AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

Since its emergence in the 1980s, the human immunodeficiency virus (HIV) has caused a global pandemic, posing a severe threat to human life and health as well as social development. Although pre-exposure prophylaxis (PrEP) effectively curbs HIV transmission and antiretroviral therapy (ART) significantly extends the lifespan of patients, vaccines remain a pivotal tool for blocking transmission and ending the pandemic. The high genetic variability of HIV-1, the glycan shield of its envelope glycoproteins, and the long-term persistence of latent reservoirs have repeatedly led to bottlenecks in traditional vaccine strategies. In recent years, mRNA technology has offered a novel approach to addressing these challenges, leveraging advantages such as sequence programmability, short production cycles, native conformational expression of antigens, and self-adjuvant effects. In recent years, mRNA vaccine technology has emerged as a transformative solution to longstanding vaccinology challenges, characterized by its sequence programmability, rapid production cycles, native conformational antigen expression, and intrinsic self-adjuvanting properties. Unlike traditional platforms reliant on pathogen culture or recombinant proteins, mRNA vaccines can be expeditiously designed and updated based solely on viral genomic sequences. Lipid nanoparticle (LNP)-encapsulated mRNA facilitates endogenous antigen expression and presentation, simultaneously eliciting potent humoral and cellular immune responses. Within this landscape, self-amplifying mRNA (saRNA) further extends in vivo antigen expression to enhance the persistence of immune responses. Moreover, the LNP delivery system not only protects mRNA from degradation and mediates endosomal escape but also synergizes with mRNA to optimize immune activation via self-adjuvant effects. Importantly, mRNA platforms circumvent the pre-existing immunity associated with viral vectors and the genomic integration risks of DNA vaccines, positioning them as a cornerstone for global pandemic preparedness. This review systematically delineates recent advances in mRNA technology for HIV-1 vaccine development, focusing on four pivotal research frontiers. First, mRNA innovations building upon the RV144 trial optimize antigens through codon modification and multivalent designs to induce more durable and broad-spectrum immunity. Second, particulate mRNA vaccine strategies, utilizing virus-like particles (VLPs) and ferritin nanoparticles, achieve in situ antigen self-assembly, significantly enhancing B cell activation and reducing infection risks in non-human primate models. Third, germline-targeting mRNA vaccines address the low-affinity barrier of broadly neutralizing antibody (bNAp) precursors, efficiently activating rare precursor B cells and promoting affinity maturation. Fourth, therapeutic mRNA vaccines offer unique advantages for an HIV functional cure; combining immunogens with mRNA-encoded adjuvants potentiates cellular immunity, while LNP-mediated “shock-and-kill” strategies specifically activate latent reservoirs to guide immune clearance. Comparative analyses with traditional platforms reveal that mRNA technology redefines antigen production and presentation, simulating chronic infection through sustained expression and enabling dual-pathway presentation via endogenous synthesis. Furthermore, we explore the mechanistic innovations of mRNA vaccines in inducing bNAps: sustained in vivo production prolongs the activation window for precursor B cells and maintains germinal center (GC) reactions; endogenously expressed antigens adopt native conformations to expose conserved epitopes; and self-adjuvanting effects modulate the functions of antigen-presenting cells (APCs) and follicular helper T cells (Tfh), driving somatic hypermutation and affinity maturation. We also address critical clinical translation challenges, including immune durability, adaptability to special populations, and large-scale LNP manufacturing, while proposing targeted optimization strategies. In conclusion, this review establishes a theoretical framework for utilizing mRNA technology to overcome HIV-1 immune escape, transitioning from a descriptive paradigm to a problem-solving-based synthesis of evidence. By integrating preclinical and early clinical data, we bridge the gap between basic design and translational verification. mRNA technology is poised to become a central pillar inHIV-1 prevention and therapy, providing a robust toolset to achieve the global goal of ending the AIDS pandemic and offering a blueprint for vaccine development against other recalcitrant infectious diseases.

ObjectiveThe malaria parasites remodel the host erythrocyte structure by exporting parasite proteins that interact with the membrane skeleton proteins of red blood cells (RBCs), facilitating their intracellular survival and pathogenicity. Skeleton-binding protein 1 (SBP1) is a conserved exported protein across Plasmodium species. In Plasmodium falciparum, SBP1 has been reported to interact with erythrocyte membrane skeleton proteins 4.1R and spectrin, while its contribution to erythrocyte remodeling and parasite virulence in Plasmodium berghei (Pb) remains unclear. This study aims to determine whether PbSBP1 associates with the host cytoskeletal protein 4.1R and to investigate its role in the remodeling of host RBCs and the pathogenicity of Plasmodium berghei. MethodsIn Plasmodium berghei, the relationship between PbSBP1 and the erythrocyte cytoskeletal protein 4.1R was examined using co-immunoprecipitation. A Pbsbp1 gene knockout mutant of Plasmodium berghei (Pbsbp1∆) was generated based on the principle of double crossover homologous recombination. The deformability of erythrocytes infected with Pbsbp1∆ parasites was assessed using microfluidic methods. Microchannels with an array of cylindrical pillars were used to detect modifications in infected RBC deformability. The infected RBCs were squashed between the rows and recovered between the columns and the transit velocity (μm/s) of infected RBCs travelling through the microchannel was recorded. The component of the erythrocyte membrane skeleton junctional complex, tropomodulin (TMOD), was fluorescently labeled, and the cytoskeletal network of infected erythrocytes was imaged using super-resolution stochastic optical reconstruction microscopy (STORM) to analyze ultrastructural changes in the cytoskeleton of wild-type (WT) and Pbsbp1∆-infected erythrocytes. Actin-based junctional complexes were displayed as individual clusters by the labeled TMOD in the STORM images, and the cluster densities and distances between adjacent clusters of infected RBCs were calculated. Additionally, rodent malaria models (BALB/c mice) and experimental cerebral malaria models (C57BL/6 mice) were employed to monitor the growth of Pbsbp1∆ and WT parasites during the intraerythrocytic stage and their capacity to induce cerebral malaria in mice. ResultsPbSBP1 may participate in the remodeling of infected erythrocytes through direct or indirect interaction with the erythrocyte cytoskeletal protein 4.1R. Microfluidic assays revealed that the deformability of erythrocytes infected with Pbsbp1∆ parasites was significantly enhanced compared to those infected with WT parasites. STORM imaging further demonstrated that the ultrastructure of the erythrocyte cytoskeleton in Pbsbp1∆-infected cells was altered relative to that in WT-infected erythrocytes. The distances between nearest neighbors of clusters had a tendency to increase while the cluster densities were decreased in Pbsbp1∆-infected RBCs compared to WT-infected RBCs. Subsequent phenotypic analysis indicated that the growth rate of Pbsbp1∆ parasites during the intraerythrocytic stage was significantly slower than that of WT parasites, and their ability to induce cerebral malaria in mice was also attenuated. These findings suggest that PbSBP1 is involved in the remodeling of the erythrocyte membrane skeleton, likely through its direct or indirect interaction with protein 4.1R, thereby regulating the deformability of infected erythrocytes and influencing the pathogenicity of the blood-stage parasites. ConclusionThis study establishes a role for PbSBP1 in host erythrocyte remodeling and parasite virulence, providing new research strategies for the prevention and treatment of malaria.

Hepatocellular carcinoma (HCC) is a lethal cancer with high morbidity rates worldwide. It is a major threat to public health in China, due to the combination of known and new risk factors, such as endemic hepatitis B virus (HBV), dietary aflatoxin exposure, and the occurrence of metabolic dysfunction-associated steatotic liver disease (MASLD). Although many methods for surveillance and multimodal therapies, such as surgery, local ablation, transarterial therapy, and new systemic agents, have been available, the survival rates of HCC remains poor. They have very limited durable responses, long post-treatment recurrence rates, and high resistance to treatment. This reflects an imperfect picture of the biological cause of the disease and a need for new mechanistic or targeted techniques. A significant characteristic of HCC, in common with other aggressive cancers, is the presence of reprogrammed, hyperactive cell metabolism. Tumor cells hijack metabolic pathways to promote their uncontrolled growth, stress survival, invasion and metastasis. While classical mechanisms such as the Warburg effect, lipid metabolism and glutamine utilization have been understood, the lysosome, which was once viewed as a static “waste disposal unit” to remove old organelles and proteins, is instead a dynamic signaling and metabolic core. The lysosomes incorporate nutrients, energy and stress signals by master regulators such as mTORC1 (activated on its surface) that balance anabolic growth and catabolic recycling to the cellular demands. In HCC, lysosomes are not passive, but are highly active and dysregulated. HCC cells upregulate lysosomes, which scavenge intracellular components via enhanced autophagy and engulf extracellular proteins via macropinocytosis, crucial for survival in the nutrient-poor, hypoxic tumor microenvironment. In addition to metabolism, lysosomes exhibit pro-invasive functions by secreting hydrolases to remodel the extracellular matrix, promote angiogenesis, and suppress stromal immune cells to foster a pro-tumor microenvironment. In a clinical context, lysosomes play an important role in therapeutic resistance: they sequester and inactivate chemotherapeutics via lysosomal sequestration, and enhanced autophagic flux protects the cell from therapy-induced damage, contributing to relapse, as lysosomal dysfunction is a key cause of treatment failure. This makes lysosomes promising yet challenging therapeutic targets in HCC. Recent preclinical and early clinical studies investigate multiple strategies to exploit the susceptibility of lysosomes: lysosome-specific agents, alkalinizing the lysosome lumen or inducing membrane permeabilization and lysosome-dependent cell death; pharmacological inhibition of key lysosomal enzymes or autophagy to impair nutrient recycling and stress adaptation; smart nanotherapeutic agents or antibody-drug conjugates, specifically activated in the acidic lysosomal environment or utilizing lysosomal pathways for efficient intracellular drug release; and combination strategies of lysosome-targeting agents with tyrosine kinase inhibitors or immunotherapy to overcome resistance and achieve synergistic antitumor effects. In summary, our review systematically presents the role of lysosomes in HCC, from metabolic reprogramming and microenvironmental adaptation to therapeutic resistance. By synthesizing the latest mechanistic insights and preclinical advances, this review highlights the indispensable role of lysosomes in the complex HCC biological network, emphasizing that an in-depth understanding of this dynamic organelle holds great promise for developing innovative, targeted therapies, offering new hope for improving the poor prognosis of global HCC patients.

ObjectiveThis paper aims to investigate and evaluate the staged efficacy and safety of the representative empirical prescription of the “Zhu Ke Jiao” theory， Qijia Rougan prescription， combined with entecavir in the treatment of hepatic fibrosis in chronic hepatitis B. MethodsA multicenter randomized controlled clinical study was conducted， and 101 patients diagnosed with chronic hepatitis B-related hepatic fibrosis （CHB-HF） who met the diagnosis and inclusion criteria were randomly assigned to an observation group （Qijia Rougan prescription + entecavir） and a control group （entecavir）. The treatment duration was 24 weeks. Liver stiffness measurement （LSM）， fibrosis-4 index （FIB-4）， portal vein diameter， hepatitis B serology， biochemical indicators， hepatic fibrosis markers in serum ［hyaluronic acid （HA）， laminin （LN）， procollagen Ⅲ peptide （PⅢP）， and type Ⅳ collagen （Ⅳ-C）］， and traditional Chinese medicine syndrome scores were used as efficacy evaluation indicators. Efficacy assessments and explorations of different staged subgroups of Qijia Rougan prescription were conducted according to LSM values based on the Metavir pathological staging standard. ResultsA total of 98 cases were included for statistical analysis， with 49 cases in the observation group and 49 in the control group. The general data of the patients in both groups were comparable. Compared with the same group before treatment， the observation group showed a significant reduction in LSM and FIB-4 （P<0.01）， as well as notable improvements in LN， Ⅳ-C， and various TCM syndrome scores （P<0.05， P<0.01）. When compared to the control group after treatment， the observation group demonstrated significant improvements in LSM， FIB-4， and various TCM syndrome score indicators （P<0.05， P<0.01）， indicating that the observation group performed better than the control group. Subgroup analysis of the regression of hepatic fibrosis stages showed that compared to the same group before treatment， the observation group had better improvement in regression of stages F2 and F3 （P<0.05）. When compared to the control group after treatment， the observation group exhibited superior improvement in regression of stage F3 （P<0.05）. No adverse events occurred in either group during the treatment period. ConclusionCompared with entecavir alone， the combination of Qijia Rougan prescription and entecavir significantly improves the degree of hepatic fibrosis and clinical TCM symptoms in patients. The optimal intervention period is primarily during stage F3， which is a potential “interception” point of the “Zhu Ke Jiao” theory.

With the accelerating trend of population aging, the number of elderly patients with lung cancer continues to rise, and the disease burden is becoming increasingly heavy. The clinical management of these patients faces severe challenges due to their decreased physiological reserve, complex comorbidities, and significant individual heterogeneity. Consequently, under traditional diagnosis and treatment models, doctors often struggle to identify the individualized risks of elderly patients in a timely and comprehensive manner, which can easily lead to decision biases such as undertreatment or overtreatment. In view of this, this study advocates for the establishment of an umbrella decision-making model specifically tailored for elderly lung cancer patients. Grounded in a multidisciplinary team (MDT) platform, this model deeply integrates oncological indicators with the comprehensive geriatric assessment (CGA) system. By holistically considering multidimensional variables including tumor burden, organ function, frailty index, cognitive status, and social support, the model establishes an operational mechanism characterized by "single entry, precise stratification, and targeted selection". Accordingly, patients can be scientifically triaged into distinct intervention tiers, such as active surveillance, minimally invasive surgery, drug therapy, radiotherapy, and best supportive care, thereby achieving real-time alignment between treatment intensity and patient fitness. This article elaborates on the construction logic and key operational procedures of this novel decision-making framework, aiming to guide clinical practice beyond the limitations of a tumor-centric perspective toward a holistic, dynamic, whole-course management strategy. This transition seeks to ensure optimal quality of life and clinical net benefit for elderly patients alongside survival prolongation.

ObjectiveThis paper aims to investigate the differential mechanisms underlying the staged therapeutic effects of Qijia Rougan formula on liver fibrosis using proteomic technology. MethodsThe staged rat model of liver fibrosis was established by subcutaneous injection of carbon tetrachloride （CCl₄） and olive oil. One hundred and four SD rats were randomized into thirteen groups：a normal group，a two-week model group，a four-week model group，a six-week model group，an eight-week model group，a two-week Qijia Rougan formula group，a four-week Qijia Rougan formula group，a six-week Qijia Rougan formula group，an eight-week Qijia Rougan formula group，a two-week compound Biejia Ruangan tablet group，a four-week Compound Biejia Ruangan Tablet group，a six-week Compound Biejia Ruangan Tablet group，and an eight-week compound Biejia Ruangan tablet group. After two weeks of drug intervention，liver tissue and abdominal aortic blood samples were collected from the rats for testing. Hematoxylin-eosin （HE） staining，Masson staining，and Picro Sirius red staining were used to observe pathological damage and collagen fiber deposition in liver tissues. Immunohistochemistry （IHC） was employed to detect the contents of fibrosis markers in liver tissues. The contents of liver function indicators in the serum were measured using a fully automated biochemical analyzer，and the levels of liver fibrosis indicators in the serum were assessed by enzyme-linked immunosorbent assay （ELISA）. Liver tissues from the normal group，each model group，and each Qijia Rougan formula group were subjected to label-free quantitative proteomic analysis to identify differential proteins among the groups，with key proteins validated by Western blot. Finally，bioinformatics analysis was performed on the differential proteins. Results（1） The staged rat model of liver fibrosis constructed with CCl₄ and olive oil showed pathological results at the 2^nd，4^th，6^th，and 8^th weeks of modeling that were consistent with the Metavir standards for the F1，F2，F3，and F4 stages. Compared with those in the normal control group，the protein expressions of α-smooth muscle actin （α-SMA） and Collagen Ⅰ were significantly increased in each stage （P<0.05）. The levels of liver function indicators in the serum，including alanine aminotransferase （ALT），aspartate aminotransferase （AST），alkaline phosphatase （ALP），direct bilirubin （DBIL），and total bilirubin （TBil） in each model group，were significantly elevated in each stage （P<0.01）. The levels of liver fibrosis indicators in the serum，including procollagen Ⅲ peptide （PⅢP），type Ⅳ collagen（Ⅳ-C），hyaluronic acid （HA），and laminin （LN） in each model group，were significantly increased in each stage （P<0.05，P<0.01）. This study successfully established a staged rat model of liver fibrosis. （2） Compared with the model groups at each stage，the administration groups showed a reduction in hepatocyte ballooning degeneration，a more orderly arrangement of hepatocytes，and a decrease of inflammatory cell infiltration. The blue-stained collagen fibers became significantly thinner and finer，with reduced and narrowed fibrous septa. The areas of collagen fibers and Picro Sirius red staining were reduced （P<0.05）. The positive areas of α-SMA and Collagen Ⅰ expression were significantly decreased （P<0.05）. The levels of ALT，AST，ALP，DBIL，and TBil in the rats of the model groups at each stage were significantly reduced （P<0.05，P<0.01）. The levels of PⅢP，Ⅳ-C，HA，and LN in the rats of the model groups at each stage were significantly decreased （P<0.05）. Among these，the improvements in all indicators were most significant in the F3 stage （P<0.01）.（3） The proteomic results show that a total of 165 differential proteins exhibit a callback trend when comparing the model groups at four stages with the normal group，and when comparing the Qijia Rougan formula group with the model group. Western blot analysis reveals that the levels of NAD（P）H：quinone oxidoreductase 1 （NQO1），mitogen-activated protein kinase 1 （MAPK1），arginase 1 （Arg1），and glutathione S-transferase α1 （GSTA1） were consistent with the proteomic results. Bioinformatics results reveal that 165 differentially expressed proteins are enriched in multiple signaling pathways. Notably，signaling pathways such as drug metabolism-cytochrome P450，arginine biosynthesis，and the peroxisome proliferator-activated receptor （PPAR） signaling pathway were found to be closely associated with liver fibrosis，suggesting that the Qijia Rougan formula may exert its staged regulatory effects on liver fibrosis by regulating these pathways. ConclusionThe Qijia Rougan formula may achieve staged regulation of liver fibrosis by regulating drug metabolism-cytochrome P450，arginine biosynthesis，and the PPAR signaling pathway.

To investigate the effect of mesenchymal stromal cells (MSCs) on the fibrosis progression and endometrial regeneration in mouse models of endometrial injury, a mouse endometrial injury model was established by physical scraping combined with lipopolysaccharide (LPS) chemical induction, and the endometrium morphology and collagen deposition were evaluated by HE and Masson staining after unilateral administration of MSCs. RT-qPCR and immunofluorescence were used to detect the expression of epithelial markers Epcam and collagen I (Col1). Primary endometrial epithelial cells were isolated to assess p21 expression. Fibrosis-related genes and signaling pathways were validated using transcriptome sequencing and RT-qPCR. The experimental results showed that MSCs increased endometrial thickness and number of glands (P<0.05), up-regulated the expression of Epcam (P<0.01), while significantly reducing uterine collagen fiber deposition (P<0.05) and the expression of p21 in primary epithelial cells (P<0.0001). Transcriptomic analysis revealed that MSCs attenuated collagen deposition by modulating genes involved in the TGF-β signaling pathway. This study elucidates that MSCs facilitate uterine repair by reversing endometrial fibrosis and promoting epithelial regeneration, and their role is related to the regulation of the TGF-β/SMAD pathway and suppression of aberrant collagen accumulation.

BACKGROUND: Atrial fibrillation (AF) is a common cardiac arrhythmia in the elderly. This study aimed to evaluate urban-rural disparities in its prevalence and management in elderly Chinese. METHODS: Consecutive participants aged ≥ 65 years attending outpatient clinics were enrolled for AF screening using handheld single-lead electrocardiogram (ECG) from April 2017 to December 2022. Each ECG rhythm strip was reviewed from the research team. AF or uninterpretable single-lead ECGs were referred for 12-lead ECG. Primary study outcome comparison was between rural and urban areas for the prevalence of AF. The Student's t-test was used to compare mean values of clinical characteristics between rural and urban participants, while the Pearson's chi-square test was used to compare between-group proportions. Multivariate stepwise logistic regression analysis was performed to estimate the association between AF and various patient characteristics. RESULTS: The 29,166 study participants included 13,253 men (45.4%) and had a mean age of 72.2 years. The 7073 rural participants differed significantly (P ≤ 0.02) from the 22,093 urban participants in several major characteristics, such as older age, greater body mass index, and so on. The overall prevalence of AF was 4.6% (n = 1347). AF was more prevalent in 7073 rural participants than 22,093 urban participants (5.6% vs. 4.3%, P < 0.01), before and after adjustment for age, body mass index, blood pressure, pulse rate, cigarette smoking, alcohol consumption and prior medical history. Multivariate logistic regression analysis identified overweight/obesity (OR = 1.35, 95% CI: 1.17-1.54) in urban areas and cigarette smoking (OR = 1.62, 95% CI: 1.20-2.17) and alcohol consumption (OR = 1.42, 95% CI: 1.04-1.93) in rural areas as specific risk factors for prevalent AF. In patients with known AF in urban areas (n = 781) and rural areas (n = 338), 60.6% and 45.9%, respectively, received AF treatment (P < 0.01), and only 22.4% and 17.2%, respectively, received anticoagulation therapy (P = 0.05). CONCLUSIONS In China, there are urban-rural disparities in AF in the elderly, with a higher prevalence and worse management in rural areas than urban areas. Our study findings provide insight for health policymakers to consider urban-rural disparity in the prevention and treatment of AF.

BACKGROUND: Blood glucose and serum albumin have been associated with cardiovascular disease prognosis, but the impact of admission-blood-glucose-to-albumin ratio (AAR) on adverse outcomes in critical ill coronary artery disease (CAD) patients was not investigated. METHODS: Patients diagnosed with CAD were non-consecutively selected from the MIMIC-IV database and categorized into quartiles based on their AAR. The primary outcome was 1-year mortality, and secondary endpoints were in-hospital mortality, acute kidney injury (AKI), and renal replacement therapy (RRT). A restricted cubic splines model and Cox proportional hazard models assessed the association between AAR and adverse outcomes in CAD patients. Kaplan-Meier survival analysis determined differences in endpoints across subgroups. RESULTS: A total of 8360 patients were included. There were 726 patients (8.7%) died in the hospital and 1944 patients (23%) died at 1 year. The incidence of AKI and RRT was 63% and 4.3%, respectively. High AAR was markedly associated with in-hospital mortality (HR = 1.587, P = 0.003), 1-year mortality (HR = 1.502, P < 0.001), AKI incidence (HR = 1.579, P < 0.001), and RRT (HR = 1.640, P < 0.016) in CAD patients in the completely adjusted Cox proportional hazard model. Kaplan-Meier survival analysis noted substantial differences in all endpoints based on AAR quartiles. Stratified analysis and interaction test demonstrated stable correlations between AAR and outcomes. CONCLUSIONS The results highlight that AAR may be a potential indicator for assessing in-hospital mortality, 1-year mortality, and adverse renal prognosis in critical CAD patients.