ObjectiveTo investigate the role of DEAD-box helicase 3 X-linked （DDX3X） in immune-mediated liver injury （ILI）， and to clarify its mechanism by regulating endoplasmic reticulum stress （ERS）-dependent apoptotic pathway and its association with the clinical progression of hepatitis B. MethodsMice were given injection of concanavalin A （ConA） via the caudal vein to establish a model of ILI， PBS （control group） and different concentrations of ConA were injected into the tail vein of hepatocyte-specific DDX3X-knockout mice （DDX3X^ΔHep and DDX3X-flox mice （DDX3X^fl/fl）， respectively.. The log-rank survival analysis， measurement of the serum levels of aspartate aminotransferase （AST） and alanine aminotransferase （ALT）， and HE staining of liver tissue were performed to assess liver injury， and qRT-PCR and Western Blot were used to measure the mRNA and protein expression levels of glucose-regulated protein 78 （GRP78）， CCAAT/enhancer-binding protein homologous protein （CHOP）， and DDX3X in liver tissue. Intraperitoneal injection of 4-phenylbutyric acid （4-PBA， 100 mg/kg） was performed to inhibit ERS. Serum samples （n=30） and liver tissue samples （n=6） were collected from healthy controls， chronic hepatitis B （CHB） patients， and hepatitis B virus-associated liver failure （HBV-LF） patients； ELISA was used to measure the serum level of DDX3X， and qRT-PCR/Western Blot was used to analyze the expression of targets in liver tissue. A one-way analysis of variance was used for comparison of continuous data between multiple groups， and the least significant difference t-test was used for further comparison between two groups. ResultsCompared with the control group of mice， the expression of DDX3X in the liver of mice induced by ConA was significantly increased after liver injury （P<0.05）， and hepatocyte-specific DDX3X knockout increased the 72-hour survival rate of mice by 55% （compared with 20% in the DDX3X^fl/fl group）， with significant reductions in the serum levels of ALT and AST （P<0.000 1） and the expression levels of the ERS markers GRP78 and CHOP （P<0.05）. After ERS was inhibited by 4-PBA， there was alleviation of liver injury （with reductions in ALT and AST， P <0.001） and a reduction in DDX3X expression （P<0.01）. The analysis of clinical samples showed that the mRNA and protein expression levels of liver DDX3X in CHB patients and HBV-LF patients were significantly higher than those in healthy controls （all P<0.01）， and there was a significant increase in the serum level of DDX3X in HBV-LF patients （P<0.000 1）. ConclusionDDX3X exacerbates ILI by regulating the ERS-dependent apoptotic pathway （GRP78/CHOP）， and its expression is associated with the progression of hepatitis B. Therefore， it can be used as a potential therapeutic target.

Background: and Purpose Symptomatic intracranial hemorrhage (sICH) following endovascular thrombectomy (EVT) is a severe complication associated with adverse functional outcomes and increased mortality rates. Currently, a reliable predictive model for sICH risk after EVT is lacking. Methods: This study used data from patients aged ≥20 years who underwent EVT for anterior circulation stroke from the nationwide Taiwan Registry of Endovascular Thrombectomy for Acute Ischemic Stroke (TREAT-AIS). A predictive model including factors associated with an increased risk of sICH after EVT was developed to differentiate between patients with and without sICH. This model was compared existing predictive models using nationwide registry data to evaluate its relative performance. Results: Of the 2,507 identified patients, 158 developed sICH after EVT. Factors such as diastolic blood pressure, Alberta Stroke Program Early CT Score, platelet count, glucose level, collateral score, and successful reperfusion were associated with the risk of sICH after EVT. The TREAT-AIS score demonstrated acceptable predictive accuracy (area under the curve [AUC]=0.694), with higher scores being associated with an increased risk of sICH (odds ratio=2.01 per score increase, 95% confidence interval=1.64–2.45, P<0.001). The discriminatory capacity of the score was similar in patients with symptom onset beyond 6 hours (AUC=0.705). Compared to existing models, the TREAT-AIS score consistently exhibited superior predictive accuracy, although this difference was marginal. Conclusions The TREAT-AIS score outperformed existing models, and demonstrated an acceptable discriminatory capacity for distinguishing patients according to sICH risk levels. However, the differences between models were only marginal. Further research incorporating periprocedural and postprocedural factors is required to improve the predictive accuracy.

Background: and Purpose Symptomatic intracranial hemorrhage (sICH) following endovascular thrombectomy (EVT) is a severe complication associated with adverse functional outcomes and increased mortality rates. Currently, a reliable predictive model for sICH risk after EVT is lacking. Methods: This study used data from patients aged ≥20 years who underwent EVT for anterior circulation stroke from the nationwide Taiwan Registry of Endovascular Thrombectomy for Acute Ischemic Stroke (TREAT-AIS). A predictive model including factors associated with an increased risk of sICH after EVT was developed to differentiate between patients with and without sICH. This model was compared existing predictive models using nationwide registry data to evaluate its relative performance. Results: Of the 2,507 identified patients, 158 developed sICH after EVT. Factors such as diastolic blood pressure, Alberta Stroke Program Early CT Score, platelet count, glucose level, collateral score, and successful reperfusion were associated with the risk of sICH after EVT. The TREAT-AIS score demonstrated acceptable predictive accuracy (area under the curve [AUC]=0.694), with higher scores being associated with an increased risk of sICH (odds ratio=2.01 per score increase, 95% confidence interval=1.64–2.45, P<0.001). The discriminatory capacity of the score was similar in patients with symptom onset beyond 6 hours (AUC=0.705). Compared to existing models, the TREAT-AIS score consistently exhibited superior predictive accuracy, although this difference was marginal. Conclusions The TREAT-AIS score outperformed existing models, and demonstrated an acceptable discriminatory capacity for distinguishing patients according to sICH risk levels. However, the differences between models were only marginal. Further research incorporating periprocedural and postprocedural factors is required to improve the predictive accuracy.

Body weight abnormalities, including overweight, obesity, and underweight, have become a dual public health challenge in Chinese adults: overweight and obesity lead to a variety of chronic complications, while underweight increases the risks of malnutrition, sarcopenia, and organ dysfunction. To systematically address these issues, multidisciplinary experts in endocrinology, sports science, nutrition, and psychiatry from various regions have held multiple weight management seminars. Based on the latest epidemiological data and clinical evidence, they expanded the guideline to include assessment and intervention strategies for underweight, in addition to the core content of obesity management. This guideline outlines the etiological mechanisms, evaluation methods, and multidimensional management strategies for overweight and obesity, covering key areas such as diagnosis and assessment, medical nutrition therapy, exercise prescription, pharmacological intervention, and psychological support. It is intended to provide a scientific and standardized approach to weight management across the adult population, aiming to curb the rising prevalence of obesity, mitigate complications associated with abnormal body weight, and improve nutritional status and overall quality of life.

Abelmoschi Corolla, the dried corolla of Abelmoschus manihot, has anti-inflammatory, antioxidant, and anti-fibrosis activities. Its chemical constituents mainly include flavonoids, organic acids, steroids, and polysaccharides. This study reviewed the research progress in the chemical constituents and pharmacological activities of Abelmoschi Corolla in recent 20 years. According to the concept of quality marker(Q-marker), the Q-markers of Abelmoschi Corolla were predicted from plant phylogeny, chemical constituent specificity, traditional efficacy, chemical constituent measurability, and absorbed constituents. The primary Q-markers for Abelmoschi Corolla were anticipated to include quercetin-3'-O-β-D-glucopyranoside, gossypetin-8-O-β-D-glucuronide, isoquercetin, myricetin,quercetin, and hyperoside, with the aim of providing reference data for improving the quality evaluation system of Abelmoschi Corolla.
Abelmoschus/chemistry* ; Drugs, Chinese Herbal/pharmacology* ; Flowers/chemistry* ; Humans ; Animals ; Quality Control ; Flavonoids/chemistry*

Chaihu and Longgu Muli Decoction has demonstrated significant efficacy in the treatment of tachyarrhythmia accompanied by anxiety and depression. However, there is a lack of standardized guidelines for its clinical application. In this study, the Chaihu and Longgu Muli Decoction was investigated through extensive research on ancient and modern literature, as well as a collection of clinical medical records. The basic information, medication details, and diagnostic information from medical records, personal experience literature, and clinical cases in the treatment of tachyarrhythmia accompanied by anxiety were extracted and analyzed to preliminarily identify the prescription characteristics and syndrome patterns. Subsequently, the Delphi method was employed to construct an item pool based on the data obtained in the first step. An expert questionnaire was prepared to collect scores and revision opinions from experts regarding these items. After statistical analysis and group discussions, a second round of questionnaires was formed by screening out certain items. This process was repeated until a final item set for the treatment of tachyarrhythmia accompanied by anxiety with Chaihu and Longgu Muli Decoction was determined. These findings provided guidance for clinical prescription practices. By extracting 71 syndromes and signs, as well as 33 tongue and pulse characteristics, the main syndrome features included palpitations, chest tightness, irritability, etc., which were basically consistent with the ancient syndromes. Through frequency analysis and group discussions, 71 items were screened out. After screening, modification, and primary and secondary division, 11 main diagnostic items and 10 secondary diagnostic items were determined. On this basis, the research team believes that Chaihu and Longgu Muli Decoction is mainly indicated for the following syndromes in the treatment of tachyarrhythmia accompanied by anxiety(palpitations, poor sleep, bitter taste, dry mouth, irritability/easily angered/anxiety/fearfulness/easily startled, red tongue with greasy yellow coating, rapid pulse, high work/life pressure, tachyarrhythmia on electrocardiogram/Holter monitor, and positive results on anxiety scale). Secondary syndromes include chest tightness, shortness of breath, feeling heavy and weak in the body, sweating, poor appetite, constipation, greasy white tongue coating, wiry pulse, slippery pulse, or knotted and intermittent pulse.
Drugs, Chinese Herbal/therapeutic use* ; Humans ; Delphi Technique ; Anxiety/complications* ; Tachycardia/psychology* ; Female ; Male ; Middle Aged ; Adult ; Aged

This study aimed to explore the effects and mechanisms of total extracts from Anthriscus sylvestris on pulmonary hypertension in rats. Sixty male SD rats were divided into normal(NC) group, model(M) group, positive drug sildenafil(Y) group, low-dose A. sylvestris(ES-L) group, medium-dose A. sylvestris(ES-M) group, and high-dose A. sylvestris(ES-H) group. On day 1, rats were intraperitoneally injected with monocrotaline(60 mg·kg~(-1)) to induce pulmonary hypertension, and the rat model was established on day 28. From days 15 to 28, intragastric administration of the respective treatments was performed. After modeling and treatment, small animal echocardiography was used to detect the right heart function of the rats. Arterial blood gas was measured using a blood gas analyzer. Hematoxylin and eosin(HE) staining and Masson staining were performed to observe cardiopulmonary pathological damage. Flow cytometry was used to detect apoptosis in the lung and myocardial tissues and reactive oxygen species(ROS) levels. Western blot was applied to detect the expression levels of transforming growth factor-β1(TGF-β1), phosphorylated mothers against decapentaplegic homolog 3(p-Smad3), Smad3, tissue plasminogen activator(t-PA), and plasminogen activator inhibitor-1(PAI-1) in lung tissue. A blood routine analyzer was used to measure inflammatory immune cell levels in the blood. Enzyme-linked immunosorbent assay(ELISA) was used to detect the expression levels of P-selectin and thromboxane A2(TXA2) in plasma. The results showed that, compared with the NC group, right heart hypertrophy index, right ventricular free wall thickness, right heart internal diameter, partial carbon dioxide pressure(PaCO_2), apoptosis in cardiopulmonary tissue, and ROS levels were significantly increased in the M group. In contrast, the ratio of pulmonary blood flow acceleration time(PAT)/ejection time(PET), right cardiac output, change rate of right ventricular systolic area, systolic displacement of the tricuspid ring, oxygen partial pressure(PaO_2), and blood oxygen saturation(SaO_2) were significantly decreased in the M group. After administration of the total extract of A. sylvestris, right heart function and blood gas levels were significantly improved, while apoptosis in cardiopulmonary tissue and ROS levels significantly decreased. Further testing revealed that the total extract of A. sylvestris significantly decreased the levels of interleukin-1β(IL-1β), interleukin-6(IL-6), and PAI-1 proteins in lung tissue, while increasing the expression of t-PA. Additionally, the extract reduced the levels of inflammatory cells such as leukocytes, lymphocytes, granulocytes, and monocytes in the blood, as well as the levels of P-selectin and TXA2 in plasma. Metabolomics results showed that the total extract of A. sylvestris significantly affected metabolic pathways, including arginine biosynthesis, tyrosine metabolism, and taurine and hypotaurine metabolism. In conclusion, the total extract of A. sylvestris may exert an anti-pulmonary hypertension effect by inhibiting the TGF-β1/Smad3 signaling pathway, thereby alleviating immune-inflammatory responses and thrombosis.
Animals ; Male ; Smad3 Protein/metabolism* ; Transforming Growth Factor beta1/metabolism* ; Rats, Sprague-Dawley ; Rats ; Signal Transduction/drug effects* ; Hypertension, Pulmonary/genetics* ; Thrombosis/immunology* ; Drugs, Chinese Herbal/administration & dosage* ; Humans ; Apoptosis/drug effects*

Qing court records show that Arecae Semen was extensively applied. The royal medical records of the Qing Dynasty document nine types of Arecae Semen, with the Palace Museum preserving seven kinds, totaling twelve cultural relics. Historical documents and physical artifacts corroborate each other, providing evidence for the study of the supply channels and court processing of Arecae Semen in the Qing court. According to relevant Qing court archival records, the sources of Arecae Semen used in the imperial court were diverse, including tributes from foreign countries such as Vietnam and Gurkha, annual tributes from local governments in Guangdong, gifts from close aides, and commodities purchased by the Imperial Household Department from civilian shops. The imperial physicians of the Qing court placed great emphasis on the specifications of Arecae Semen slices and were extremely meticulous about their processing. The variety of Arecae Semen slices used in the Qing palace exceeded those recorded in the botanical texts of the era. Compared with the commonly used processing methods for Arecae Semen in the Qing Dynasty, the imperial physicians adjusted the properties and efficacy of the herbs through different processing techniques, based on the patient's condition, constitution, and other factors, in order to meet the clinical treatment needs of the court. The slicing of Arecae Semen in the Qing court required strict control of thickness, with an average thickness of 0.44 mm, which is significantly thinner than the Arecae Semen slices found in today's markets. The texture was softer, making them easier to chew and absorb. Both the Qing court Arecae Semen slices and the Muxiang Binglang Pills focused on the use of authentic medicinal materials, ensuring the quality of the medicine and enhancing the efficacy of Arecae Semen through meticulous selection and preparation.
China ; Drugs, Chinese Herbal/history* ; Humans ; Medicine, Chinese Traditional/history* ; History, 19th Century ; History, Ancient ; History, 17th Century ; History, 18th Century

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test