1.Mechanisms of Sini San in Regulation of Gut Microbiota Against Depression and Liver Injury in CUMS Rats
Junling LI ; Yan ZHANG ; Lei WANG ; Fang QI ; Zhenzhen CHEN ; Tianxing CHEN ; Yuhang LIU ; Xueying WANG ; Xianwen TANG ; Yubo LI
Chinese Journal of Experimental Traditional Medical Formulae 2026;32(3):33-40
ObjectiveTo explore the efficacy and mechanisms of Sini San in the treatment of depression and liver injury based on gut microbiota. MethodsThirty-two male Sprague-Dawley (SD) rats were randomly divided into a normal group, model group (M), Sini San group (MS, 2.5 g·kg-1), and fluoxetine group (MF, 2 mg·kg-1). Except for the normal group, rats in the other three groups were subjected to chronic unpredictable mild stress (CUMS). After 8 weeks, the open-field test and sucrose preference test were conducted. Enzyme-linked immunosorbent assay (ELISA) was used to detect serum corticosterone (CORT), adrenocorticotropic hormone (ACTH), corticotropin-releasing factor (CRF), lipopolysaccharide (LPS), Zonulin, interleukin-6 (IL-6), tumor necrosis factor-α (TNF-α), interleukin-1β (IL-1β), γ-aminobutyric acid (GABA) levels in the hippocampus and prefrontal cortex, and brain-derived neurotrophic factor (BDNF) levels in the hippocampus. Real-time quantitative polymerase chain reaction (Real-time PCR) was used to detect hippocampal BDNF mRNA expression. Serum alanine aminotransferase (ALT) and aspartate aminotransferase (AST) levels were measured using the ultraviolet lactate dehydrogenase method. The ultrastructure of the intestinal epithelium was observed by electron microscopy, and gut microbiota in rat feces were analyzed using 16S rDNA high-throughput sequencing. ResultsCompared with the normal group, the sucrose preference of rats in the model group was significantly reduced (P0.01), whereas it was significantly increased in the Sini San group compared with the model group (P0.05). Compared with the normal group, hippocampal GABA protein levels and BDNF mRNA expression in the model group were significantly decreased (P0.05), and compared with the model group, both were significantly increased in the Sini San group (P0.05, P0.01). Compared with the normal group, serum LPS and Zonulin levels in the model group were significantly increased (P0.05, P0.01), and compared with the model group, Zonulin levels in the Sini San group were significantly decreased (P0.05). No obvious changes were observed in the ultrastructure of the jejunal mucosa among groups. Compared with the normal group, widened and blurred tight junctions, sparse and shortened microvilli, and mitochondrial swelling with cristae disruption in epithelial cells were observed in the ileal and colonic mucosa of the model group, which were markedly improved in the Sini San and fluoxetine groups. The results of 16S rDNA high-throughput sequencing showed that Sini San improved CUMS-induced dysbiosis of Bacteroidetes and Proteobacteria. Correlation analysis indicated that Bacteroidetes and Proteobacteria were significantly correlated with depression-related indicators, liver function, and intestinal mucosal permeability. ConclusionSini San exerts antidepressant and hepatoprotective effects by improving Bacteroidetes and Proteobacteria and inhibiting the increase in intestinal mucosal permeability in CUMS rats.
2.Mechanisms of Sini San in Regulation of Gut Microbiota Against Depression and Liver Injury in CUMS Rats
Junling LI ; Yan ZHANG ; Lei WANG ; Fang QI ; Zhenzhen CHEN ; Tianxing CHEN ; Yuhang LIU ; Xueying WANG ; Xianwen TANG ; Yubo LI
Chinese Journal of Experimental Traditional Medical Formulae 2026;32(3):33-40
ObjectiveTo explore the efficacy and mechanisms of Sini San in the treatment of depression and liver injury based on gut microbiota. MethodsThirty-two male Sprague-Dawley (SD) rats were randomly divided into a normal group, model group (M), Sini San group (MS, 2.5 g·kg-1), and fluoxetine group (MF, 2 mg·kg-1). Except for the normal group, rats in the other three groups were subjected to chronic unpredictable mild stress (CUMS). After 8 weeks, the open-field test and sucrose preference test were conducted. Enzyme-linked immunosorbent assay (ELISA) was used to detect serum corticosterone (CORT), adrenocorticotropic hormone (ACTH), corticotropin-releasing factor (CRF), lipopolysaccharide (LPS), Zonulin, interleukin-6 (IL-6), tumor necrosis factor-α (TNF-α), interleukin-1β (IL-1β), γ-aminobutyric acid (GABA) levels in the hippocampus and prefrontal cortex, and brain-derived neurotrophic factor (BDNF) levels in the hippocampus. Real-time quantitative polymerase chain reaction (Real-time PCR) was used to detect hippocampal BDNF mRNA expression. Serum alanine aminotransferase (ALT) and aspartate aminotransferase (AST) levels were measured using the ultraviolet lactate dehydrogenase method. The ultrastructure of the intestinal epithelium was observed by electron microscopy, and gut microbiota in rat feces were analyzed using 16S rDNA high-throughput sequencing. ResultsCompared with the normal group, the sucrose preference of rats in the model group was significantly reduced (P<0.01), whereas it was significantly increased in the Sini San group compared with the model group (P<0.05). Compared with the normal group, hippocampal GABA protein levels and BDNF mRNA expression in the model group were significantly decreased (P<0.05), and compared with the model group, both were significantly increased in the Sini San group (P<0.05, P<0.01). Compared with the normal group, serum LPS and Zonulin levels in the model group were significantly increased (P<0.05, P<0.01), and compared with the model group, Zonulin levels in the Sini San group were significantly decreased (P<0.05). No obvious changes were observed in the ultrastructure of the jejunal mucosa among groups. Compared with the normal group, widened and blurred tight junctions, sparse and shortened microvilli, and mitochondrial swelling with cristae disruption in epithelial cells were observed in the ileal and colonic mucosa of the model group, which were markedly improved in the Sini San and fluoxetine groups. The results of 16S rDNA high-throughput sequencing showed that Sini San improved CUMS-induced dysbiosis of Bacteroidetes and Proteobacteria. Correlation analysis indicated that Bacteroidetes and Proteobacteria were significantly correlated with depression-related indicators, liver function, and intestinal mucosal permeability. ConclusionSini San exerts antidepressant and hepatoprotective effects by improving Bacteroidetes and Proteobacteria and inhibiting the increase in intestinal mucosal permeability in CUMS rats.
3.Pharmacodynamic Substances and Mechanisms of Xinglou Chengqi Tang in Treating Post-stroke Complications: A Review
Yujin ZHANG ; Xiangzhuo LIU ; Zhouyang CHEN ; Zihao SONG ; Xinyi LIU ; Yizhi YAN ; Chaoya LI ; Yingyan FANG ; Shasha YANG ; Xueqin CHENG ; Zhou XIE ; Sijie TAN ; Peng ZENG ; Yue ZHANG
Chinese Journal of Experimental Traditional Medical Formulae 2026;32(1):327-337
Stroke is the leading cause of death and disability among adults in China, and its common complications include digestive system abnormalities, cognitive impairment, depression, stroke-associated pneumonia, and hemiplegia. The combination of traditional Chinese and Western medicine has great potential in treating post-stroke complications. Xinglou Chengqitang (XLCQT) is a representative prescription of alleviating the disease in the upper part by treating the lower part. It has definite therapeutic effect and high safety. Clinically, XLCQT is often used to treat stroke and its complications. However, the quantity and quality of clinical trials of XLCQT in treating post-stroke complications need to be improved. Additionally, since the basic research is weak, the material basis and multi-target mechanism for the efficacy of this prescription are unknown. This article reviews XLCQT in terms of the pharmacodynamic basis, medicinal properties, safety evaluation, and progress in clinical research and mechanisms in treating post-stroke complications. This article summarizes 22 key active ingredients of XLCQT in treating acute stroke complicated with syndrome of phlegm heat and fu-organ excess. Among these key active ingredients, resveratrol, kaempferol, luteolin, chrysoeriol, apigenin, (+)-catechin, and adenosine have good pharmacokinetic properties and high bioavailability. The mechanisms of XLCQT in treating post-stroke complications are complex, including inflammatory response, brain-gut axis, hypothalamic-pituitary-adrenal (HPA) axis, intestinal flora, neurotrophic factors, autophagy, oxidative stress, and free radical damage. This review helps to deeply understand the pharmacodynamic basis and mechanisms of XLCQT in treating post-stroke complications and provides a theoretical basis for the clinical application of XLCQT against post-stroke complications and the development of drugs.
4.Yttrium-90 selective internal radiation therapy on liver cancer: the past, the present, and the future
Jingqin MA ; Linhong ZHANG ; Minjie YANG ; Jiabin CAI ; Ying FANG ; Rong LIU ; Xudong QU ; Lingxiao LIU ; Zhiping YAN
Chinese Journal of Clinical Medicine 2025;32(1):3-8
Yttrium-90 selective internal radiation therapy (90Y-SIRT) is a treatment technique that delivers radioactive microspheres precisely to the arterial vascular bed of neoplasms, utilizing beta radiation to administer a high local dose of radiation to the neoplasm tissues. This technology has demonstrated significant efficacy in patients with unresectable pirmary liver cancers and liver metastases. This article systematically reviews the development history and clinical application status of 90Y-SIRT in the treatment of liver cancer, and looks forward to future development directions.
5.Association among childhood obesity, type 2 diabetes mellitus and coronary artery heart disease: a Mendelian randomization study
CHEN Haimiao ; MA Yan ; LIU Mingqi ; MA Shanshan ; LI Jun ; FANG Yirong
Journal of Preventive Medicine 2025;37(3):307-311
Objective:
To investigate the association between childhood obesity and type 2 diabetes mellitus (T2DM) as well as coronary artery heart disease (CHD).
Methods:
Genome-wide association study (GWAS) data for childhood obesity were collected from the ECG consortium, encompassing information on children aged 2 to 18 years, including 18 613 cases and 12 696 controls. GWAS data for T2DM were collected from the DIAGRAM consortium, including 242 283 cases and 1 569 734 controls. GWAS data for CHD were collected from the CARDIoGRAMplusC4D consortium, including 10 801 cases and 137 371 controls. Pleiotropic genes associated with both T2DM and CHD were analyzed using the MAGMA, PLACO and conditional false discovery rate (cFDR) methods. Mendelian randomization (MR) analysis was performed using inverse variance weighted (IVW) method, exploring the causal relationships among childhood obesity, T2DM and CHD. Heterogeneity was evaluated using Cochran's Q test, horizontal pleiotropy and exclude outliers were tested using MR-Egger regression and MR-PRESSO test. The mediating variables among the three diseases were investigated by using a mediation analysis.
Results:
The results of MAGMA, PLACO and cFDR analyses identified 80 pleiotropic genes associated with both T2DM and CHD, primarily distributed on chromosomes 3, 17 and 19. The MR analysis revealed that childhood obesity increased the risk of T2DM (OR=1.151, 95%CI: 1.033-1.283) and CHD (OR=1.158, 95%CI: 1.068-1.255), T2DM increased the risk of CHD (OR=1.182, 95%CI: 1.139-1.227), and CHD increased the risk of T2DM (OR=1.124, 95%CI: 1.055-1.198). The MR-Egger regression analysis showed no horizontal pleiotropy, and the MR-PRESSO test did not identify any outliers (all P>0.05). Mediation analysis indicated that childhood obesity directly increased the risk of CHD (effect value=0.096, 95%CI: 0.012-0.180) and indirectly increased the risk of CHD through T2DM (effect value=0.023, 95%CI: 0.005-0.041), with the mediation effect accounting for 15.65% of the total effect.
Conclusions
There are potential causal associations between childhood obesity and T2DM as well as CHD, with a bidirectional causal relationship between T2DM and CHD. T2DM also plays a mediating role in the association between childhood obesity and CHD.
6.Ablation of IGFBP5 expression alleviates neurogenic erectile dysfunction by inducing neurovascular regeneration
Jiyeon OCK ; Guo Nan YIN ; Fang-Yuan LIU ; Yan HUANG ; Fitri Rahma FRIDAYANA ; Minh Nhat VO ; Ji-Kan RYU
Investigative and Clinical Urology 2025;66(1):74-86
Purpose:
To investigate the therapeutic potential of eliminating insulin-like growth factor-binding protein 5 (IGFBP5) expression in improving erectile function in mice with cavernous nerve injury (CNI)-induced erectile dysfunction (ED).
Materials and Methods:
Eight-week-old male C57BL/6 mice were divided into four groups: a sham-operated group and three CNI-induced ED groups. The CNI-induced ED groups were treated with intracavernous injections 3 days before the CNI procedure.These injections included phosphate-buffered saline, scrambled control short hairpin RNA (shRNA), or shRNA targeting mouse IGFBP5 lentiviral particles. One week after CNI, erectile function was evaluated and the penile tissue was then harvested for histological examination and western blot analysis. Additionally, the major pelvic ganglia (MPG) and dorsal root ganglia (DRG) were cultured for ex vivo neurite outgrowth assays.
Results:
Following CNI, IGFBP5 expression in the cavernous tissues significantly increased, reaching its peak at day 7. First, ablation of IGFBP5 expression promotes neurite sprouting in MPG and DRG when exposed to lipopolysaccharide. Second, ablating IGFBP5 expression in CNI-induced ED mice improved erectile function, likely owing to increased neurovascular contents, including endothelial cells, pericytes, and neuronal processes. Third, ablating IGFBP5 expression in CNI-induced ED mice promoted neurovascular regeneration by increasing cell proliferation, reducing apoptosis, and decreasing Reactive oxygen species production. Finally, western blot analysis demonstrated that IGFBP5 ablation attenuated the JNK/c-Jun signaling pathway, activated the PI3K/AKT signaling pathway, and increased vascular endothelial growth factor and neurotrophic factor expression.
Conclusions
Ablating IGFBP5 expression enhanced neurovascular regeneration and ultimately improved erectile function in CNI-induced ED mice.
7.Effects of different storage temperatures and durations on the activity of coagulation factor Ⅷ and Ⅸ in whole blood
Hehe WANG ; Tiantian WANG ; Jie WANG ; Cuicui QIAO ; Wei LIU ; Xueqin ZHANG ; Yan CHENG ; Yunhai FANG ; Xinsheng ZHANG
Chinese Journal of Blood Transfusion 2025;38(6):824-827
Objective: To investigate the effects of different storage temperatures and durations on the activities of coagulation factor Ⅷ (Factor Ⅷ, FⅧ) and coagulation factor Ⅸ (Factor Ⅸ, FⅨ) after whole blood collection, so as to provide data support for the optimal storage conditions. Methods: A total of 16 mL of whole blood was collected from each of the 20 healthy volunteers at our blood center and aliquoted into 8 sodium citrate anticoagulant tubes. Two tubes were immediately centrifuged for the measurement of FⅧ and FⅨ activity levels. The remaining 6 tubes of whole blood were respectively stored under room temperature and low-temperature conditions. At 2, 4, and 6 h, the whole blood samples were centrifuged and analyzed for FⅧ and FⅨ activity levels. The mean values of the two immediately tested tubes were used as the control group, while other tubes were designated as the experimental groups for comparison. Statistical analysis was performed using SPSS 26.0. Results: The activity of FⅧ in whole blood remained stable after 4 hours of storage at both room temperature and low temperature (116.53±25.95 vs 125.22±27.33, 109.77±23.23 vs 125.22±27.33) (P>0.05 for both). However, by 6 hours, FⅧ activity showed a statistically significant decline compared to the control group (108.65±22.92 vs 125.22±27.33, 100.46±20.19 vs 125.22±27.33) (P<0.05 for both), though the room temperature group results were closer to the control values. The activity of FⅨ in whole blood remained stable after 6 hours of storage under both conditions (97.14±19.48 vs 96.76±19.67, 97.10±17.45 vs 96.76±19.6) (P>0.05 for all comparisons). Conclusion: For whole blood samples after collection, storage at either room temperature or low temperature for up to 4 hours does not compromise the accuracy of test results. When stored for 6 hours, FⅨ activity remains stable, whereas FⅧ activity decreases significantly. Notably, FⅧ activity demonstrates better stability at room temperature than under low-temperature conditions within the 6-hour storage.
8.Detection of residual DNA in host cells of Escherichia coli in levodopa by Real-time PCR
Bingyu XU ; YAN LIU ; Xinyao GUO ; Fang YAN ; Guibin SUN
Journal of China Pharmaceutical University 2025;56(2):176-182
Using Real-time PCR technology, a highly specific and sensitive method for detecting DNA residues of Escherichia coli host cells in levodopa was established, validated, and preliminarily applied. Escherichia coli strain MB6 16S ribosomal RNA gene was selected as the target gene to design multiple pairs of primers and the target fragment by specific amplification of PCR was obtained. The target fragment was cloned into the pLENTI-BSD-CON vector and the recombinant plasmid was constructed and named pLENTI-BSD-CON-E.coli-16S. A quantitative PCR detection method (SYBR Green method) with magnetic bead extraction and purification methods was established with the reference standard of the recombinant plasmid. Furthermore, the established method was validated, including linear and range, accuracy, precision, specificity, and quantification limit, and applied to the detection of levodopa raw materials. Meanwhile, the detection method was compared with the Taqman probe method by the commercial kit. The primer sequences of the quantitative PCR detection method (SYBR Green method) were TTCGATGCAACGCGAAGAAC (forward) and GTGTAGCCCTGGTCGTAAGG (reverse). The standard curve of DNA was in the range of 10 fg/μL to 3 ng/μL with good linearity (R2≥ 0.98). The quantitative limit was 10 fg/μL. In addition, the detection recovery rate was in the range of 59.7% to 80.7%, with RSD at less than 15%. Nine batches of levodopa were detected by this method, and the amount of E.coli DNA residue was below the limit. The developed qPCR method can be used for quantitative detection of residual DNA in biological products produced by E.coli as host cells, such as levodopa . The results indicate that the sensitivity of the detection method for recombinant plasmid construction standards is superior than the reagent kit detection method.
9.Iodine nutritional status of children aged 8-10 in Wuhan from 2019 to 2023
WANG Shuai, CHEN Fang, YANG Yan, LUO Huatang, LIU Cong, XU Wenxiu
Chinese Journal of School Health 2025;46(6):792-796
Objective:
To explore the iodine nutrition status of children in Wuhan from 2019 to 2023, and to evaluate the effect of iodine deficiency disorders control in focus groups in Wuhan, so as to provide a basis for consolidating elimination of iodine deficiency disorders.
Methods:
A total of 13 000 non boarding primary school students aged 8-10 were selected from 13 districts of Wuhan by stratified random sampling method.Household salt samples were collected to measure salt iodine content, random urine samples were analyzed for urinary iodine concentration. And B ultrasound was used to measure thyroid volume in students. The median of salt iodine, coverage rate of iodized salt, consumption rate of qualified iodized salt, median of urinary iodine, and the goiter rate were calculated. And Mann-Whitney U- test, Kruskal-Wallis H- test and Chi-square test were applied to compare between groups. Chi-square trend test was used to analyze the changing trends of coverage rate of iodized salt, consumption rate of qualified iodized salt and goiter rate among children in Wuhan.
Results:
The median of iodine content of children s household salt was 23.8 (21.7, 26.1) mg/kg, and the coverage rate of iodized salt was 98.7%, and the consumption rate of qualified iodized salt was 94.5 %. The consumption rates of qualified iodized salt showed an overall upward trend from 2019 to 2023 ( χ 2 trend =5.57, P <0.05). The median of urinary iodine of children was 220.1 (136.7, 326.0) μg/L,and boys had higher median of urinary iodine than girls [228.3(143.2, 336.0),210.2(129.1, 315.7) μg/L] ( Z =6.60, P <0.01). The median of urinary iodine of children in suburbs was higher than those in urban areas [236.3 (150.7, 342.2) , 207.1 (124.5, 309.8) μg/L]( Z =11.00, P <0.01). A total of 4 600 children were examined for thyroid volume, and the range of goiter rates were 1.1% to 3.4%, with an average goiter rate of 2.5%, which showed an overall downward trend from 2019 to 2023 ( χ 2 trend =5.11, P <0.05).
Conclusions
The iodine nutrition is sufficient and iodine nutrition status is good among children in Wuhan. It should continue to carry out monitoring and evaluation of children s iodine nutrition, guide the public to supplement iodine scientifically,so as to maintain the appropriate level of iodine for children.
10.Mechanism of Pharmacological Liver and Kidney Injuries of Dictamni Cortex Based on UPLC-Q-TOF-MS
Jiahe YAN ; Sujie LIU ; Xiaofan WANG ; Chen WANG ; Jiaxin RUAN ; Fang LU ; Shumin LIU
Chinese Journal of Experimental Traditional Medical Formulae 2025;31(20):48-56
ObjectiveThis study aims to reveal the mechanism of liver and kidney injuries caused by Dictamni Cortex and its interrelationship by metabonomics analysis of liver and kidney via ultra-performance liquid chromatography-quadrupole-time-of-flight mass spectrometry (UPLC-Q-TOF-MS). MethodsThe content of the marker compounds of Dictamni Cortex was measured by high-performance liquid chromatography (HPLC) to carry out quality control. Sprague Dawley (SD) rats were randomly divided into a blank group (normal saline), an administration group (0.9, 2.7, 8.1 g·kg-1), and a high-dose withdrawal control group, with eight rats in each group. Continuous administration was performed once daily for 28 days. The liver and kidney injuries caused by each administration group were assessed by organ indices, pathological observations, and serum and plasma biochemical indices measured by enzyme-linked immunosorbent assay (ELISA). The potential biomarkers of liver and kidney injuries caused by Dictamni Cortex were screened, and pathway enrichment analysis and correlation analysis were performed based on UPLC-Q-TOF-MS. ResultsCompared with the blank group, both the medium- and low-dose groups showed insignificant damage to the liver and kidney of rats. The high-dose group exhibited the most serious damage, and the level of liver and kidney function indices [alanine aminotransferase (ALT), aspartate aminotransferase (AST), creatinine (Cr), and blood urea nitrogen (BUN)] and serum inflammatory indices ([interleukin 1β (IL-1β), IL-6, and tumor necrosis factor-α (TNF-α)] in the serum were significantly changed (P<0.01). The liver and kidney metabolism pathways and differential metabolites were quite different. Among them, phenylalanine metabolism, niacin and nicotinamide metabolism, and glycerophospholipid metabolism were common pathways. Correlation analysis of differential metabolites showed that there were significant correlations among disorders of 4′-Phosphopantothenoylcysteine, PC (16∶0/15∶0), phenylethylamine, arachidonic acid, and linoleic acid in liver and kidney tissue. ConclusionThe decoction of Dictamni Cortex can cause liver and kidney injuries, and its mechanism may be related to oxidative stress and lipid metabolism disorders. The correlation of differential metabolites indicates the interaction between liver and kidney injuries.


Result Analysis
Print
Save
E-mail