1.Study on the catalytic mechanism of triterpene C-29 carboxylases from Tripterygium wilfordii based on directed evolution
Pan-ting LIU ; Yi-feng ZHANG ; Yuan LIU ; Jie GAO ; Lin MA ; Xiao-yi WU ; Ya-ting HU ; Ping SU ; Shi-jun YUAN ; Xia-nan ZHANG ; Wei GAO
Acta Pharmaceutica Sinica 2024;59(6):1883-1893
Celastrol and wilforlide A are the main active triterpenoids of the traditional Chinese medicine Lei Gong Teng, which have anti-tumour, anti-inflammatory and immunosuppressive activities, and are the material basis for the clinical efficacy of Lei Gong Teng-related Chinese medicinal preparations. By analysing the biosynthetic pathway of active ingredients, optimizing genetic elements and utilizing "cell factory" to produce triterpenoids heterologously will be an effective way to obtain from
2.The taste correction process of ibuprofen oral solution based on the combination of electronic tongue technology and artificial taste comprehensive evaluation
Rui YUAN ; Yun-ping QU ; Yan WANG ; Ya-xuan ZHANG ; Wan-ling ZHONG ; Xiao-yu FAN ; Hui-juan SHEN ; Yun-nan MA ; Jin-hong YE ; Jie BAI ; Shou-ying DU
Acta Pharmaceutica Sinica 2024;59(8):2404-2411
This experiment aims to study the taste-masking effects of different kinds of corrigent used individually and in combination on ibuprofen oral solution, in order to optimize the taste-masking formulation. Firstly, a wide range of corrigent and the mass fractions were extensively screened using electronic tongue technology. Subsequently, a combination of sensory evaluation, analytic hierarchy process (AHP)-fuzzy mathematics evaluation, and Box-Behnken experimental design were employed to comprehensively assess the taste-masking effects of different combinations of corrigent on ibuprofen oral solution, optimize the taste-masking formulation, and validate the results. The study received ethical approval from the Review Committee of the Beijing University of Chinese Medicine (ethical code: 2024BZYLL0102). The results showed that corrigent fractions and types were screened separately through single-factor experiments. Subsequently, a Box-Behnken response surface design combined with AHP and fuzzy mathematics evaluation was used to fit a functional model:
3.Metanephric stromal tumor in children with BRAF V600E gene mutation: a case report and literature review
Shuting MAO ; Dao WANG ; Bai LI ; Shanshan LIU ; Linlin WEI ; Shufang SU ; Yan XU ; Ya′nan MA ; Ge ZHOU ; Yufeng LIU
Chinese Journal of Applied Clinical Pediatrics 2024;39(4):306-310
The clinical data of one child with metanephric stromal tumor (MST) and BRAF V600E gene mutation admitted to the First Affiliated Hospital of Zhengzhou University in June 2022 was analyzed retrospectively.Literature was reviewed.The patient, a 2-year-old girl, was diagnosed with a tumor in the left abdomen.The maximum diameter of the tumor was 10.5 cm.A radical nephrectomy was performed on the left kidney, and postoperative pathology revealed MST.Microscopically, the tumor had no envelope and exhibited expansive growth.The tumor cells were fusiform or stellate, and nuclear division was visible in the cell-rich region.Dysplastic blood vessels were seen inside the tumor.The tumor cells around the blood vessels and invaginated renal tubules were arranged like onion skin.CD34 was detected positive by immunohistochemical staining, and BRAF V600E mutation was also detected positive by fluorescent polymerase chain reaction.A total of 21 relevant case reports were retrieved, including 16 in English and 5 in Chinese.Fifty-eight MST patients, including the one in this report were analyzed.These patients were aged 2 days to 15 years, with a median age of 2 years.Except for 2 patients with unknown sex, the ratio of male to female was about 1.4∶1.0.Most MST patients were asymptomatic, with an average tumor size of 5.3 cm.The tumor cell CD34 showed positive expression in different degrees.Eight patients received the BRAF V600E mutation detection, and the results were all positive.Fifty-eight patients underwent nephrectomy and were followed up for 0-156 months, of which 7 patients were assisted with radiotherapy and chemotherapy.During the follow-up, 1 patient died, and 1 patient had a relapse.MST is a rare benign renal stromal tumor. BRAF V600E mutations are detected in a variety of malignancies.This paper is the first to report MST with BRAF V600E mutation in China and points out the importance of molecular detection of BRAF mutation for accurate diagnosis of MST.
4.Phase Separation of Biomacromolecules and Its Important Role in Transcriptional Regulation
Xiang-Dong ZHAO ; Le WANG ; Lu-Jie MA ; De-Bao XIE ; Meng-Di GAO ; Ya-Nan MENG ; Fan-Li ZENG
Progress in Biochemistry and Biophysics 2024;51(4):743-753
Cells not only contain membrane-bound organelles (MBOs), but also membraneless organelles (MLOs) formed by condensation of many biomacromolecules. Examples include RNA-protein granules such as nucleoli and PML nuclear bodies (PML-NBs) in the nucleus, as well as stress granules and P-bodies in the cytoplasm. Phase separation is the basic organizing principle of the form of the condensates or membraneless organelles (MLOs) of biomacromolecules including proteins and nucleic acids. In particular, liquid-liquid phase separation (LLPS) compartmentalises and concentrates biological macromolecules into liquid condensates. It has been found that phase separation of biomacromolecules requires some typical intrinsic characteristics, such as intrinsically disordered regions, modular domains and multivalent interactions. The phase separation of biomacromolecules plays a key role in many important cell activities. In recent years, the phase separation of biomacromolecules phase has become a focus of research in gene transcriptional regulation. Transcriptional regulatory elements such as RNA polymerases, transcription factors (TFs), and super enhancers (SEs) all play important roles through phase separation. Our group has previously reported for the first time that long-term inactivation or absence of assembly factors leads to the formation of condensates of RNA polymerase II (RNAPII) subunits in the cytoplasm, and this process is reversible, suggesting a novel regulatory model of eukaryotic transcription machinery. The phase separation of biomacromolecules provides a biophysical understanding for the rapid transmission of transcriptional signals by a large number of TFs. Moreover, phase separation during transcriptional regulation is closely related to the occurrence of cancer. For example, the activation of oncogenes is usually associated with the formation of phase separation condensates at the SEs. In this review, the intrinsic characteristics of the formation of biomacromolecules phase separation and the important role of phase separation in transcriptional regulation are reviewed, which will provide reference for understanding basic cell activities and gene regulation in cancer.
5.Clinical and genetic analysis of a child with Canavan disease due to compound heterozygous variants of ASPA gene
Shasha NIU ; Yanyan MA ; Yuqiang LYU ; Hongmei XIN ; Dong WANG ; Yanxin WANG ; Ya′nan YANG ; Zilong LI ; Yi LIU ; Zhongtao GAI
Chinese Journal of Medical Genetics 2024;41(2):225-229
Objective:To analyze the clinical phenotype and genetic characteristics for a child with Canavan disease.Methods:A child who was admitted to the Children's Hospital Affiliated to Shandong University on April 9, 2021 for inability to uphold his head for 2 months and increased muscle tone for one week was subjected to whole exome sequencing, and candidate variants were verified by Sanger sequencing.Results:Genetic testing revealed that the child has harbored compound heterozygous variants of the ASPA gene, including a paternally derived c. 556_559dupGTTC (p. L187Rfs*5) and a maternally derived c.919delA (p. S307Vfs*24). Based on the guidelines from the American College of Medical Genetics and Genomics, both variants were predicted to be pathogenic (PVS1+ PM2_Supporting+ PM3). Conclusion:The c. 556_559dupGTTC (p.L187Rfs*5) and c. 919delA (p.S307Vfs*24) compound heterozygous variants of the ASPA gene probably underlay the pathogenesis of Canavan disease in this child.
6.Liraglutide in fluences human podocyte autophagy and apoptosis induced by high glucose through PI3K/Akt/mTOR pathway
Yalan ZHANG ; Xin MA ; Yangyan LUO ; Ya FENG ; Nan MAO
Chinese Journal of Diabetes 2024;32(5):380-388
Objective To investigate the impact and mechanism of Liraglutide on autophagy and apoptosis of human podocyte induced by high glucose.Methods Human podocytes were cultured in vitro,and grouped into normal control group(NC group),high glucose group(HG group),25 nmol/L Liraglutide group(HG+Lir 25 group),50 nmol/L Liraglutide group(HG+Lir 50 group),Liraglutide+LY294002 group(HG+Lir+LY294002 group),and Liraglutide+3-MA group(HG+Lir+3-MA group).The podocyte activity was detected by CCK-8.The apoptosis rate and morphology of podocytes were detected by flow cytometry and Hoechst 33342 staining.The expression of autophagic body and autophagic marker LC3 protein in podocyteswas observed by transmission electron microscopy and immunofluorescence staining.Western blot was applied to detect the expression of apoptosis,autophagy and phosphoinositol 3-kinase(PI3K)/protein kinase B(Akt)/mammalian target of rapamycin(mTOR)pathway related proteins in podocytes.Results Compared with NC group,the activity of podocytes and the expression of Bcl-2,Bcl-2/Bax,LC3 Ⅱ/LC3 Ⅰ,p-PI3K/PI3K,p-Akt/Akt proteins in HG group were decreased(P<0.05),while the apoptosis rate and the expression of Bax,p62,p-mTOR/mTOR proteins were increased in HG group(P<0.05).There were many podocytes with pyknotic nuclei,the number of autophagic bodies and the number of green fluorescent spots of LC3 protein were decreased in HG group.Compared with HG group,the activity of podocyte increased,and the expression of Bcl-2,Bcl-2/Bax,LC3 Ⅱ/LC3 Ⅰ,p-PI3K/PI3K,p-Akt/Akt protein increased(P<0.05),while the apoptosis rate and the expression of Bax,p62,p-mTOR/mTOR protein decreased(P<0.05)in HG+Lir 25 group and HG+Lir 50 group.The number of podocytes with karyopyknosis was reduced,the number of autophagosomes and the number of green fluorescent spots of LC3 protein were increased in HG+Lir 25 group and HG+Lir 50 group,and the above changes indexes were more obvious in the HG+Lir 50 group group.Compared with HG+Lir 50 group,PI3K/Akt/mTOR pathway could be regulated,and reduce the improvement of Liraglutide on podocyte viability,apoptosis and autophagy induced by high glucose in HG+Lir+LY294002 group and HG+Lir+3-MA group.Conclusion Liraglutide may promote the autophagy of human podocyte induced by high glucose and inhibit its apoptosis through PI3K/Akt/mTOR pathway.
7.Pathogenic characteristics of bloodstream infections in patients with hematological diseases and the impact of stem cell transplantation on them
CAI Ya-nan ; YE Li-yan ; ZHANG Guang-cun ; MA Wei ; GUO Ling ; WANG Li-feng ; MA Yan-ning ; YE Kun ; YANG Ji-yong
China Tropical Medicine 2023;23(4):392-
Abstract: Objective To investigate the epidemiological characteristics of pathogens causing bloodstream infection in hematology patients during treatment and to compare the effects of allogeneic hematopoietic stem cell transplantation (HSCT) on them, so as to provide evidence for the diagnosis and treatment of bloodstream infection. Methods A total of 292 cases with bloodstream infection in hematology wards of the PLA General Hospital were collected from 2017 to 2021, which were divided into HSCT group and N-HSCT group according to whether performed HSCT or not. The epidemiological characteristics and influence of pathogenic bacteria in blood stream infection were analyzed and compared between the two groups. Results A total of 362 strains of pathogenic bacteria were collected from 292 cases, including 106 strains in HSCT group (84 cases) and 256 strains in N-HSCT group (208 cases). Bloodstream infections were more common in acute myeloid leukemia (130/392, 44.52%), followed by non-Hodgkin's lymphoma (74/292, 25.34%). The rate of once bloodstream infection in HSCT group was higher than that in N-HSCT Group, but the rate of twice bloodstream infections in N-HSCT group was higher. Gram-negative Bacilli were the most common pathogens (56.08%), with Escherichia coli being absolutely dominant (109/362, 30.11%), followed by Klebsiella pneumoniae (39/362, 10.77%). Coagulase-negative staphylococci (CoNS) (107/362, 29.56%) were the most common Gram-positive cocci. The detection rate of fungi in HSCT group (10/106, 9.43%) was significantly higher than that in N-HSCT Group (3.52%). The drug resistance rate of the common pathogenic bacteria was at a high level, and there was a certain proportion of multi-drug resistant strains (except for Pseudomonas aeruginosa). The resistance rates of CoNS to penicillin, gentamicin, moxifloxacin, clindamycin and rifampicin in HSCT group were higher than those in N-HSCT Group. The resistance rate of Escherichia coli to piperacillin/tazobactam, cephalosporins and etapenem in HSCT group was significantly higher than that in N-HSCT group. Conclusions The pathogens of blood stream infection in hematology patients are complicated and various. It is difficult for clinical diagnosis and treatment to detect multiple infections and multiple pathogens. HSCT patients have a higher risk of fungal bloodstream infection and more multi-drug resistant strains detected. Therefore, the identification of bloodstream infection and multi-drug resistant strains associated with HSCT patients should prompt surveillance.
8.Incidence and prognosis of olfactory and gustatory dysfunctions related to infection of SARS-CoV-2 Omicron strain: a national multi-center survey of 35 566 population.
Meng Fan LIU ; Rui Xia MA ; Xian Bao CAO ; Hua ZHANG ; Shui Hong ZHOU ; Wei Hong JIANG ; Yan JIANG ; Jing Wu SUN ; Qin Tai YANG ; Xue Zhong LI ; Ya Nan SUN ; Li SHI ; Min WANG ; Xi Cheng SONG ; Fu Quan CHEN ; Xiao Shu ZHANG ; Hong Quan WEI ; Shao Qing YU ; Dong Dong ZHU ; Luo BA ; Zhi Wei CAO ; Xu Ping XIAO ; Xin WEI ; Zhi Hong LIN ; Feng Hong CHEN ; Chun Guang SHAN ; Guang Ke WANG ; Jing YE ; Shen Hong QU ; Chang Qing ZHAO ; Zhen Lin WANG ; Hua Bin LI ; Feng LIU ; Xiao Bo CUI ; Sheng Nan YE ; Zheng LIU ; Yu XU ; Xiao CAI ; Wei HANG ; Ru Xin ZHANG ; Yu Lin ZHAO ; Guo Dong YU ; Guang Gang SHI ; Mei Ping LU ; Yang SHEN ; Yu Tong ZHAO ; Jia Hong PEI ; Shao Bing XIE ; Long Gang YU ; Ye Hai LIU ; Shao wei GU ; Yu Cheng YANG ; Lei CHENG ; Jian Feng LIU
Chinese Journal of Otorhinolaryngology Head and Neck Surgery 2023;58(6):579-588
Objective: This cross-sectional investigation aimed to determine the incidence, clinical characteristics, prognosis, and related risk factors of olfactory and gustatory dysfunctions related to infection with the SARS-CoV-2 Omicron strain in mainland China. Methods: Data of patients with SARS-CoV-2 from December 28, 2022, to February 21, 2023, were collected through online and offline questionnaires from 45 tertiary hospitals and one center for disease control and prevention in mainland China. The questionnaire included demographic information, previous health history, smoking and alcohol drinking, SARS-CoV-2 vaccination, olfactory and gustatory function before and after infection, other symptoms after infection, as well as the duration and improvement of olfactory and gustatory dysfunction. The self-reported olfactory and gustatory functions of patients were evaluated using the Olfactory VAS scale and Gustatory VAS scale. Results: A total of 35 566 valid questionnaires were obtained, revealing a high incidence of olfactory and taste dysfunctions related to infection with the SARS-CoV-2 Omicron strain (67.75%). Females(χ2=367.013, P<0.001) and young people(χ2=120.210, P<0.001) were more likely to develop these dysfunctions. Gender(OR=1.564, 95%CI: 1.487-1.645), SARS-CoV-2 vaccination status (OR=1.334, 95%CI: 1.164-1.530), oral health status (OR=0.881, 95%CI: 0.839-0.926), smoking history (OR=1.152, 95%CI=1.080-1.229), and drinking history (OR=0.854, 95%CI: 0.785-0.928) were correlated with the occurrence of olfactory and taste dysfunctions related to SARS-CoV-2(above P<0.001). 44.62% (4 391/9 840) of the patients who had not recovered their sense of smell and taste also suffered from nasal congestion, runny nose, and 32.62% (3 210/9 840) suffered from dry mouth and sore throat. The improvement of olfactory and taste functions was correlated with the persistence of accompanying symptoms(χ2=10.873, P=0.001). The average score of olfactory and taste VAS scale was 8.41 and 8.51 respectively before SARS-CoV-2 infection, but decreased to3.69 and 4.29 respectively after SARS-CoV-2 infection, and recovered to 5.83and 6.55 respectively at the time of the survey. The median duration of olfactory and gustatory dysfunctions was 15 days and 12 days, respectively, with 0.5% (121/24 096) of patients experiencing these dysfunctions for more than 28 days. The overall self-reported improvement rate of smell and taste dysfunctions was 59.16% (14 256/24 096). Gender(OR=0.893, 95%CI: 0.839-0.951), SARS-CoV-2 vaccination status (OR=1.334, 95%CI: 1.164-1.530), history of head and facial trauma(OR=1.180, 95%CI: 1.036-1.344, P=0.013), nose (OR=1.104, 95%CI: 1.042-1.171, P=0.001) and oral (OR=1.162, 95%CI: 1.096-1.233) health status, smoking history(OR=0.765, 95%CI: 0.709-0.825), and the persistence of accompanying symptoms (OR=0.359, 95%CI: 0.332-0.388) were correlated with the recovery of olfactory and taste dysfunctions related to SARS-CoV-2 (above P<0.001 except for the indicated values). Conclusion: The incidence of olfactory and taste dysfunctions related to infection with the SARS-CoV-2 Omicron strain is high in mainland China, with females and young people more likely to develop these dysfunctions. Active and effective intervention measures may be required for cases that persist for a long time. The recovery of olfactory and taste functions is influenced by several factors, including gender, SARS-CoV-2 vaccination status, history of head and facial trauma, nasal and oral health status, smoking history, and persistence of accompanying symptoms.
Female
;
Humans
;
Adolescent
;
SARS-CoV-2
;
Smell
;
COVID-19/complications*
;
Cross-Sectional Studies
;
COVID-19 Vaccines
;
Incidence
;
Olfaction Disorders/etiology*
;
Taste Disorders/etiology*
;
Prognosis
9.Phenotype and genotype analysis of progressive familial intrahepatic cholestasis type 4
Tingting YANG ; Shuzhen MA ; Ling LYU ; Yuan CHEN ; Ya′nan ZHANG ; Xinli BAI
Chinese Journal of Applied Clinical Pediatrics 2023;38(6):457-460
Objective:To improve the understanding of progressive familial intrahepatic cholestasis type 4 (PFIC4).Methods:Clinical characteristics in a 10-year-old boy with PFIC4 at the Second Hospital of Hebei Medical University in February 2020 were retrospectively analyzed, and the TJP2 gene mutations were analyzed. Results:The proband was a 10-year-old boy with a slow onset of intrahepatic cholestasis[normal γ-glutamyl transpeptidase(GGT)], hepatosplenomegaly and hepatic fibrosis.Laboratory tests showed elevated levels of total bilirubin, especially the direct bilirubin increased.Alanine aminotransferase, aspartate transaminase acid and total bile acid were elevated, while GGT remained in a normal range.Oral medication of ursodeoxycholic acid initially improved liver biochemical parameters, but later fluctuated.Adenosine dehydrogenase, coagulation indicators and hepatic fibrosis indexes were persistently abnormal.The average shear wave velocity of liver was 1.9 times of the upper limit of normal value.Compound heterozygous mutations c. 334G>A(p.A112T)/c.580_639delGACCGGAGCCGTGGCCGGAGCCTGGAGCGGGG-CCTGGACCAAGACCATGCGCGCACCCGA (p.194_213delDRSRGRSLERGLDQDHARTR) were found in the TJP2 gene.The deletion mutation of the TJP2 gene was reported for the first time throughout the world.Both of his parents carried a heterozygous mutation. Conclusions:PFIC should be considered in intrahepatic cholestasis patients with a normal range of GGT.The detection of TJP2 gene mutation is of great value in the clinical diagnosis of PFIC4.The presence of TJP2 gene mutation may be a risk factor for patient developing cirrhosis of liver and primary liver cancer in early childhood.It is necessary for children with PFIC4 to be closely followed up.
10.The expression and significance of protease activated receptor 2 in ovarian epithelial carcinoma.
Shuang Huan LIU ; Yi Ming MA ; Ya Nan ZHANG ; Xin Hua ZHAO ; Hong Ying WANG ; Bin LI
Chinese Journal of Oncology 2023;45(1):64-73
Objective: To investigate the expression and significance of protease activated receptor 2 (PAR2) in ovarian epithelial carcinoma. Methods: PAR2 mRNA expression levels in 410 cases of epithelial ovarian carcinoma and 88 cases of human normal ovary were analyzed from cancer Genome Atlas (TCGA) database and tissue genotypic expression database (GTEx). Immunohistochemical (IHC) staining of PAR2 protein was performed in 149 patients with ovarian cancer who underwent primary surgical treatment at Cancer Hospital of Chinese Academy of Medical Sciences. Then the relationship between mRNA/protein expression of PAR2 and clinicopathological features and prognosis was analyzed. Gene functions and related signaling pathways involved in PAR2 were studied by enrichment analysis. Results: The mRNA expression of PAR2 in epithelial ovarian carcinoma was significantly higher than that in normal ovarian tissue (3.05±0.72 vs. 0.33±0.16, P=0.004). There were 77 cases showing positive and 19 showing strong positive of PAR2 IHC staining among the 149 patients, accounting for 64.4% in total. PAR2 mRNA/protein expression was closely correlated with tumor reduction effect and initial therapeutic effect (P<0.05). Survival analysis showed that the progression free survival time (P=0.033) and overall survival time (P=0.011) in the group with high PAR2 mRNA expression was significantly lower than that in the low PAR2 mRNA group. Multivariate analysis showed tumor reduction effect, initial therapeutic effect were independent prognostic factors on both progression-free survival and overall survival (P<0.05). The progression-free survival (P=0.016) and overall survival (P=0.038) of the PAR2 protein high expression group was significantly lower than that of the low group. Multivariate analysis showed PAR2 expression, initial treatment effect and chemotherapy resistance were independent prognostic factors on both progression-free survival and overall survival (P<0.05). Based on Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG), PAR2 target genes were mainly enriched in function related to intercellular connection, accounting for 40%. Gene enrichment analysis (GSEA) showed that the Wnt/β-catenin signaling pathway (P=0.023), the MAPK signaling pathway (P=0.029) and glycolysis related pathway (P=0.018) were enriched in ovarian cancer patients with high PAR2 mRNA expression. Conclusions: PAR2 expression is closely related to tumor reduction effect, initial treatment effect and survival of ovarian cancer patients. PAR2 may be involved in Wnt/β-catenin signaling pathway and intercellular connection promoting ovarian cancer invasion and metastasis.
Female
;
Humans
;
Carcinoma, Ovarian Epithelial
;
Receptor, PAR-2
;
Ovarian Neoplasms/pathology*
;
Prognosis
;
RNA, Messenger/metabolism*

Result Analysis
Print
Save
E-mail