Purpose: To investigate the therapeutic potential of eliminating insulin-like growth factor-binding protein 5 (IGFBP5) expression in improving erectile function in mice with cavernous nerve injury (CNI)-induced erectile dysfunction (ED). Materials and Methods: Eight-week-old male C57BL/6 mice were divided into four groups: a sham-operated group and three CNI-induced ED groups. The CNI-induced ED groups were treated with intracavernous injections 3 days before the CNI procedure.These injections included phosphate-buffered saline, scrambled control short hairpin RNA (shRNA), or shRNA targeting mouse IGFBP5 lentiviral particles. One week after CNI, erectile function was evaluated and the penile tissue was then harvested for histological examination and western blot analysis. Additionally, the major pelvic ganglia (MPG) and dorsal root ganglia (DRG) were cultured for ex vivo neurite outgrowth assays. Results: Following CNI, IGFBP5 expression in the cavernous tissues significantly increased, reaching its peak at day 7. First, ablation of IGFBP5 expression promotes neurite sprouting in MPG and DRG when exposed to lipopolysaccharide. Second, ablating IGFBP5 expression in CNI-induced ED mice improved erectile function, likely owing to increased neurovascular contents, including endothelial cells, pericytes, and neuronal processes. Third, ablating IGFBP5 expression in CNI-induced ED mice promoted neurovascular regeneration by increasing cell proliferation, reducing apoptosis, and decreasing Reactive oxygen species production. Finally, western blot analysis demonstrated that IGFBP5 ablation attenuated the JNK/c-Jun signaling pathway, activated the PI3K/AKT signaling pathway, and increased vascular endothelial growth factor and neurotrophic factor expression. Conclusions Ablating IGFBP5 expression enhanced neurovascular regeneration and ultimately improved erectile function in CNI-induced ED mice.

Using Real-time PCR technology, a highly specific and sensitive method for detecting DNA residues of Escherichia coli host cells in levodopa was established, validated, and preliminarily applied. Escherichia coli strain MB6 16S ribosomal RNA gene was selected as the target gene to design multiple pairs of primers and the target fragment by specific amplification of PCR was obtained. The target fragment was cloned into the pLENTI-BSD-CON vector and the recombinant plasmid was constructed and named pLENTI-BSD-CON-E.coli-16S. A quantitative PCR detection method (SYBR Green method) with magnetic bead extraction and purification methods was established with the reference standard of the recombinant plasmid. Furthermore, the established method was validated, including linear and range, accuracy, precision, specificity, and quantification limit, and applied to the detection of levodopa raw materials. Meanwhile, the detection method was compared with the Taqman probe method by the commercial kit. The primer sequences of the quantitative PCR detection method (SYBR Green method) were TTCGATGCAACGCGAAGAAC (forward) and GTGTAGCCCTGGTCGTAAGG (reverse). The standard curve of DNA was in the range of 10 fg/μL to 3 ng/μL with good linearity (R2≥ 0.98). The quantitative limit was 10 fg/μL. In addition, the detection recovery rate was in the range of 59.7% to 80.7%, with RSD at less than 15%. Nine batches of levodopa were detected by this method, and the amount of E.coli DNA residue was below the limit. The developed qPCR method can be used for quantitative detection of residual DNA in biological products produced by E.coli as host cells, such as levodopa . The results indicate that the sensitivity of the detection method for recombinant plasmid construction standards is superior than the reagent kit detection method.

Objective: To explore the association between the Internet usage characteristics and suicidal ideation among vocational high school students, so as to provide a theoretical basis for precise intervention of suicide among vocational high school students. Methods: A total of 1 781 students were recruited from three vocational high schools in Wuhan and Xianning in March 2023 by using the cluster random sampling method. The Columbia-Suicide Severity Rating Scale and Revised Chen Internet Addiction Scale were used to measure suicidal ideation and Internet addiction, respectively. LASSO regression model was used to select influential factors related to suicidal ideation, and the gradient boosting decision tree algorithm XGBoost was used to develop prediction models and evaluate predictive performance. By calculating the SHAP values, the contribution of each influential factor was quantified. Results: The prevalence of suicidal ideation among vocational high school students was 42.22% and prevalence of Internet addiction was 26.39%. LASSO regression results indicated that age, gender, experience of being left behind, parental relationship, holding a class cadre position, using the Internet for learning, Internet use during dawn, morning and late night, Internet addiction, and depressive symptoms were all the influential factors of suicidal ideation among vocational high school students ( β= -0.05 , 0.29, 0.09, 0.27, 0.10, -0.01, 0.09, 0.05, 0.24, 0.28, 0.78, all P <0.05). The AUC of the prediction model was 0.75. The results based on SHAP values indicated that all influential factors identified through multivariate analysis contributed positively to the model predictions ( SHAP >0). Among these, depressive symptoms and parental relationship had the greatest impact on suicidal ideation ( SHAP =0.77, 0.26), and the joint effect of features with higher contribution could improve the prediction probability. Conclusions Depressive symptoms, parental relationships, Internet addiction, and time of Internet use are most important risk factors of suicidal behaviors for vocational high school students. Thus, effective interventions should be conducted to reduce their suicidal ideation.

Objective To observe the efficacy and safety of Morinda officinalis oligosaccharides in the continuation treatment of mild and moderate depression.Methods An open,single-arm,multi-center design was adopted in our study.Adult patients with mild and moderate depression who had received acute treatment of Morinda officinalis oligosaccharides were enrolled and continue to receive Morinda officinalis oligosaccharides capsules for 24 weeks,the dose remained unchanged during continuation treatment.The remission rate,recurrence rate,recurrence time,and the change from baseline to endpoint of Hamilton Depression Scale(HAMD),Hamilton Anxiety Scale(HAMA),Clinical Global Impression-Severity(CGI-S)and Arizona Sexual Experience Scale(ASEX)were evaluated.The incidence of treatment-related adverse events was reported.Results The scores of HAMD-17 at baseline and after treatment were 6.60±1.87 and 5.85±4.18,scores of HAMA were 6.36±3.02 and 4.93±3.09,scores of CGI-S were 1.49±0.56 and 1.29±0.81,scores of ASEX were 15.92±4.72 and 15.57±5.26,with significant difference(P＜0.05).After continuation treatment,the remission rate was 54.59％(202 cases/370 cases),and the recurrence rate was 6.49％(24 cases/370 cases),the recurrence time was(64.67±42.47)days.The incidence of treatment-related adverse events was 15.35％(64 cases/417 cases).Conclusion Morinda officinalis oligosaccharides capsules can be effectively used for the continuation treatment of mild and moderate depression,and are well tolerated and safe.

Objective To explore the analgesic effect of different doses of dezocine combined with ropivacaine for thoracic paravertebral block(TPVB)on patients undergoing thoracoscopic radical resection of lung cancer and the influence on hemodynamics and immune function of patients.Methods Patients with lung cancer who underwent thoracoscopic radical resection were divided into low-dose group and high-dose group according to random number table method.Both groups of patients were given total intravenous anesthesia to complete the surgery.At 15 min before general anesthesia induction,the low-dose group was given TPBV with 0.1 mg·kg-1 dezocine+0.375％ropivacaine for a total of 20 mL,and the high-dose group was given TPBV with 0.15 mg·kg-1 dezocine+0.375％ropivacaine for a total of 20 mL.Comparisons were performed on both groups in terms of analgesic effect,hemodynamic parameters,immune function and occurrence of adverse drug reactions.Results There were 48 cases in low-dose group and 46 cases in high-dose group.In low-dose group,the heart rate values before TPVB,before skin incision,at 5 min after sectioning and at the end of surgery were(78.52±6.54),(70.79±7.07),(74.48±6.68)and(76.69±7.29)beat·min-1,the mean arterial pressure values were(93.16±5.72),(86.38±7.51),(92.15±6.36)and(91.14±6.13)mmHg.In high-dose group,the heart rate values at the above time points were(79.36±7.11),(71.68±6.49),(74.76±7.06)and(76.57±6.52)beat·min-1;the mean arterial pressure values were(93.89±7.18),(85.27±7.41),(90.34±6.52)and(92.43±6.34)mmHg,there were no statistical differences between the two groups(all P＞0.05).The resting state scores at 2,6 and 12 h after surgery were(1.38±0.19),(1.54±0.21)and(1.72±0.16)points,the pain scores at motion state were(1.88±0.15),(2.36±0.37)and(3.26±0.38)points in low-dose group;in high-dose group,the resting state scores were(1.32±0.17),(1.58±0.22)and(1.81±0.18)points,the pain scores at motion state were(1.81±0.13),(2.11±0.31)and(3.03±0.36)points,respectively,there were no statistical differences between the two groups(all P＞0.05).The number of analgesic pump compressions at 24 h after surgery and the number of cases with analgesic remedy were(5.12±1.26)times and 15 cases in low-dose group and were(4.74±1.03)times and 10 cases in high-dose group,with no statistical differences between the groups(all P＞0.05).The percentages of CD3+cells in low-dose group at the end of surgery and at 12 h and 24 h after surgery were(68.51±6.76)％,(54.22±5.43)％and(51.47±6.58)％,the percentages of CD4+cells were(40.29±5.02)％,(34.94±4.79)％and(30.48±5.11)％,CD4+/CD8+ratios were 1.54±0.34,1.36±0.28 and 1.16±0.23;the percentages of CD3+cells in high-dose group were(67.92±7.11)％,(56.58±6.36)％and(54.47±6.89)％,percentages of CD4+cells were(41.33±5.75)％,(35.86±5.21)％and(32.27±4.78)％,the CD4+/CD8+were 1.53±0.35,1.40±0.30 and 1.22±0.26,all with no significant difference(all P＞0.05).The incidence of postoperative adverse drug reactions in high-dose group and low-dose group were 32.61％and 14.58％,with significant difference(P＜0.05).Conclusion When TPVB regimen of dezocine combined with ropivacaine is used in thoracoscopic radical resection of lung cancer,the analgesic effect of low-dose dezocine is comparable to that of high-dose dezocine,with lower risk of adverse drug reactions.

Objective To evaluate the pharmacokinetics characteristics of single-dose of Etripamil nasal spray 70 mg in healthy adult Chinese subjects.Methods This was a single-center,randomized,double-blind,placebo-controlled study.Twelve healthy adult Chinese subjects were randomized to receive single-dose of Etripamil nasal spray 70 mg(n=10)or placebo nasal spray(n=2).Blood and urine samples were collected prior and post dose.Etripamil in plasma and urine were analyzed by liquid chromatography-tandem mass spectrometry.The pharmacokinetic parameters were calculated by WinNonlin non-compartmental model.Results Following the single-dose of Etripamil nasal spray 70 mg in healthy adult Chinese subjects,the peak concentration of Etripamil in plasma was quickly attained,with a Cmax of(66.76±56.61)ng·mL-1 and a median(range)tmax of 4.00(3.00-5.00)min.The plasma concentrations of Etripamil had fallen approximately 65％from peak value at 25 min after dosing,and close to 80％within 50 min.The AUC0-last and AUC0-∞ were(3 104.16±2 654.46)and(4 048.77±2 682.38)ng·min·mL-1,respectively.The urine excretion percentage of Etripamil during 24 h was(0.01±0.01)％.Among the 12 subjects who were treated with Etripamil or placebo,10 subjects reported a total of 29 treatment-emergent adverse events(TEAEs).All of the TEAEs were mild in severity.The most common TEAEs were rhinorrhoea and lacrimation increased.Conclusion Etripamil was quickly absorbed after intranasal administration,followed by rapid distribution and elimination(not primarily excreted by renal);Etripamil 70 mg was safe and well tolerated by the healthy Chinese adult subjects.

Coronary restenosis is an important cause of poor long-term prognosis in patients with coronary heart disease. Here, we show that lysine methyltransferase SMYD2 expression in the nucleus is significantly elevated in serum- and PDGF-BB-induced vascular smooth muscle cells (VSMCs), and in tissues of carotid artery injury-induced neointimal hyperplasia. Smyd2 overexpression in VSMCs (Smyd2-vTg) facilitates, but treatment with its specific inhibitor LLY-507 or SMYD2 knockdown significantly inhibits VSMC phenotypic switching and carotid artery injury-induced neointima formation in mice. Transcriptome sequencing revealed that SMYD2 knockdown represses the expression of serum response factor (SRF) target genes and that SRF overexpression largely reverses the inhibitory effect of SMYD2 knockdown on VSMC proliferation. HDAC3 directly interacts with and deacetylates SRF, which enhances SRF transcriptional activity in VSMCs. Moreover, SMYD2 promotes HDAC3 expression via tri-methylation of H3K36 at its promoter. RGFP966, a specific inhibitor of HDAC3, not only counteracts the pro-proliferation effect of SMYD2 overexpression on VSMCs, but also inhibits carotid artery injury-induced neointima formation in mice. HDAC3 partially abolishes the inhibitory effect of SMYD2 knockdown on VSMC proliferation in a deacetylase activity-dependent manner. Our results reveal that the SMYD2-HDAC3-SRF axis constitutes a novel and critical epigenetic mechanism that regulates VSMC phenotypic switching and neointimal hyperplasia.

The adulteration and counterfeiting of herbal ingredients in medicinal and food homology (MFH) have a serious impact on the quality of herbal materials, thereby endangering human health. Compared to pharmaceutical drugs, health products derived from traditional Chinese medicine (TCM) are more easily accessible and closely integrated into consumers' daily life. However, the authentication of the authenticity of TCM ingredients in MFH has not received sufficient attention. The lack of clear standards emphasizes the necessity of conducting systematic research in this area. This study utilized DNA barcoding technology, combining ITS2, psbA-trnH, matK as universal barcode sequences, and DX, HH, JYH as specific barcode sequences, to identify the authenticity of commercial medicinal and food homology scented herbal teas. The aim was to investigate the authenticity of scented herbal tea products circulating in the market. The research results revealed that among 180 scented herbal tea samples, DNA barcodes were successfully obtained from 164 samples, while the remaining samples either lacked the target components or suffered severe DNA degradation, resulting in failed amplification. Combined with morphological identification studies, it was found that out of the 180 samples, 141 were authentic, accounting for 78.33% of the total samples, while 31 samples showed adulteration and 8 samples lacked the target components, accounting for 21.67% of the total samples. Additionally, water testing revealed that 5 samples of Carthamus tinctorius herbal tea exhibited the phenomenon of weight adulteration. This study exposed the presence of adulteration and weight adulteration in scented herbal tea products, highlighting the need for regulatory authorities to expedite the establishment of quality standards in scented herbal tea industry. These findings provide valuable insights for the rapid development of the scented herbal tea industry.

Objective To develop a virtual world integration scale for adolescents and test its reliability and validity within the framework of the Virtual Social Ecology Model. Methods A total of 2543 students from four schools in Wuhan and Xianning were recruited from March to October 2023. The preliminary items of the scale were determined by semi-structured interview, literature review, brainstorming and Delphi expert consultation. The compiled scale was analyzed for validity and reliability using critical ration analysis, homogeneity test, confirmatory factor analysis, correlation related validity test , cronbach α coefficient, and split-half coefficient. Results The scale was preliminarily determined to consist of 20 items in 10 dimensions, including virtual self-identity, emotional interaction, virtual social interaction, cyber bullying, community activities, value identity, community participation, community management, network culture and virtual social capital. In the item analysis, the correlation coefficient of homogeneity test ranged from 0.496 to 0.767 (P<0.001), and there was statistical difference in critical ratio analysis (CR= 21.897-53.546, P<0.001). The fits of the confirmatory factor analysis model in validity analysis were: CFI=0.933, NFI=0.951, IFI=0.927, and RMSEA=0.064. The criterion validity showed a significantly positive association (the coefficient was between 0.450 and 0.855, P<0.01). The overall Cronbach α coefficient was 0.929 and the split-half coefficient was 0.846. The Cronbach α coefficients of sub-questionnaires were between 0.719 and 0.900 , and the split-half coefficients were between 0.729 and 0.913. Conclusion The Virtual World Integration Scale has good reliability and validity, and can be used as an assessment tool for the level of adolescents’ integration in virtual world.

Umbilical cord mesenchymal stem cells (UC-MSCs) have been widely used in regenerative medicine, but there is limited research on the stability of UC-MSCs formulation during production. This study aims to assess the stability of the cell stock solution and intermediate product throughout the production process, as well as the final product following reconstitution, in order to offer guidance for the manufacturing process and serve as a reference for formulation reconstitution methods. Three batches of cell formulation were produced and stored under low temperature (2-8 ℃) and room temperature (20-26 ℃) during cell stock solution and intermediate product stages. The storage time intervals for cell stock solution were 0, 2, 4, and 6 h, while for intermediate products, the intervals were 0, 1, 2, and 3 h. The evaluation items included visual inspection, viable cell concentration, cell viability, cell surface markers, lymphocyte proliferation inhibition rate, and sterility. Additionally, dilution and culture stability studies were performed after reconstitution of the cell product. The reconstitution diluents included 0.9% sodium chloride injection, 0.9% sodium chloride injection + 1% human serum albumin, and 0.9% sodium chloride injection + 2% human serum albumin, with dilution ratios of 10-fold and 40-fold. The storage time intervals after dilution were 0, 1, 2, 3, and 4 h. The reconstitution culture media included DMEM medium, DMEM + 2% platelet lysate, 0.9% sodium chloride injection, and 0.9% sodium chloride injection + 1% human serum albumin, and the culture duration was 24 h. The evaluation items were viable cell concentration and cell viability. The results showed that the cell stock solution remained stable for up to 6 h under both low temperature (2-8 ℃) and room temperature (20-26 ℃) conditions, while the intermediate product remained stable for up to 3 h under the same conditions. After formulation reconstitution, using sodium chloride injection diluted with 1% or 2% human serum albumin maintained a viability of over 80% within 4 h. It was observed that different dilution factors had an impact on cell viability. After formulation reconstitution, cultivation in medium with 2% platelet lysate resulted in a cell viability of over 80% after 24 h. In conclusion, the stability of cell stock solution within 6 h and intermediate product within 3 h meets the requirements. The addition of 1% or 2% human serum albumin in the reconstitution diluent can better protect the post-reconstitution cell viability.