Stroke is the leading cause of death and disability among adults in China， and its common complications include digestive system abnormalities， cognitive impairment， depression， stroke-associated pneumonia， and hemiplegia. The combination of traditional Chinese and Western medicine has great potential in treating post-stroke complications. Xinglou Chengqitang （XLCQT） is a representative prescription of alleviating the disease in the upper part by treating the lower part. It has definite therapeutic effect and high safety. Clinically， XLCQT is often used to treat stroke and its complications. However， the quantity and quality of clinical trials of XLCQT in treating post-stroke complications need to be improved. Additionally， since the basic research is weak， the material basis and multi-target mechanism for the efficacy of this prescription are unknown. This article reviews XLCQT in terms of the pharmacodynamic basis， medicinal properties， safety evaluation， and progress in clinical research and mechanisms in treating post-stroke complications. This article summarizes 22 key active ingredients of XLCQT in treating acute stroke complicated with syndrome of phlegm heat and fu-organ excess. Among these key active ingredients， resveratrol， kaempferol， luteolin， chrysoeriol， apigenin， （+）-catechin， and adenosine have good pharmacokinetic properties and high bioavailability. The mechanisms of XLCQT in treating post-stroke complications are complex， including inflammatory response， brain-gut axis， hypothalamic-pituitary-adrenal （HPA） axis， intestinal flora， neurotrophic factors， autophagy， oxidative stress， and free radical damage. This review helps to deeply understand the pharmacodynamic basis and mechanisms of XLCQT in treating post-stroke complications and provides a theoretical basis for the clinical application of XLCQT against post-stroke complications and the development of drugs.

ObjectiveTo explore the efficacy and mechanisms of Sini San in the treatment of depression and liver injury based on gut microbiota. MethodsThirty-two male Sprague-Dawley （SD） rats were randomly divided into a normal group， model group （M）， Sini San group （MS， 2.5 g·kg^-1）， and fluoxetine group （MF， 2 mg·kg^-1）. Except for the normal group， rats in the other three groups were subjected to chronic unpredictable mild stress （CUMS）. After 8 weeks， the open-field test and sucrose preference test were conducted. Enzyme-linked immunosorbent assay （ELISA） was used to detect serum corticosterone （CORT）， adrenocorticotropic hormone （ACTH）， corticotropin-releasing factor （CRF）， lipopolysaccharide （LPS）， Zonulin， interleukin-6 （IL-6）， tumor necrosis factor-α （TNF-α）， interleukin-1β （IL-1β）， γ-aminobutyric acid （GABA） levels in the hippocampus and prefrontal cortex， and brain-derived neurotrophic factor （BDNF） levels in the hippocampus. Real-time quantitative polymerase chain reaction （Real-time PCR） was used to detect hippocampal BDNF mRNA expression. Serum alanine aminotransferase （ALT） and aspartate aminotransferase （AST） levels were measured using the ultraviolet lactate dehydrogenase method. The ultrastructure of the intestinal epithelium was observed by electron microscopy， and gut microbiota in rat feces were analyzed using 16S rDNA high-throughput sequencing. ResultsCompared with the normal group， the sucrose preference of rats in the model group was significantly reduced （P0.01）， whereas it was significantly increased in the Sini San group compared with the model group （P0.05）. Compared with the normal group， hippocampal GABA protein levels and BDNF mRNA expression in the model group were significantly decreased （P0.05）， and compared with the model group， both were significantly increased in the Sini San group （P0.05， P0.01）. Compared with the normal group， serum LPS and Zonulin levels in the model group were significantly increased （P0.05， P0.01）， and compared with the model group， Zonulin levels in the Sini San group were significantly decreased （P0.05）. No obvious changes were observed in the ultrastructure of the jejunal mucosa among groups. Compared with the normal group， widened and blurred tight junctions， sparse and shortened microvilli， and mitochondrial swelling with cristae disruption in epithelial cells were observed in the ileal and colonic mucosa of the model group， which were markedly improved in the Sini San and fluoxetine groups. The results of 16S rDNA high-throughput sequencing showed that Sini San improved CUMS-induced dysbiosis of Bacteroidetes and Proteobacteria. Correlation analysis indicated that Bacteroidetes and Proteobacteria were significantly correlated with depression-related indicators， liver function， and intestinal mucosal permeability. ConclusionSini San exerts antidepressant and hepatoprotective effects by improving Bacteroidetes and Proteobacteria and inhibiting the increase in intestinal mucosal permeability in CUMS rats.

ObjectiveTo explore the efficacy and mechanisms of Sini San in the treatment of depression and liver injury based on gut microbiota. MethodsThirty-two male Sprague-Dawley （SD） rats were randomly divided into a normal group， model group （M）， Sini San group （MS， 2.5 g·kg^-1）， and fluoxetine group （MF， 2 mg·kg^-1）. Except for the normal group， rats in the other three groups were subjected to chronic unpredictable mild stress （CUMS）. After 8 weeks， the open-field test and sucrose preference test were conducted. Enzyme-linked immunosorbent assay （ELISA） was used to detect serum corticosterone （CORT）， adrenocorticotropic hormone （ACTH）， corticotropin-releasing factor （CRF）， lipopolysaccharide （LPS）， Zonulin， interleukin-6 （IL-6）， tumor necrosis factor-α （TNF-α）， interleukin-1β （IL-1β）， γ-aminobutyric acid （GABA） levels in the hippocampus and prefrontal cortex， and brain-derived neurotrophic factor （BDNF） levels in the hippocampus. Real-time quantitative polymerase chain reaction （Real-time PCR） was used to detect hippocampal BDNF mRNA expression. Serum alanine aminotransferase （ALT） and aspartate aminotransferase （AST） levels were measured using the ultraviolet lactate dehydrogenase method. The ultrastructure of the intestinal epithelium was observed by electron microscopy， and gut microbiota in rat feces were analyzed using 16S rDNA high-throughput sequencing. ResultsCompared with the normal group， the sucrose preference of rats in the model group was significantly reduced （P<0.01）， whereas it was significantly increased in the Sini San group compared with the model group （P<0.05）. Compared with the normal group， hippocampal GABA protein levels and BDNF mRNA expression in the model group were significantly decreased （P<0.05）， and compared with the model group， both were significantly increased in the Sini San group （P<0.05， P<0.01）. Compared with the normal group， serum LPS and Zonulin levels in the model group were significantly increased （P<0.05， P<0.01）， and compared with the model group， Zonulin levels in the Sini San group were significantly decreased （P<0.05）. No obvious changes were observed in the ultrastructure of the jejunal mucosa among groups. Compared with the normal group， widened and blurred tight junctions， sparse and shortened microvilli， and mitochondrial swelling with cristae disruption in epithelial cells were observed in the ileal and colonic mucosa of the model group， which were markedly improved in the Sini San and fluoxetine groups. The results of 16S rDNA high-throughput sequencing showed that Sini San improved CUMS-induced dysbiosis of Bacteroidetes and Proteobacteria. Correlation analysis indicated that Bacteroidetes and Proteobacteria were significantly correlated with depression-related indicators， liver function， and intestinal mucosal permeability. ConclusionSini San exerts antidepressant and hepatoprotective effects by improving Bacteroidetes and Proteobacteria and inhibiting the increase in intestinal mucosal permeability in CUMS rats.

Objective: To explore the early effects of birth weight at different gestational ages on blood pressure trajectory among primary school students, so as to provide evidence for incorporating gestational age birth weight into individualized early warning and intervention strategies for childhood hypertension. Methods: From May to November 2023, a purposeful sampling method was used to recruit 1 676 students in grade 1-3 from three primary schools in a certain urban district of Chongqing. Follow up assessments were conducted in May 2024(T1), November 2024(T2), and May 2025(T3). General demographic and birth related information were collected via self administered questionnaires, while height, weight and blood pressure were obtained through physical examinations. Linear mixed effects model was used to analyze the associations between birth weight at different gestational ages and blood pressure trajectories. Results: During the T1-T3 period, the systolic blood pressure of boys were 98.5 (93.0, 104.5 ),98.5 (93.5, 105.0), and 97.5 (92.5, 103.5)mmHg, respectively, while the diastolic blood pressure were 60.5 (56.5, 65.0), 61.5 ( 57.0 , 65.5), and 60.0 (56.0, 64.0)mmHg, respectively. For girls, the systolic blood pressure were 95.5 (90.0, 102.0),95.5 (90.5, 101.5), and 96.0 (90.5, 101.5)mmHg, respectively, and the diastolic blood pressure were 60.5 (56.0, 64.5 ),61.5 (57.5, 65.5), and 59.5 (56.0, 63.0)mmHg, respectively. Through Friedman test within both boys and girls, diostolic blood pressure were statistically significant across three measurements( χ 2=48.85，81.54，both P <0.01). The proportion of normal blood pressure increased , and the proportion of prehypertension and hypertension decreased with time( χ 2=39.72，25.62，both P < 0.01 ). Linear mixed effects model analysis revealed that after adjusting for age, sex, household income monthly, parental education, family history of hypertension and maternal pregnancy complications, large for gestational age had significantly higher trajectories of systolic ( β = 1.50) and diastolic( β =0.94) blood pressure compared to appropriate for gestational age(both P <0.01). Conclusion Large for gestational age is associated with elevated blood pressure trajectories during school age, and it may be considered as an early indicator for individualized screening and intervention for childhood hypertension.

Background Microparticles (MPs) are one of the main medium of inflammatory reaction with an important role in atherosclerotic progression. Studies on association of air pollution exposure and levels of peripheral blood MPs are limited among human. Objective To evaluate the effects of short-term exposure to air pollution on levels of peripheral blood MPs. Method A panel of 73 healthy adults was followed with 4 repeated follow-ups in Beijing, China, from November 2014 to January 2016. During each visit, we collected questionnaire information, fasting venous blood, urine, and exposures to fine particulate matter (PM_2.5), black carbon, nitric oxide, nitrogen dioxide, nitrogen oxide, sulfur dioxide, carbon monoxide, and ozone. We used linear mixed-effect models to analyze associations of air pollution exposure with levels of total MPs (TMPs) and MPs derived from various cells. Stratified analysis was conducted by levels of C-reactive protein (CRP) and malondialdehyde (MDA). Results The results showed significant associations between air pollution exposure and peripheral blood TMPs at 2 h-6 d prior to the follow-ups (P<0.05), while no statistical associations were found for MPs derived from different cell types. Significant increases in TMPs of 7.8% (95%CI: 0.7%, 15.3%) and 14.3% (95%CI: 2.8%, 27.2%) were observed with each interquartile range (IQR) increase in PM_2.5 (IQR=64.9 μg·m⁻³) at prior 18 h and NO (IQR=40.5 μg·m⁻³) at prior 48 h. Among participants with low levels of CRP and MDA, significantly positive associations were observed between air pollution exposure and levels of TMPs (P<0.05). Conclusion Short-term exposure to air pollution is significantly associated with increased levels of circulating MPs in healthy adults, and in people with lower systemic inflammation, peripheral blood MPs levels are more easily affected after exposure to air pollutants.

Objective: To investigate the effects of different storage temperatures and durations on the activities of coagulation factor Ⅷ (Factor Ⅷ, FⅧ) and coagulation factor Ⅸ (Factor Ⅸ, FⅨ) after whole blood collection, so as to provide data support for the optimal storage conditions. Methods: A total of 16 mL of whole blood was collected from each of the 20 healthy volunteers at our blood center and aliquoted into 8 sodium citrate anticoagulant tubes. Two tubes were immediately centrifuged for the measurement of FⅧ and FⅨ activity levels. The remaining 6 tubes of whole blood were respectively stored under room temperature and low-temperature conditions. At 2, 4, and 6 h, the whole blood samples were centrifuged and analyzed for FⅧ and FⅨ activity levels. The mean values of the two immediately tested tubes were used as the control group, while other tubes were designated as the experimental groups for comparison. Statistical analysis was performed using SPSS 26.0. Results: The activity of FⅧ in whole blood remained stable after 4 hours of storage at both room temperature and low temperature (116.53±25.95 vs 125.22±27.33, 109.77±23.23 vs 125.22±27.33) (P>0.05 for both). However, by 6 hours, FⅧ activity showed a statistically significant decline compared to the control group (108.65±22.92 vs 125.22±27.33, 100.46±20.19 vs 125.22±27.33) (P<0.05 for both), though the room temperature group results were closer to the control values. The activity of FⅨ in whole blood remained stable after 6 hours of storage under both conditions (97.14±19.48 vs 96.76±19.67, 97.10±17.45 vs 96.76±19.6) (P>0.05 for all comparisons). Conclusion: For whole blood samples after collection, storage at either room temperature or low temperature for up to 4 hours does not compromise the accuracy of test results. When stored for 6 hours, FⅨ activity remains stable, whereas FⅧ activity decreases significantly. Notably, FⅧ activity demonstrates better stability at room temperature than under low-temperature conditions within the 6-hour storage.

Using Real-time PCR technology, a highly specific and sensitive method for detecting DNA residues of Escherichia coli host cells in levodopa was established, validated, and preliminarily applied. Escherichia coli strain MB6 16S ribosomal RNA gene was selected as the target gene to design multiple pairs of primers and the target fragment by specific amplification of PCR was obtained. The target fragment was cloned into the pLENTI-BSD-CON vector and the recombinant plasmid was constructed and named pLENTI-BSD-CON-E.coli-16S. A quantitative PCR detection method (SYBR Green method) with magnetic bead extraction and purification methods was established with the reference standard of the recombinant plasmid. Furthermore, the established method was validated, including linear and range, accuracy, precision, specificity, and quantification limit, and applied to the detection of levodopa raw materials. Meanwhile, the detection method was compared with the Taqman probe method by the commercial kit. The primer sequences of the quantitative PCR detection method (SYBR Green method) were TTCGATGCAACGCGAAGAAC (forward) and GTGTAGCCCTGGTCGTAAGG (reverse). The standard curve of DNA was in the range of 10 fg/μL to 3 ng/μL with good linearity (R2≥ 0.98). The quantitative limit was 10 fg/μL. In addition, the detection recovery rate was in the range of 59.7% to 80.7%, with RSD at less than 15%. Nine batches of levodopa were detected by this method, and the amount of E.coli DNA residue was below the limit. The developed qPCR method can be used for quantitative detection of residual DNA in biological products produced by E.coli as host cells, such as levodopa . The results indicate that the sensitivity of the detection method for recombinant plasmid construction standards is superior than the reagent kit detection method.

Objective: To explore the iodine nutrition status of children in Wuhan from 2019 to 2023, and to evaluate the effect of iodine deficiency disorders control in focus groups in Wuhan, so as to provide a basis for consolidating elimination of iodine deficiency disorders. Methods: A total of 13 000 non boarding primary school students aged 8-10 were selected from 13 districts of Wuhan by stratified random sampling method.Household salt samples were collected to measure salt iodine content, random urine samples were analyzed for urinary iodine concentration. And B ultrasound was used to measure thyroid volume in students. The median of salt iodine, coverage rate of iodized salt, consumption rate of qualified iodized salt, median of urinary iodine, and the goiter rate were calculated. And Mann-Whitney U- test, Kruskal-Wallis H- test and Chi-square test were applied to compare between groups. Chi-square trend test was used to analyze the changing trends of coverage rate of iodized salt, consumption rate of qualified iodized salt and goiter rate among children in Wuhan. Results: The median of iodine content of children s household salt was 23.8 (21.7, 26.1) mg/kg, and the coverage rate of iodized salt was 98.7%, and the consumption rate of qualified iodized salt was 94.5 %. The consumption rates of qualified iodized salt showed an overall upward trend from 2019 to 2023 ( χ 2 trend =5.57， P <0.05). The median of urinary iodine of children was 220.1 (136.7, 326.0) μg/L,and boys had higher median of urinary iodine than girls [228.3(143.2, 336.0),210.2(129.1, 315.7) μg/L] ( Z =6.60, P <0.01). The median of urinary iodine of children in suburbs was higher than those in urban areas [236.3 (150.7, 342.2) , 207.1 (124.5, 309.8) μg/L]( Z =11.00, P <0.01). A total of 4 600 children were examined for thyroid volume, and the range of goiter rates were 1.1% to 3.4%, with an average goiter rate of 2.5%, which showed an overall downward trend from 2019 to 2023 ( χ 2 trend =5.11, P <0.05). Conclusions The iodine nutrition is sufficient and iodine nutrition status is good among children in Wuhan. It should continue to carry out monitoring and evaluation of children s iodine nutrition, guide the public to supplement iodine scientifically,so as to maintain the appropriate level of iodine for children.

ObjectiveThis study aims to reveal the mechanism of liver and kidney injuries caused by Dictamni Cortex and its interrelationship by metabonomics analysis of liver and kidney via ultra-performance liquid chromatography-quadrupole-time-of-flight mass spectrometry （UPLC-Q-TOF-MS）. MethodsThe content of the marker compounds of Dictamni Cortex was measured by high-performance liquid chromatography （HPLC） to carry out quality control. Sprague Dawley （SD） rats were randomly divided into a blank group （normal saline）， an administration group （0.9， 2.7， 8.1 g·kg^-1）， and a high-dose withdrawal control group， with eight rats in each group. Continuous administration was performed once daily for 28 days. The liver and kidney injuries caused by each administration group were assessed by organ indices， pathological observations， and serum and plasma biochemical indices measured by enzyme-linked immunosorbent assay （ELISA）. The potential biomarkers of liver and kidney injuries caused by Dictamni Cortex were screened， and pathway enrichment analysis and correlation analysis were performed based on UPLC-Q-TOF-MS. ResultsCompared with the blank group， both the medium- and low-dose groups showed insignificant damage to the liver and kidney of rats. The high-dose group exhibited the most serious damage， and the level of liver and kidney function indices ［alanine aminotransferase （ALT）， aspartate aminotransferase （AST）， creatinine （Cr）， and blood urea nitrogen （BUN）］ and serum inflammatory indices （［interleukin 1β （IL-1β）， IL-6， and tumor necrosis factor-α （TNF-α）］ in the serum were significantly changed （P<0.01）. The liver and kidney metabolism pathways and differential metabolites were quite different. Among them， phenylalanine metabolism， niacin and nicotinamide metabolism， and glycerophospholipid metabolism were common pathways. Correlation analysis of differential metabolites showed that there were significant correlations among disorders of 4′-Phosphopantothenoylcysteine， PC （16∶0/15∶0）， phenylethylamine， arachidonic acid， and linoleic acid in liver and kidney tissue. ConclusionThe decoction of Dictamni Cortex can cause liver and kidney injuries， and its mechanism may be related to oxidative stress and lipid metabolism disorders. The correlation of differential metabolites indicates the interaction between liver and kidney injuries.

ObjectiveTo explore the mechanism of the immunotoxicity induced by dictamnine （DIC） in rats and the recovery effect after drug withdrawal by ultra-performance liquid chromatography-quadrupole-time-of-flight mass spectrometry， thereby providing a theoretical basis for elucidating the toxic mechanism of DIC. MethodsSD rats were randomized into blank （normal saline）， DIC （10 mg·kg^-1）， and DIC withdrawal （recovery period） groups （n=8）. The rats were continuously treated for 7 days， once a day， and the body weight and organ weight were recorded. The levels of interleukin-1 （IL-1）， IL-6， and tumor necrosis factor-α （TNF-α） in the serum and immunoglobulin A （IgA）， immunoglobulin G （IgG）， and immunoglobulin M （IgM） in the spleen were determined by enzyme-linked immunosorbent assay. Hematoxylin-eosin staining was used to observe the pathological changes in the spleen. ultra performance liquid chromatography quadrupole time-of-flight mass spectrometry （UPLC-Q-TOF-MS） was employed to screen the potential biomarkers of immune inflammation caused by DIC， and pathway enrichment analysis and correlation analysis were performed. The mRNA levels of IL-1β， TNF-α， lysophosphatidylcholine acyltransferase 2 （LPCAT2）， and farnesoid X receptor （FXR） in the serum were determined by Real-time fluorescence quantitative polymerase chain reaction （Real-time PCR）. ResultsCompared with the blank group， the DIC group showed elevated levels of IL-1β， IL-6， and TNF-α in the serum （P<0.01）， and the DIC withdrawal group showcased lowered levels of IL-1β， IL-6， and TNF-α in the serum （P<0.01）. The levels of IgA， IgG， and IgM in the spleen of rats in the DIC group were decreased （P<0.01）， while those in the DIC withdrawal group were recovered （P<0.05， P<0.01）. Untargeted metabolomics of the serum and spleen screened out 14 common differential metabolites and 14 common metabolic pathways. The Spearman correlation analysis between differential metabolites and inflammatory factors identified PC （32∶0）， LysoPC （20∶4/0∶0）， LysoPC （P-18∶0/0∶0）， taurochenodeoxycholic acid， taurocholic acid， LysoPC ［20∶5（5Z，8Z，11Z，14Z，17Z）/0∶0］， chenodeoxycholic acid， arachidonic acid， LysoPC （18∶0/0∶0）， LysoPC （15∶0/0∶0）， LysoPC （16∶0/0∶0）， and LysoPC （17∶0/0∶0） as the biomarkers of immunotoxicity induced by DIC in SD rats. In the process of immunotoxicity caused by DIC， lipid metabolism disorders such as glycerophospholipid metabolism， primary bile acid metabolism， and arachidonic acid metabolism were enriched， which was consistent with the DIC-induced inflammatory factors and pathological characteristics of the spleen. Compared with the blank group， the DIC group exhibited up-regulated mRNA levels of IL-1β， TNF-α， LPCAT2， and FXR （P<0.01）， and the up-regulation was decreased in the withdrawal group （P<0.01）. ConclusionDIC can lead to immune and inflammatory disorders. DIC withdrawal can regulate the expression of biomarkers related to serum and spleen metabolites， regulate the inflammatory metabolic pathway， reduce the inflammation level， and alleviate the metabolic disorders， thus attenuating the potential toxicity induced by DIC.