1.Association of Body Mass Index with All-Cause Mortality and Cause-Specific Mortality in Rural China: 10-Year Follow-up of a Population-Based Multicenter Prospective Study.
Juan Juan HUANG ; Yuan Zhi DI ; Ling Yu SHEN ; Jian Guo LIANG ; Jiang DU ; Xue Fang CAO ; Wei Tao DUAN ; Ai Wei HE ; Jun LIANG ; Li Mei ZHU ; Zi Sen LIU ; Fang LIU ; Shu Min YANG ; Zu Hui XU ; Cheng CHEN ; Bin ZHANG ; Jiao Xia YAN ; Yan Chun LIANG ; Rong LIU ; Tao ZHU ; Hong Zhi LI ; Fei SHEN ; Bo Xuan FENG ; Yi Jun HE ; Zi Han LI ; Ya Qi ZHAO ; Tong Lei GUO ; Li Qiong BAI ; Wei LU ; Qi JIN ; Lei GAO ; He Nan XIN
Biomedical and Environmental Sciences 2025;38(10):1179-1193
OBJECTIVE:
This study aimed to explore the association between body mass index (BMI) and mortality based on the 10-year population-based multicenter prospective study.
METHODS:
A general population-based multicenter prospective study was conducted at four sites in rural China between 2013 and 2023. Multivariate Cox proportional hazards models and restricted cubic spline analyses were used to assess the association between BMI and mortality. Stratified analyses were performed based on the individual characteristics of the participants.
RESULTS:
Overall, 19,107 participants with a sum of 163,095 person-years were included and 1,910 participants died. The underweight (< 18.5 kg/m 2) presented an increase in all-cause mortality (adjusted hazards ratio [ aHR] = 2.00, 95% confidence interval [ CI]: 1.66-2.41), while overweight (≥ 24.0 to < 28.0 kg/m 2) and obesity (≥ 28.0 kg/m 2) presented a decrease with an aHR of 0.61 (95% CI: 0.52-0.73) and 0.51 (95% CI: 0.37-0.70), respectively. Overweight ( aHR = 0.76, 95% CI: 0.67-0.86) and mild obesity ( aHR = 0.72, 95% CI: 0.59-0.87) had a positive impact on mortality in people older than 60 years. All-cause mortality decreased rapidly until reaching a BMI of 25.7 kg/m 2 ( aHR = 0.95, 95% CI: 0.92-0.98) and increased slightly above that value, indicating a U-shaped association. The beneficial impact of being overweight on mortality was robust in most subgroups and sensitivity analyses.
CONCLUSION
This study provides additional evidence that overweight and mild obesity may be inversely related to the risk of death in individuals older than 60 years. Therefore, it is essential to consider age differences when formulating health and weight management strategies.
Humans
;
Body Mass Index
;
China/epidemiology*
;
Male
;
Female
;
Middle Aged
;
Prospective Studies
;
Rural Population/statistics & numerical data*
;
Aged
;
Follow-Up Studies
;
Adult
;
Mortality
;
Cause of Death
;
Obesity/mortality*
;
Overweight/mortality*
2.The taste correction process of ibuprofen oral solution based on the combination of electronic tongue technology and artificial taste comprehensive evaluation
Rui YUAN ; Yun-ping QU ; Yan WANG ; Ya-xuan ZHANG ; Wan-ling ZHONG ; Xiao-yu FAN ; Hui-juan SHEN ; Yun-nan MA ; Jin-hong YE ; Jie BAI ; Shou-ying DU
Acta Pharmaceutica Sinica 2024;59(8):2404-2411
This experiment aims to study the taste-masking effects of different kinds of corrigent used individually and in combination on ibuprofen oral solution, in order to optimize the taste-masking formulation. Firstly, a wide range of corrigent and the mass fractions were extensively screened using electronic tongue technology. Subsequently, a combination of sensory evaluation, analytic hierarchy process (AHP)-fuzzy mathematics evaluation, and Box-Behnken experimental design were employed to comprehensively assess the taste-masking effects of different combinations of corrigent on ibuprofen oral solution, optimize the taste-masking formulation, and validate the results. The study received ethical approval from the Review Committee of the Beijing University of Chinese Medicine (ethical code: 2024BZYLL0102). The results showed that corrigent fractions and types were screened separately through single-factor experiments. Subsequently, a Box-Behnken response surface design combined with AHP and fuzzy mathematics evaluation was used to fit a functional model:
3.Metanephric stromal tumor in children with BRAF V600E gene mutation: a case report and literature review
Shuting MAO ; Dao WANG ; Bai LI ; Shanshan LIU ; Linlin WEI ; Shufang SU ; Yan XU ; Ya′nan MA ; Ge ZHOU ; Yufeng LIU
Chinese Journal of Applied Clinical Pediatrics 2024;39(4):306-310
The clinical data of one child with metanephric stromal tumor (MST) and BRAF V600E gene mutation admitted to the First Affiliated Hospital of Zhengzhou University in June 2022 was analyzed retrospectively.Literature was reviewed.The patient, a 2-year-old girl, was diagnosed with a tumor in the left abdomen.The maximum diameter of the tumor was 10.5 cm.A radical nephrectomy was performed on the left kidney, and postoperative pathology revealed MST.Microscopically, the tumor had no envelope and exhibited expansive growth.The tumor cells were fusiform or stellate, and nuclear division was visible in the cell-rich region.Dysplastic blood vessels were seen inside the tumor.The tumor cells around the blood vessels and invaginated renal tubules were arranged like onion skin.CD34 was detected positive by immunohistochemical staining, and BRAF V600E mutation was also detected positive by fluorescent polymerase chain reaction.A total of 21 relevant case reports were retrieved, including 16 in English and 5 in Chinese.Fifty-eight MST patients, including the one in this report were analyzed.These patients were aged 2 days to 15 years, with a median age of 2 years.Except for 2 patients with unknown sex, the ratio of male to female was about 1.4∶1.0.Most MST patients were asymptomatic, with an average tumor size of 5.3 cm.The tumor cell CD34 showed positive expression in different degrees.Eight patients received the BRAF V600E mutation detection, and the results were all positive.Fifty-eight patients underwent nephrectomy and were followed up for 0-156 months, of which 7 patients were assisted with radiotherapy and chemotherapy.During the follow-up, 1 patient died, and 1 patient had a relapse.MST is a rare benign renal stromal tumor. BRAF V600E mutations are detected in a variety of malignancies.This paper is the first to report MST with BRAF V600E mutation in China and points out the importance of molecular detection of BRAF mutation for accurate diagnosis of MST.
4.Analysis of influencing factors of perioperative ischemic stroke in non-cardiac and non-neurosurgical surgeries
Ya-Zhen BAI ; Tong-Tong ZHENG ; Meng-Nan FAN ; Yi-Ru SHANG ; Gan-Qin DU ; Qi-Zhi FU
Medical Journal of Chinese People's Liberation Army 2024;49(10):1117-1122
Objective To explore the incidence and risk factors of perioperative ischemic stroke in non-cardiac and non-neurosurgical surgeries and its correlation with preoperative risk assessment of cerebrovascular events,so as to guide perioperative risk management.Methods A retrospective study was conducted on 40 patients aged≥18 years who underwent non-cardiac and non-neurosurgical surgeries and experienced perioperative ischemic stroke in the First Affiliated Hospital of Henan University of Science and Technology from January 2015 to January 2022,forming the stroke group.A control group of 160 patients without perioperative ischemic stroke was selected in a 1:4 case-control ratio,matched for gender,age,date of operation,and the surgeon.Clinical data and preoperative risk assessment of cerebrovascular events(including the single or combined application of head CT/MRI,transcranial Doppler ultrasound,carotid ultrasound,and neurological consultation)of the two groups of patients were collected and statistically analyzed.Multiple logistic regression analysis was used to identify risk factors associated with perioperative ischemic stroke.Results The incidence of perioperative ischemic stroke was 0.042%.Multiple logistic analysis results showed that hypertension(OR=7.858,95%CI 2.175-28.388,P=0.002),hyperlipidemia(OR=4.457,95%CI 1.320-15.049,P=0.016),renal insufficiency(OR=8.277,95%CI 1.480-46.282,P=0.016),and intraoperative hypotension(OR=3.862,95%CI 1.211-12.317,P=0.022)were independent risk factors for perioperative ischemic stroke in non-cardiac and non-neurological surgeries;preoperative cerebrovascular risk assessment(OR=0.130,95%CI 0.031-0.542,P=0.005)was a protective factor against it.Conclusions The incidence of perioperative ischemic stroke in non-cardiac and non-neurosurgical surgery is low but has a poor prognosis.Hypertension,hyperlipidemia,renal insufficiency,and postoperative hypotension are risk factors for perioperative ischemic stroke,while preoperative cerebrovascular event risk assessment is beneficial to reducing its incidence.
5.Research progress of intelligent reversible drug delivery system
Ke-xin CONG ; Xiao-dan SONG ; Ya-nan SUN ; Chao-xing HE ; Shao-kun YANG ; De-ying CAO ; Jing BAI ; Jia ZHANG ; Bai XIANG
Acta Pharmaceutica Sinica 2023;58(3):483-493
In the research on cancer theranostics, most environment-sensitive drug delivery systems can only achieve unidirectional and irreversible responsive changes under pathological conditions, thereby improving the targeting effect and drug release performance of the delivery system. However, such irreversible changes pose potential safety hazards when the dynamically distributed delivery system returns to the blood circulation or transports to the normal physiological environment. Intelligent reversible drug delivery systems can respond to normal physiological and pathological microenvironments to achieve bidirectional and reversible structural changes. This feature will help to precisely control the drug release of the delivery system, prolong the blood circulation time, improve the targeting efficiency, and avoid the potential safety hazards of the irreversible drug delivery system. In this review, we describe the research progress of intelligent reversible drug delivery system from two main aspects: controlled drug release and prolonged blood circulation time/enhanced cellular internalization of drug.
6.Phenotype and genotype analysis of progressive familial intrahepatic cholestasis type 4
Tingting YANG ; Shuzhen MA ; Ling LYU ; Yuan CHEN ; Ya′nan ZHANG ; Xinli BAI
Chinese Journal of Applied Clinical Pediatrics 2023;38(6):457-460
Objective:To improve the understanding of progressive familial intrahepatic cholestasis type 4 (PFIC4).Methods:Clinical characteristics in a 10-year-old boy with PFIC4 at the Second Hospital of Hebei Medical University in February 2020 were retrospectively analyzed, and the TJP2 gene mutations were analyzed. Results:The proband was a 10-year-old boy with a slow onset of intrahepatic cholestasis[normal γ-glutamyl transpeptidase(GGT)], hepatosplenomegaly and hepatic fibrosis.Laboratory tests showed elevated levels of total bilirubin, especially the direct bilirubin increased.Alanine aminotransferase, aspartate transaminase acid and total bile acid were elevated, while GGT remained in a normal range.Oral medication of ursodeoxycholic acid initially improved liver biochemical parameters, but later fluctuated.Adenosine dehydrogenase, coagulation indicators and hepatic fibrosis indexes were persistently abnormal.The average shear wave velocity of liver was 1.9 times of the upper limit of normal value.Compound heterozygous mutations c. 334G>A(p.A112T)/c.580_639delGACCGGAGCCGTGGCCGGAGCCTGGAGCGGGG-CCTGGACCAAGACCATGCGCGCACCCGA (p.194_213delDRSRGRSLERGLDQDHARTR) were found in the TJP2 gene.The deletion mutation of the TJP2 gene was reported for the first time throughout the world.Both of his parents carried a heterozygous mutation. Conclusions:PFIC should be considered in intrahepatic cholestasis patients with a normal range of GGT.The detection of TJP2 gene mutation is of great value in the clinical diagnosis of PFIC4.The presence of TJP2 gene mutation may be a risk factor for patient developing cirrhosis of liver and primary liver cancer in early childhood.It is necessary for children with PFIC4 to be closely followed up.
7.Treatment Outcomes in COVID-19 Patients with Brucellosis: Case Series in Heilongjiang and Systematic Review of Literature.
Man Li YANG ; Jing Ya WANG ; Xing Yu ZONG ; Li GUAN ; Hui Zhen LI ; Yi Bai XIONG ; Yu Qin LIU ; Ting LI ; Xin Yu JI ; Xi Yu SHANG ; Hui Fang ZHANG ; Yang GUO ; Zhao Yuan GONG ; Lei ZHANG ; Lin TONG ; Ren Bo CHEN ; Yi Pin FAN ; Jin QIN ; Fang WANG ; Gang LIN ; Nan Nan SHI ; Yan Ping WANG ; Yan MA
Biomedical and Environmental Sciences 2023;36(10):930-939
OBJECTIVE:
Clinical characteristics and outcome in COVID-19 with brucellosis patients has not been well demonstrated, we tried to analyze clinical outcome in local and literature COVID-19 cases with brucellosis before and after recovery.
METHODS:
We retrospectively collected hospitalization data of comorbid patients and prospectively followed up after discharge in Heilongjiang Infectious Disease Hospital from January 15, 2020 to April 29, 2022. Demographics, epidemiological, clinical symptoms, radiological and laboratory data, treatment medicines and outcomes, and follow up were analyzed, and findings of a systematic review were demonstrated.
RESULTS:
A total of four COVID-19 with brucellosis patients were included. One patient had active brucellosis before covid and 3 patients had nonactive brucellosis before brucellosis. The median age was 54.5 years, and all were males (100.0%). Two cases (50.0%) were moderate, and one was mild and asymptomatic, respectively. Three cases (75.0%) had at least one comorbidity (brucellosis excluded). All 4 patients were found in COVID-19 nucleic acid screening. Case C and D had only headache and fever on admission, respectively. Four cases were treated with Traditional Chinese medicine, western medicines for three cases, no adverse reaction occurred during hospitalization. All patients were cured and discharged. Moreover, one case (25.0%) had still active brucellosis without re-positive COVID-19, and other three cases (75.0%) have no symptoms of discomfort except one case fell fatigue and anxious during the follow-up period after recovery. Conducting the literature review, two similar cases have been reported in two case reports, and were both recovered, whereas, no data of follow up after recovery.
CONCLUSION
These cases indicate that COVID-19 patients with brucellosis had favorable outcome before and after recovery. More clinical studies should be conducted to confirm our findings.
Female
;
Humans
;
Male
;
Middle Aged
;
Brucellosis
;
COVID-19
;
Retrospective Studies
;
SARS-CoV-2
;
Treatment Outcome
;
Case Reports as Topic
8. Existence and morphology features of the myodural bridge in JapaLura Splendida
Xue BAI ; Hao-Nan KANG ; Ya-Ru DOU ; Wei TANG ; Hong-Jin SUI ; Nan ZHENG
Acta Anatomica Sinica 2023;54(2):220-225
Objective The dense fibrous connective tissue that connects sub-occipital muscles which consist of the rectus capitis posterior minor muscle (RCPmi), rectus capitis posterior major muscle (RCPma), obliquus capitis inferior muscle (OCI) and nuchal ligament (NL) to the spinal dura mater (SDM), is described as the myodural bridge (MDB) in humans. The MDB is perceived as an essential anatomical structure and has been a subject of interest for clinicians. Studies have revealed that MDB may be related to the dynamic circulation of the cerebrospinal fluid (CSF) and a chronic cervicogenic headache. To date, the MDB is identified as a universal, existing structure in mammals and it exists in other vertebrates as well, such as Gallus domesticus and Rock pigeons in Avifauna, Siamese crocodile and Trachemys scripta elegans in Reptile. The current study is to further analyze different structures features of the MDB in sundry classes and provide the anatomical basis for functional studies. The JapaLura Splendida is the most common species in Lacertiformes, Reptilia. So we chose it as the experimental object to supply the morphological study of the MDB in Reptilia. Methods The study was based on gross anatomical dissection, thick sheet section, histological staining to observe the structural characteristics of the post-occipital area of twenty JapaLura Splendidas and the existence of the MDB. Results The deep post-occipital muscles were composed of the rectus capitis dorsal muscle (RCD) and the obliquus capital posterior (OCP) muscle. The RCD was merged by the rectus capitis dorsal major muscle (RCDma), the rectus capitis dorsal minor muscle (RCDmi) and the obliquus capitis anterior muscle (OCA). In the atlanto-occipital space, the dense fibrous bundles were found to originate from the ventral aspect of the RCD and run ventral, closely inserting into the SDM. In the atlanto-axial space, the dense fibrous bundles were found to originate from the ventral aspect of the OCP and run ventral, closely contacted with the SDM. These dense fibrous bundles were the collagen type I fibers with strong double refraction. Conclusion The result of this study indicates that the MDB is located between the post-occipital muscles and the SDM in JapaLura Splendida. The MDB of Japalura splendida may be related to the activities of the head and neck, and exert a physiological function similar to the MDB in humans.
9.Construction of a core outcome set in clinical research of acupuncture and moxibustion for treatment of adhesive capsulitis.
Yang BAI ; Ya-Li HONG ; Bo CHEN ; Yi-Nan QIN ; Yuan-Hao DU
Chinese Acupuncture & Moxibustion 2023;43(6):701-705
This study aims to construct the core outcome set for the clinical trials of adhesive capsulitis treated with acupuncture and moxibustion. Using systematic review, semi-structured interview, Delphi questionnaire survey, analytic hierarchy process and expert consensus meeting, the primary outcomes are obtained, i.e. local tenderness, pain degree during movement, range of motion, changes in range of motion, function score, and score of local symptoms of shoulder joint. The secondary outcomes are myofascial thickness, thickness of the inferior wall of the joint capsule, health status, activity of daily living, incidence of adverse events, laboratory indexes, vital signs, cost-effectiveness, total effective rate, and patient satisfaction. It is expected to provide a reference for the outcome selection in clinical trials and the generation of medical evidences in the treatment of adhesive capsulitis with acupuncture and moxibustion.
Humans
;
Acupuncture Therapy
;
Bursitis/therapy*
;
Consensus
;
Moxibustion
;
Outcome Assessment, Health Care

Result Analysis
Print
Save
E-mail