OBJECTIVE To explore the association between the use of oral progesterone drugs in early pregnancy and gestational diabetes mellitus （GDM）. METHODS Through real-world retrospective cohort research method， pregnant women who underwent the oral glucose tolerance test （OGTT） at the Affiliated Maternal and Child Health Hospital of Nantong University between January 2022 and January 2023 were enrolled. Based on whether oral progesterone drugs were used in early pregnancy， they were divided into treatment group and control group； propensity score matching （PSM） with a 1∶1 ratio was employed to control for confounding factors； Logistic regression and linear regression were employed to analyze the association between drug factors （whether use of oral progesterone drug， duration of medication， dosage， and drug type） and outcome indicators （occurrence of GDM， fasting blood glucose levels， and OGTT 1 and 2 h blood glucose levels in late pregnancy）. RESULTS A total of 709 pregnant women were enrolled in the two groups before PSM； after PSM， 256 cases were included in both the treatment group and the control group. The results of association analysis indicated that there was no significant association between the use of oral progesterone drugs and GDM （P＞0.05）； but a significant correlation was found with OGTT 1 h blood glucose levels [β＝0.965， 95%CI （0.007，1.922）， P＜0.05]， specifically with Dydrogesterone tablets [β＝0.977， 95%CI （0.009， 1.944）， P＜0.05] and Progesterone soft capsules [β ＝1.089， 95%CI （0.077， 2.102）， P＜0.05]. There was no significant correlation between other drug factors and outcome indicators （P＞0.05）. CONCLUSIONS The use of oral progestogen drugs in early pregnancy is not significantly associated with GDM. The blood glucose levels in late pregnancy， especially OGTT 1 h blood glucose levels， have a certain correlation with Progesterone soft capsules and Dydrogesterone tablets.

Panax species are mostly valuable medicinal plants. While some species' seeds are sensitive to dehydration, the dehydration tolerance of seeds from other Panax species remains unclear. The phospholipase D(PLD) gene plays an important role in plant responses to dehydration stress. However, the characteristics of the PLD gene family and their mechanisms of response to dehydration stress in seeds of Panax species with different dehydration tolerances are not well understood. This study used seeds from eight Panax species to measure the germination rates and PLD activity after dehydration and to analyze the correlation between dehydration tolerance and seed traits. Bioinformatics analysis was also conducted to characterize the PnPLD and PvPLD gene families and to evaluate their expression patterns under dehydration stress. The dehydration tolerance of Panax seeds was ranked from high to low as follows: P. ginseng, P. zingiberensis, P. quinquefolius, P. vietnamensis var. fuscidiscus, P. japonicus var. angustifolius, P. japonicus, P. notoginseng, and P. stipuleanatus. A significant negative correlation was found between dehydration tolerance and seed shape(three-dimensional variance), with flatter seeds exhibiting stronger dehydration tolerance(r=-0.792). Eighteen and nineteen PLD members were identified in P. notoginseng and P. vietnamensis var. fuscidiscus, respectively. These members were classified into five isoforms: α, β, γ, δ, and ζ. The gene structures, subcellular localization, physicochemical properties, and other characteristics of PnPLD and PvPLD were similar. Both promoters contained regulatory elements associated with plant growth and development, hormone responses, and both abiotic and biotic stress. During dehydration, the PLD enzyme activity in P. notoginseng seeds gradually increased as the water content decreased, whereas in P. vietnamensis var. fuscidiscus, PLD activity first decreased and then increased. The expression of PLDα and PLDδ in P. notoginseng seeds initially increased and then decreased, whereas in P. vietnamensis var. fuscidiscus, the expression of PLDα and PLDδ consistently decreased. In conclusion, the dehydration tolerance of Panax seeds showed a significant negative correlation with seed shape. The dehydration tolerance in P. vietnamensis var. fuscidiscus and dehydration sensitivity of P. notoginseng seeds may be related to differences in PLD enzyme activity and the expression of PLDα and PLDδ genes. This study provided the first systematic comparison of dehydration tolerance in Panax seeds and analyzed the causes of tolerance differences and the optimal water content for long-term storage at ultra-low temperatures, thus providing a theoretical basis for the short-term and ultra-low temperature long-term storage of medicinal plant seeds with varying dehydration tolerances.
Seeds/metabolism* ; Panax/physiology* ; Plant Proteins/metabolism* ; Gene Expression Regulation, Plant ; Phospholipase D/metabolism* ; Plants, Medicinal/enzymology* ; Germination ; Multigene Family ; Water/metabolism* ; Dehydration ; Phylogeny

In recent years, the study of single-cell transcriptome sequencing technology in the heterogeneity of astrocytes (astrocytes) after spinal cord injury (SCI) has provided new perspectives on post-traumatic nerve regeneration and repair. To provide a review on the research progress of single-cell sequencing technology in astrocytes after spinal cord injury (SCI), and to more comprehensively and deeply elaborate the application of single-cell sequencing technology in the field of astrocytes after SCI. Single-cell sequencing technology can analyse the transcriptomes of individual cells in a high-throughput manner, thus revealing fine differences in cell types and states. By using single-cell sequencing technology, the heterogeneity of astrocytes after SCI and their association with nerve regeneration and repair were revealed. In conclusion, the application of single-cell sequencing technology provides an important tool to reveal the heterogeneity of astrocytes after SCI, to further explore the mechanisms of astrocytes in SCI, and to develop intervention strategies targeting their regulatory mechanisms in order to improve the therapeutic efficacy of SCI. The discovery of changes in astrocyte transcriptome dynamics has improved researchers' understanding of spinal cord injury lesion progression and provided new insights into the treatment of spinal cord injury at different time points. To date, all of these findings need to be validated by more basic research and sufficient clinical trials. In the future, single-cell sequencing technology, through interdisciplinary collaboration with bioinformatics, computer science, tissue engineering, and clinical medicine, is expected to open a new window for the treatment of spinal cord injury.
Spinal Cord Injuries/metabolism* ; Astrocytes/cytology* ; Single-Cell Analysis/methods* ; Humans ; Animals ; Transcriptome ; Nerve Regeneration

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

Schizophrenia (SZ) stands as a severe psychiatric disorder. This study applied diffusion tensor imaging (DTI) data in conjunction with graph neural networks to distinguish SZ patients from normal controls (NCs) and showcases the superior performance of a graph neural network integrating combined fractional anisotropy and fiber number brain network features, achieving an accuracy of 73.79% in distinguishing SZ patients from NCs. Beyond mere discrimination, our study delved deeper into the advantages of utilizing white matter brain network features for identifying SZ patients through interpretable model analysis and gene expression analysis. These analyses uncovered intricate interrelationships between brain imaging markers and genetic biomarkers, providing novel insights into the neuropathological basis of SZ. In summary, our findings underscore the potential of graph neural networks applied to multimodal DTI data for enhancing SZ detection through an integrated analysis of neuroimaging and genetic features.
Humans ; Schizophrenia/pathology* ; Diffusion Tensor Imaging/methods* ; Male ; Female ; Adult ; Brain/metabolism* ; Young Adult ; Middle Aged ; White Matter/pathology* ; Gene Expression ; Nerve Net/diagnostic imaging* ; Graph Neural Networks

Objective To observe the efficacy of Chinese medicine in the treatment of pregnancy complicated with thalassemia and to investigate its influence on pregnancy outcomes.Methods A retrospective cohort study was carried out in 175 pregnant women complicated with thalassemia who met the inclusion criteria.According to the treatment methods,the patients were divided into Chinese medicine group(105 cases),iron supplementation group(41 cases)and untreated group(29 cases).The changes of hematological indicators and pregnancy outcomes in the second and third trimesters of pregnancy were compared among the three groups.The Chinese medicine group was further divided into three subgroups:56 cases in the Chinese patent medicine group,20 cases in the single Chinese medicine group and 29 cases in the Chinese herbal compound group.The changes of hematological indexes in the second and third trimesters of pregnancy in the three subgroups were compared.Moreover,the normative management of pregnant women with thalassemia during pregnancy was explored.Results(1)The concentration of hemoglobin(Hb)in the third trimester of the Chinese medicine group was(2.28±7.27)g/L higher than that in the second trimester,and the curative effect of Chinese medicine group was superior to that in the iron supplementation group and the untreated group(P＜0.05).The Hb concentration in the Chinese medicine group before delivery was(12.17±10.81)g/L higher than that in the second trimester,and the increase in the Chinese medicine group was more significantly than that in the other two groups(P＜0.05).(2)The level of serum ferritin(FER)in the third trimester of the three groups was lower than that in the second trimester,and the decrease of FER level in the iron supplementation group was less significantly than that in the other two groups(P＜0.05).(3)The Hb concentration in the third trimester of the single Chinese medicine group and the Chinese herbal compound group increased by(4.50±4.66),(3.62±8.77)g/L respectively compared with that in the second trimester,and the increase in the above two groups was more significantly than that in the Chinese patent medicine group(P＜0.05).(4)There was no significant difference in pregnancy outcomes among the three groups of pregnant women with thalassemia(P＞0.05).(5)Only 52.0％(91/175)of pregnant women with thalassemia underwent three or more blood routine tests after 20-24 weeks of pregnancy,34.3％(60/175)of pregnant women failed in re-examining the FER levels,and 21.2％(37/175)of pregnant women had no standardized iron supplementation.Conclusion Chinese medicine therapy is effective on improving anemia in pregnant women with thalassemia.Chinese herbal compound and single Chinese medicinal are more effective than Chinese patent medicine,and have not increased the risk of adverse pregnancy outcomes.Oral administration of iron can increase the iron reserve of pregnant women with thalassemia,but its effect on improving anemia is not as good as that of Chinese medicine.Attention should be got to the monitoring of anemia and iron metabolism indicators as well as the standardized use of iron supplements and Chinese patent medicines in pregnant women with thalassemia.

Objective:To analyze the clinical characteristics,treatment,and prognosis of adult patients with early T-cell precursor acute lymphoblastic leukemia/lymphoma(ETP-ALL/LBL).Methods:Clinical data of 113 T lymphoblastic leukemia/lymphoma(T-ALL/LBL)patients from January 2006 to January 2019 were collected from three hematology research centers,including Peking University Third Hospital,the First Medical Center of Chinese PLA General Hospital and Institute of Hematology and Blood Diseases Hospital,Chinese Medical University.The clinical characteristics and prognosis of ETP-ALL/LBL patients were analyzed compared with non-ETP-ALL/LBL patients.Results:In 113 T-ALL/LBL patients,13 cases(11.5％)were diagnosed as ETP-ALL/LBL,including 11 males,with a median age of 28(18-53)years.Compared with non-ETP-ALL/LBL patients,there were no significant differences in age,sex,incidence of large mediastinal mass,clinical stage,international prognostic index(IPI)score,white blood cell(WBC)count and lactate dehydrogenase(LDH)level among ETP-ALL/LBL patients.Among 13 ETP-ALL/LBL patients,9 cases(69.2％)achieved complete remission(CR),and there was no statistically significant difference in response rate induced by chemotherapy between ETP-ALL/LBL patients and non-ETP-ALL/LBL patients.Among patients who received chemotherapy without allogeneic hematopoietic stem cell transplantation(allo-HSCT),ETP-ALL/LBL group had a worse 5-year overall survival(OS)rate compared with non-ETP-ALL/LBL group(0 vs 7.1％,P=0.008),while in patients with allo-HSCT,there was no significant difference for 5-year OS rate between the two group(37.5％vs 40.2％,P＞0.05).Multivariate Cox regression analysis showed that CR after induction therapy,allo-HSCT,and LDH level were independent prognostic factors affecting T-ALL/LBL patients.Conclusion:No significant difference in response rate induced by chemotherapy is observed between ETP-ALL/LBL and non-ETP-ALL/LBL patients.Allo-HSCT consolidation after induction of remission therapy may have significant favorable influence on OS for patients with ETP-ALL/LBL.

Objective:To screen interleukin(IL)-1β secretion-related membrane transporters by macrophage experiment in vitro and conventional knockout mice.Methods:THP-1 cell line was differentiated to obtain human THP-1-derived macrophages,and the primary macrophages were obtained from human peripheral blood.FVB wild-type mice with the same sex and age were used as the controls of MRP1 knockout mice.The macrophages in abdominal cavity and bone marrow of mice were cultivated.The cells were treated with ABCC1/MRP1,ABCG2/BCRP,ABCB1/P-gp,OATP1B1,and MATE transporter inhibitors,then stimulated by lipopolysaccharide and adenosine triphosphate.The secretion level of IL-iβ was detected by ELISA,Western blot,and immunofluorescence.Results:After inhibiting ABCC1/MRP1 transporter,the secretion of IL-1β decreased significantly,while inhibition of the other 4 transporters had no effect.In animal experiment,the level of IL-1 β secreted by macrophages in bone marrow of MRP1 knockout mice was significantly lower than control group(P＜0.05).Conclusion:ABCC1/MRP1 transporter is a newly discovered IL-1β secretion pathway,which is expected to become a new target for solving clinical problems such as cytokine release syndrome.

Objective:To explore the clinical correlation and prognostic value of the Albumin-Bilirubin(ALBI)score in children with secondary hemophagocytic syndrome(sHLH).Methods:A retrospective analysis was conducted on the data of children's sHLH cases clearly diagnosed in the Affiliated Hospital of Zunyi Medical University from January 2012 to March 2023.Survival analysis was conducted according to the ALBI classification.Spearman correlation analysis was conducted between the ALBI score and clinical indicators.The Receiver Operating Characteristic(ROC)curve was used to evaluate the ALBI score,select the best cutoff value,and evaluate the accuracy of prognostic prediction value.Kaplan-Meier method was used to draw the survival curve.Log-rank method was used to compare the differences of survival curve between groups.Cox regression was used for prognostic analysis and restricted cubic spline curves used to calculate the relationship between ALBI scores and the risk of death in children with sHLH.Results:A total of 128 children with sHLH were included in this study,with a median age of 38(13.25,84)months.There were 70 males(54.69％)and 58 females(45.31％).The survival analysis results of ALBI grading showed that the survival rate of HLH patients with ALBI grade 3 was significantly lower than those with ALBI grades 1 and 2.Spearman correlation analysis results showed that ALBI score was positively correlated with splenomegaly,respiratory failure,disseminated intravascular coagulation(DIC),pulmonary hemorrhage,gastrointestinal hemorrhage,central nervous system involvement,ALT,AST,TG,LDH,PT,APTT,and SF(the correlation coefficients are:r=0.181,0.362,0.332,0.221,0.351,0.347,0.391,0.563,0.180,0.448,0.483,0.37,0.356),and was negatively correlated with HB,PLT,and FIB(the correlation coefficients are:r=-0.321,-0.316,-0.423),but was not significantly correlated with EBV infection,fungal infection,hepatomegaly,and ANC(P＞0.05).Using the ROC curve,the cutoff value of ALBI was-1.76.Single factor Cox regression analysis results showed that HB＜90 g/L,ALT ≥ 80 U/L,AST≥200 U/L,LDH ≥1 000 U/L,PT ≥20 s,APTT≥40 s,FIB＜1.5 g/L,ALBI ≥-1.76,combined pulmonary hemorrhage,DIC,central nervous system involvement,gastrointestinal bleeding,and not using blood purification may be the prognostic risk factors for children with sHLH(P＜0.05).Multivariate Cox regression results showed that FIB＜1.5 g/L(HR=2.119,95％CI:1.028-4.368),ALBI≥-1.76(HR=2.452,95％CI:1.233-4.875),and central nervous system involvement(HR=4.674,95％CI:2.486-8.789)were independent risk factors affecting prognosis,while blood purification(HR=0.306,95％CI:0.153-0.612)was an independent protective factor for prognosis.The application of restricted cubic splines shows that the risk of death increases with the increase of ALBI score.The area under the ROC curve(AUC)of the ALBI score for predicting the risk of 1-week,2-week,4-week,and overall mortality were 0.825,0.807,0.700,and 0.693,respectively,indicating good predictive performance for early mortality risk.According to subgroup analysis results of clinical manifestations,compared with the ALBI＜-1.76 group,ALBI≥-1.76 was associated with age ≤2 years,EBV infection,HLH-1994/2004 treatment,concomitant respiratory failure,and ANC≤1.0 × 109/L,HB＜90 g/L,PLT＜100 × 109/L,TG≥3.0 mmol/L,LDH ≥ 1 000 U/L,APTT≥40 s,and FIB＜1.5 g/L(P＜0.05).Conclusion:The ALBI score is related to the clinical characteristics and laboratory indicators of sHLH,and can be used as a beneficial indicator for assessing the prognostic risk of sHLH in children.It has good accuracy and clinical application value in predicting the prognosis of sHLH in children.