Fang YAN ; Guibin SUN
Journal of China Pharmaceutical University 2025;56(2):176-182
Using Real-time PCR technology, a highly specific and sensitive method for detecting DNA residues of Escherichia coli host cells in levodopa was established, validated, and preliminarily applied. Escherichia coli strain MB6 16S ribosomal RNA gene was selected as the target gene to design multiple pairs of primers and the target fragment by specific amplification of PCR was obtained. The target fragment was cloned into the pLENTI-BSD-CON vector and the recombinant plasmid was constructed and named pLENTI-BSD-CON-E.coli-16S. A quantitative PCR detection method (SYBR Green method) with magnetic bead extraction and purification methods was established with the reference standard of the recombinant plasmid. Furthermore, the established method was validated, including linear and range, accuracy, precision, specificity, and quantification limit, and applied to the detection of levodopa raw materials. Meanwhile, the detection method was compared with the Taqman probe method by the commercial kit. The primer sequences of the quantitative PCR detection method (SYBR Green method) were TTCGATGCAACGCGAAGAAC (forward) and GTGTAGCCCTGGTCGTAAGG (reverse). The standard curve of DNA was in the range of 10 fg/μL to 3 ng/μL with good linearity (R2≥ 0.98). The quantitative limit was 10 fg/μL. In addition, the detection recovery rate was in the range of 59.7% to 80.7%, with RSD at less than 15%. Nine batches of levodopa were detected by this method, and the amount of E.coli DNA residue was below the limit. The developed qPCR method can be used for quantitative detection of residual DNA in biological products produced by E.coli as host cells, such as levodopa . The results indicate that the sensitivity of the detection method for recombinant plasmid construction standards is superior than the reagent kit detection method.
7.Predicting model for the impact of Internet usage characteristics on suicidal ideation among vocational high school students
YU Bin, YAN Jingyan, ZHANG Liqun, XIAO Chenchang, LI Fang, GUO Yan, YAN Hong
Chinese Journal of School Health 2025;46(8):1175-1179
Objective:
To explore the association between the Internet usage characteristics and suicidal ideation among vocational high school students, so as to provide a theoretical basis for precise intervention of suicide among vocational high school students.
Methods:
A total of 1 781 students were recruited from three vocational high schools in Wuhan and Xianning in March 2023 by using the cluster random sampling method. The Columbia-Suicide Severity Rating Scale and Revised Chen Internet Addiction Scale were used to measure suicidal ideation and Internet addiction, respectively. LASSO regression model was used to select influential factors related to suicidal ideation, and the gradient boosting decision tree algorithm XGBoost was used to develop prediction models and evaluate predictive performance. By calculating the SHAP values, the contribution of each influential factor was quantified.
Results:
The prevalence of suicidal ideation among vocational high school students was 42.22% and prevalence of Internet addiction was 26.39%. LASSO regression results indicated that age, gender, experience of being left behind, parental relationship, holding a class cadre position, using the Internet for learning, Internet use during dawn, morning and late night, Internet addiction, and depressive symptoms were all the influential factors of suicidal ideation among vocational high school students ( β= -0.05 , 0.29, 0.09, 0.27, 0.10, -0.01, 0.09, 0.05, 0.24, 0.28, 0.78, all P <0.05). The AUC of the prediction model was 0.75. The results based on SHAP values indicated that all influential factors identified through multivariate analysis contributed positively to the model predictions ( SHAP >0). Among these, depressive symptoms and parental relationship had the greatest impact on suicidal ideation ( SHAP =0.77, 0.26), and the joint effect of features with higher contribution could improve the prediction probability.
Conclusions
Depressive symptoms, parental relationships, Internet addiction, and time of Internet use are most important risk factors of suicidal behaviors for vocational high school students. Thus, effective interventions should be conducted to reduce their suicidal ideation.
8.Potential utility of albumin-bilirubin and body mass index-based logistic model to predict survival outcome in non-small cell lung cancer with liver metastasis treated with immune checkpoint inhibitors.
Lianxi SONG ; Qinqin XU ; Ting ZHONG ; Wenhuan GUO ; Shaoding LIN ; Wenjuan JIANG ; Zhan WANG ; Li DENG ; Zhe HUANG ; Haoyue QIN ; Huan YAN ; Xing ZHANG ; Fan TONG ; Ruiguang ZHANG ; Zhaoyi LIU ; Lin ZHANG ; Xiaorong DONG ; Ting LI ; Chao FANG ; Xue CHEN ; Jun DENG ; Jing WANG ; Nong YANG ; Liang ZENG ; Yongchang ZHANG
Chinese Medical Journal 2025;138(4):478-480
9.Current status of generalized pustular psoriasis: Findings from a multicenter hospital-based survey of 127 Chinese patients.
Haimeng WANG ; Jiaming XU ; Xiaoling YU ; Siyu HAO ; Xueqin CHEN ; Bin PENG ; Xiaona LI ; Ping WANG ; Chaoyang MIAO ; Jinzhu GUO ; Qingjie HU ; Zhonglan SU ; Sheng WANG ; Chen YU ; Qingmiao SUN ; Minkuo ZHANG ; Bin YANG ; Yuzhen LI ; Zhiqiang SONG ; Songmei GENG ; Aijun CHEN ; Zigang XU ; Chunlei ZHANG ; Qianjin LU ; Yan LU ; Xian JIANG ; Gang WANG ; Hong FANG ; Qing SUN ; Jie LIU ; Hongzhong JIN
Chinese Medical Journal 2025;138(8):953-961
BACKGROUND:
Generalized pustular psoriasis (GPP), a rare and recurrent autoinflammatory disease, imposes a substantial burden on patients and society. Awareness of GPP in China remains limited.
METHODS:
This cross-sectional survey, conducted between September 2021 and May 2023 across 14 hospitals in China, included GPP patients of all ages and disease phases. Data collected encompassed demographics, clinical characteristics, economic impact, disease severity, quality of life, and treatment-related complications. Risk factors for GPP recurrence were analyzed.
RESULTS:
Among 127 patients (female/male ratio = 1.35:1), the mean age of disease onset was 25 years (1st quartile [Q1]-3rd quartile [Q3]: 11-44 years); 29.2% had experienced GPP for more than 10 years. Recurrence occurred in 75.6% of patients, and nearly half reported no identifiable triggers. Younger age at disease onset ( P = 0.021) and transitioning to plaque psoriasis ( P = 0.022) were associated with higher recurrence rates. The median diagnostic delay was 8 months (Q1-Q3: 2-41 months), and 32.3% of patients reported misdiagnoses. Comorbidities were present in 53.5% of patients, whereas 51.1% experienced systemic complications during treatment. Depression and anxiety affected 84.5% and 95.6% of patients, respectively. During GPP flares, the median Dermatology Life Quality Index score was 19.0 (Q1-Q3: 13.0-23.5). This score showed significant differences between patients with and without systemic symptoms; it demonstrated correlations with both depression and anxiety scores. Treatment costs caused financial hardship in 55.9% of patients, underscoring the burden associated with GPP.
CONCLUSIONS
The substantial disease and economic burdens among Chinese GPP patients warrant increased attention. Patients with early onset disease and those transitioning to plaque psoriasis require targeted interventions to mitigate the high recurrence risk.
Humans
;
Male
;
Female
;
Psoriasis/pathology*
;
Adult
;
Cross-Sectional Studies
;
Adolescent
;
Child
;
Young Adult
;
Quality of Life
;
Middle Aged
;
China/epidemiology*
;
Recurrence
;
Risk Factors
;
Surveys and Questionnaires
;
East Asian People
10.Guidelines for the diagnosis and treatment of prurigo nodularis.
Li ZHANG ; Qingchun DIAO ; Xia DOU ; Hong FANG ; Songmei GENG ; Hao GUO ; Yaolong CHEN ; Chao JI ; Chengxin LI ; Linfeng LI ; Jie LI ; Jingyi LI ; Wei LI ; Zhiming LI ; Yunsheng LIANG ; Jianjun QIAO ; Zhiqiang SONG ; Qing SUN ; Juan TAO ; Fang WANG ; Zhiqiang XIE ; Jinhua XU ; Suling XU ; Hongwei YAN ; Xu YAO ; Jianzhong ZHANG ; Litao ZHANG ; Gang ZHU ; Fei HAO ; Xinghua GAO
Chinese Medical Journal 2025;138(22):2859-2861


Result Analysis
Print
Save
E-mail