1.Related research on pathogenic candidate genes for familial blepharophimosis-ptosis-epicanthus inversus syndrome
Xin TAN ; Linan JIAO ; Xianfang PU ; Yunqin LI ; Yue ZOU ; Jianshu KANG
International Eye Science 2026;26(1):142-147
AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.
2.Staged Efficacy of Qijia Rougan Prescription Combined with Entecavir for Chronic Hepatitis B-related Hepatic Fibrosis with Qi Deficiency and Collateral Stasis Syndrome Based on "Zhu Ke Jiao" Theory
Baixue LI ; Xin WANG ; Jibin LIU ; Li WEN ; Cen JIANG ; Wenjun WU ; Dong WANG ; Shuwan LIU ; Huabao LIU ; Yongli ZHENG ; Liang HUANG ; Yue SU ; Song ZHANG ; Yanan SHANG ; Hang ZHOU ; Quansheng FENG
Chinese Journal of Experimental Traditional Medical Formulae 2026;32(9):180-188
ObjectiveThis paper aims to investigate and evaluate the staged efficacy and safety of the representative empirical prescription of the “Zhu Ke Jiao” theory, Qijia Rougan prescription, combined with entecavir in the treatment of hepatic fibrosis in chronic hepatitis B. MethodsA multicenter randomized controlled clinical study was conducted, and 101 patients diagnosed with chronic hepatitis B-related hepatic fibrosis (CHB-HF) who met the diagnosis and inclusion criteria were randomly assigned to an observation group (Qijia Rougan prescription + entecavir) and a control group (entecavir). The treatment duration was 24 weeks. Liver stiffness measurement (LSM), fibrosis-4 index (FIB-4), portal vein diameter, hepatitis B serology, biochemical indicators, hepatic fibrosis markers in serum [hyaluronic acid (HA), laminin (LN), procollagen Ⅲ peptide (PⅢP), and type Ⅳ collagen (Ⅳ-C)], and traditional Chinese medicine syndrome scores were used as efficacy evaluation indicators. Efficacy assessments and explorations of different staged subgroups of Qijia Rougan prescription were conducted according to LSM values based on the Metavir pathological staging standard. ResultsA total of 98 cases were included for statistical analysis, with 49 cases in the observation group and 49 in the control group. The general data of the patients in both groups were comparable. Compared with the same group before treatment, the observation group showed a significant reduction in LSM and FIB-4 (P<0.01), as well as notable improvements in LN, Ⅳ-C, and various TCM syndrome scores (P<0.05, P<0.01). When compared to the control group after treatment, the observation group demonstrated significant improvements in LSM, FIB-4, and various TCM syndrome score indicators (P<0.05, P<0.01), indicating that the observation group performed better than the control group. Subgroup analysis of the regression of hepatic fibrosis stages showed that compared to the same group before treatment, the observation group had better improvement in regression of stages F2 and F3 (P<0.05). When compared to the control group after treatment, the observation group exhibited superior improvement in regression of stage F3 (P<0.05). No adverse events occurred in either group during the treatment period. ConclusionCompared with entecavir alone, the combination of Qijia Rougan prescription and entecavir significantly improves the degree of hepatic fibrosis and clinical TCM symptoms in patients. The optimal intervention period is primarily during stage F3, which is a potential “interception” point of the “Zhu Ke Jiao” theory.
3.Application of Recombinant Collagen in Biomedicine
Huan HU ; Hong ZHANG ; Jian WANG ; Li-Wen WANG ; Qian LIU ; Ning-Wen CHENG ; Xin-Yue ZHANG ; Yun-Lan LI
Progress in Biochemistry and Biophysics 2025;52(2):395-416
Collagen is a major structural protein in the matrix of animal cells and the most widely distributed and abundant functional protein in mammals. Collagen’s good biocompatibility, biodegradability and biological activity make it a very valuable biomaterial. According to the source of collagen, it can be broadly categorized into two types: one is animal collagen; the other is recombinant collagen. Animal collagen is mainly extracted and purified from animal connective tissues by chemical methods, such as acid, alkali and enzyme methods, etc. Recombinant collagen refers to collagen produced by gene splicing technology, where the amino acid sequence is first designed and improved according to one’s own needs, and the gene sequence of improved recombinant collagen is highly consistent with that of human beings, and then the designed gene sequence is cloned into the appropriate vector, and then transferred to the appropriate expression vector. The designed gene sequence is cloned into a suitable vector, and then transferred to a suitable expression system for full expression, and finally the target protein is obtained by extraction and purification technology. Recombinant collagen has excellent histocompatibility and water solubility, can be directly absorbed by the human body and participate in the construction of collagen, remodeling of the extracellular matrix, cell growth, wound healing and site filling, etc., which has demonstrated significant effects, and has become the focus of the development of modern biomedical materials. This paper firstly elaborates the structure, type, and tissue distribution of human collagen, as well as the associated genetic diseases of different types of collagen, then introduces the specific process of producing animal source collagen and recombinant collagen, explains the advantages of recombinant collagen production method, and then introduces the various systems of expressing recombinant collagen, as well as their advantages and disadvantages, and finally briefly introduces the application of animal collagen, focusing on the use of animal collagen in the development of biopharmaceutical materials. In terms of application, it focuses on the use of animal disease models exploring the application effects of recombinant collagen in wound hemostasis, wound repair, corneal therapy, female pelvic floor dysfunction (FPFD), vaginal atrophy (VA) and vaginal dryness, thin endometritis (TE), chronic endometritis (CE), bone tissue regeneration in vivo, cardiovascular diseases, breast cancer (BC) and anti-aging. The mechanism of action of recombinant collagen in the treatment of FPFD and CE was introduced, and the clinical application and curative effect of recombinant collagen in skin burn, skin wound, dermatitis, acne and menopausal urogenital syndrome (GSM) were summarized. From the exploratory studies and clinical applications, it is evident that recombinant collagen has demonstrated surprising effects in the treatment of all types of diseases, such as reducing inflammation, promoting cell proliferation, migration and adhesion, increasing collagen deposition, and remodeling the extracellular matrix. At the end of the review, the challenges faced by recombinant collagen are summarized: to develop new recombinant collagen types and dosage forms, to explore the mechanism of action of recombinant collagen, and to provide an outlook for the future development and application of recombinant collagen.
4.Expression of IP3R2 and RYR2 mediated Ca2+signals in a mouse model of delayed encephalopathy after acute carbon monoxide poisoning
Jili ZHAO ; Tianyu MENG ; Yarong YUE ; Xin ZHANG ; Wenqian DU ; Xinyu ZHANG ; Hui XUE ; Wenping XIANG
Chinese Journal of Tissue Engineering Research 2025;29(2):254-261
BACKGROUND:Ca2+expression in astrocytes has been found to be closely related to cognitive function,and the Ca2+signaling pathway regulated by inositol 1,4,5-trisphosphate receptors(IP3R2)and ryanodine receptor(RYR)2 receptors has become a hot spot in the study of cognitive disorder-related diseases. OBJECTIVE:To investigate the expression of Ca2+signals mediated by IP3R2 and RYR2 in hippocampal astrocytes in animal models of delayed encephalopathy after acute carbon monoxide poisoning,and to explore the possible pathogenesis of delayed encephalopathy after acute carbon monoxide poisoning. METHODS:C57BL mice with qualified cognitive function were selected by Morris water maze experiment and randomly divided into control group and experimental group.An animal model of delayed encephalopathy after acute carbon monoxide poisoning was established by static carbon monoxide inhalation in the experimental group,and the same amount of air was inhaled in the control group.Behavioral and neuronal changes,astrocyte specific marker glial fibrillary acidic protein,IP3R2,RYR2 receptor and Ca2+concentration in astrocytes of the two groups were detected using Morris water maze,hematoxylin-eosin staining,western blot,immunofluorescence double labeling and Ca2+fluorescence probe at 21 days after modeling. RESULTS AND CONCLUSION:In the Morris water maze,the escape latency of the experimental group was significantly longer than that of the control group(P<0.05).Hematoxylin-eosin staining results showed that in the experimental group,the number of hippocampal pyramidal cells decreased,the cell structure was disordered,and the nucleus was broken and dissolved.Immunofluorescence results showed that IP3R2 and RYR2 were co-expressed with glial fibrillary acidic protein in the hippocampus,and the expressions of IP3R2,RYR2 and glial fibrillary acidic protein were up-regulated in the hippocampus of the experimental group(P<0.05).Western blot analysis showed that the expressions of IP3R2,RYR2,and glial fibrillary acidic protein in the hippocampus of the experimental group were increased(P<0.05).Ca2+concentration in hippocampal astrocytes increased significantly in the experimental group(P<0.05).To conclude,astrocytes may affect Ca2+signals by mediating IP3R2 and RYR2 receptors,then impair the cognitive function of mice with carbon monoxide poisoning,and eventually lead to delayed encephalopathy after acute carbon monoxide poisoning.
5.Bufei Tongbi Decoction Inhibits Pulmonary Fibrosis in Diabetic Rats via TGF-β1/p-Smad3 Signaling Pathway
Gang WANG ; Rensong YUE ; Qiyue YANG ; Dan ZHANG ; Xin CHEN
Chinese Journal of Experimental Traditional Medical Formulae 2025;31(10):176-184
ObjectiveTo study the effect of Bufei Tongbi decoction on pulmonary fibrosis in diabetic rats via the transforming growth factor-β1 (TGF-β1)/phosphorylated Smad family member 3 (p-Smad3) signaling pathway. MethodsStreptozotocin (60 mg·kg-1) and bleomycin (24.80 U·kg-1) were used to prepare the rat model of diabetes with pulmonary fibrosis by intratracheal injection. Sixty rats were randomly assigned into blank, model, low-, medium-, and high-dose (3.98, 7.95, and 15.90 g·kg-1, respectively) Bufei Tongbi decoction, and pirfenidone (0.36 mg·kg-1) groups (n=10). The successfully modeled rats in each group were administrated with corresponding agents once per day for four consecutive weeks. After drug administration, fasting blood glucose and lung function indicators were measured. Chemical immunoassay was employed to determine the serum levels of hydroxyproline (Hyp), hyaluronic acid (HA), and laminin (LN). The lung index was determined by the wet and dry methods. The pathological changes in the lung tissue were observed by hematoxylin-eosin (HE) staining, and the degree of fibrosis was detected by Masson staining. The mRNA and protein levels of TGF-β1, p-Smad3, Smad3, α-smooth muscle actin (α-SMA), collagen type Ⅰ alpha 1 (Col1A1), and fibronectin were determined by PCR and Western blotting, respectively. ResultsCompared with the blank group, the model group showed alveolar septa thickening, obvious thickening of the basement membrane of pulmonary blood vessels, severe destruction of the alveolar structure, structural disarrangement of the lung parenchyma, and an increase in the proportion of inflammatory cell infiltration in the lung tissue, together with a large amount of blue collagen deposition and a large amount of collagen fibroplasia in the bronchial wall, vessel wall, interstitium, and alveolar wall, which indicated severe fibrosis. Bufei Tongbi decoction groups and the pirfenidone group showed lower fasting blood glucose level (P<0.05) and higher forced vital capacity (FVC), cytoplasmic dynein (Cydn), FEV0.3/FEV ratio, and lung index (P<0.05) than the model group. Moreover, these groups demonstrated alleviated lung fibrosis, elevated Hyp, HA, and LN levels, down-regulated mRNA levels of α-SMA, Col1A1, and fibronectin, and down-regulated protein levels of TGF-β1, Smad3, p-Smad3, α-SMA, Col1A1, and fibronectin (P<0.05). ConclusionBufei Tongbi decoction can inhibit pulmonary fibrosis in diabetic rats by inhibiting the TGF-β1/p-Smad3 signaling pathway.
6.Heterogeneity of Adipose Tissue From a Single-cell Transcriptomics Perspective
Yong-Lang WANG ; Si-Si CHEN ; Qi-Long LI ; Yu GONG ; Xin-Yue DUAN ; Ye-Hui DUAN ; Qiu-Ping GUO ; Feng-Na LI
Progress in Biochemistry and Biophysics 2025;52(4):820-835
Adipose tissue is a critical energy reservoir in animals and humans, with multifaceted roles in endocrine regulation, immune response, and providing mechanical protection. Based on anatomical location and functional characteristics, adipose tissue can be categorized into distinct types, including white adipose tissue (WAT), brown adipose tissue (BAT), beige adipose tissue, and pink adipose tissue. Traditionally, adipose tissue research has centered on its morphological and functional properties as a whole. However, with the advent of single-cell transcriptomics, a new level of complexity in adipose tissue has been unveiled, showing that even under identical conditions, cells of the same type may exhibit significant variation in morphology, structure, function, and gene expression——phenomena collectively referred to as cellular heterogeneity. Single-cell transcriptomics, including techniques like single-cell RNA sequencing (scRNA-seq) and single-nucleus RNA sequencing (snRNA-seq), enables in-depth analysis of the diversity and heterogeneity of adipocytes at the single-cell level. This high-resolution approach has not only deepened our understanding of adipocyte functionality but also facilitated the discovery of previously unidentified cell types and gene expression patterns that may play key roles in adipose tissue function. This review delves into the latest advances in the application of single-cell transcriptomics in elucidating the heterogeneity and diversity within adipose tissue, highlighting how these findings have redefined the understanding of cell subpopulations within different adipose depots. Moreover, the review explores how single-cell transcriptomic technologies have enabled the study of cellular communication pathways and differentiation trajectories among adipose cell subgroups. By mapping these interactions and differentiation processes, researchers gain insights into how distinct cellular subpopulations coordinate within adipose tissues, which is crucial for maintaining tissue homeostasis and function. Understanding these mechanisms is essential, as dysregulation in adipose cell interactions and differentiation underlies a range of metabolic disorders, including obesity and diabetes mellitus type 2. Furthermore, single-cell transcriptomics holds promising implications for identifying therapeutic targets; by pinpointing specific cell types and gene pathways involved in adipose tissue dysfunction, these technologies pave the way for developing targeted interventions aimed at modulating specific adipose subpopulations. In summary, this review provides a comprehensive analysis of the role of single-cell transcriptomic technologies in uncovering the heterogeneity and functional diversity of adipose tissues.
7.Process Optimization and Health Risk Assessment of Calcined Haematitum Based on QbD Concept
Yue YANG ; Jingwei ZHOU ; Jialiang ZOU ; Guorong MEI ; Yifan SHI ; Lei ZHONG ; Jiaojiao WANG ; Xuelian GAN ; Dewen ZENG ; Xin CHEN ; Lin CHEN ; Hongping CHEN ; Shilin CHEN ; Yuan HU ; Youping LIU
Chinese Journal of Experimental Traditional Medical Formulae 2025;31(13):187-196
ObjectiveTo investigate the processing technology of calcined Haematitum based on the concept of quality by design(QbD) and to assess its health risk. MethodsTaking whole iron content, Fe2+ dissolution content and looseness as critical quality attributes(CQAs), and calcination temperature, calcination time, spreading thickness and particle size as critical process parameters(CPPs) determined by the failure mode and effect analysis(FMEA), the processing technology of calcined Haematitum was optimized by orthogonal test combined with analytic hierarchy process-criteria importance through intercriteria correlation(AHP-CRITIC) hybrid weighting method. The contents of heavy metals and harmful elements were determined by inductively coupled plasma mass spectrometry, and the health risk assessment was carried out by daily exposure(EXP), target hazard quotient(THQ) and lifetime cancer risk(LCR), and the theoretical value of the maximum limit was deduced. ResultsThe optimal processing technology for calcined Haematitum was calcination at 650 ℃, calcination time of 1 h, particle size of 0.2-0.5 cm, spreading thickness of 1 cm, and vinegar quenching for 1 time[Haematitum-vinegar(10:3)]. The contents of 5 heavy metals and harmful elements in 13 batches of calcined Haematitum were all decreased with reductions of up to 5-fold. The cumulative THQ of 2 batches of samples was>1, while the cumulative THQ of all batches of Haematitum was>1. The LCR of As in 1 batches of Haematitum was 1×10-6-1×10-4, and the LCR of the rest was<1×10-6, and the LCRs of calcined Haematitum were all<1×10-6, indicating that the carcinogenic risk of calcined Haematitum was low, but special attention should still be paid to Haematitum medicinal materials. Preliminary theoretical values of the maximum limits of Cu, As, Cd, Pb and Hg were formulated as 1 014, 25, 17, 27, 7 mg·kg-1. ConclusionThe optimized processing technology of calcined Haematitum is stable and feasible, and the contents of heavy metals and harmful elements are reduced after processing. Preliminary theoretical values of the maximum limits of Cu, As, Cd, Pb and Hg are formulated to provide a scientific basis for the formulation of standards for the limits of harmful elements in Haematitum.
8.Optimization of Processing Technology of Calcined Pyritum Based on QbD Concept and Its XRD Fingerprint Analysis
Xin CHEN ; Jingwei ZHOU ; Haiying GOU ; Lei ZHONG ; Tianxing HE ; Wenbo FEI ; Jialiang ZOU ; Yue YANG ; Dewen ZENG ; Lin CHEN ; Hongping CHEN ; Shilin CHEN ; Yuan HU ; Youping LIU
Chinese Journal of Experimental Traditional Medical Formulae 2025;31(13):197-205
ObjectiveBased on the concept of quality by design(QbD), the processing process of calcined Pyritum was optimized, and its X-ray diffraction(XRD) fingerprint was established. MethodsThe safety, effectiveness and quality controllability of calcined Pyritum were taken as the quality profile(QTPP), the color, hardness, metallic luster, phase composition, the contents of heavy metals and hazardous elements were taken as the critical quality attributes(CQAs), and the calcination temperature, calcination time, paving thickness and particle size were determined as the critical process parameters(CPPs). Differential thermal analysis, X-ray diffraction(XRD) and inductively coupled plasma mass spectrometry(ICP-MS) were used to analyze the correlation between the calcination temperature and CQAs of calcined Pyritum. Then, based on the criteria importance through intercriteria correlation(CRITIC)-entropy weight method, the optimal processing process of calcined Pyritum was optimized by orthogonal test. Powder XRD was used to analyze the phase of calcined Pyritum samples processed according to the best process, and the mean and median maps of calcined Pyritum were established by the superposition of geometric topological figures, and similarity evaluation and cluster analysis were carried out. ResultsThe results of single factor experiments showed that the physical phase of Pyritum changed from FeS2 to Fe7S8 during the process of temperature increase, the color gradually deepened from dark yellow, and the contents of heavy metals and harmful elements decreased. The optimized processing process of calcined Pyritum was as follows:calcination temperature at 750 ℃, calcination time of 2.5 h, paving thickness of 3 cm, particle size of 0.8-1.2 cm, vinegar quenching 1 time[Pyritum-vinegar(10∶3)]. After calcination, the internal structure of Pyritum was honeycomb-shaped, which was conducive to the dissolution of active ingredients. XRD fingerprints of 13 batches of calcined Pyritum characterized by 10 common peaks were established. The similarities of the relative peak intensities of the XRD fingerprints of the analyzed samples were>0.96, and it could effectively distinguish the raw products and unqualified products. ConclusionTemperature is the main factor affecting the quality of calcined Pyritum. After processing, the dissolution of the effective components in Pyritum increases, and the contents of heavy metals and harmful substances decrease, reflecting the function of processing to increase efficiency and reduce toxicity. The optimized processing process is stable and feasible, and the established XRD fingerprint can be used as one of the quality control standards of calcined Pyritum.
9.Process Optimization and Health Risk Assessment of Calcined Haematitum Based on QbD Concept
Yue YANG ; Jingwei ZHOU ; Jialiang ZOU ; Guorong MEI ; Yifan SHI ; Lei ZHONG ; Jiaojiao WANG ; Xuelian GAN ; Dewen ZENG ; Xin CHEN ; Lin CHEN ; Hongping CHEN ; Shilin CHEN ; Yuan HU ; Youping LIU
Chinese Journal of Experimental Traditional Medical Formulae 2025;31(13):187-196
ObjectiveTo investigate the processing technology of calcined Haematitum based on the concept of quality by design(QbD) and to assess its health risk. MethodsTaking whole iron content, Fe2+ dissolution content and looseness as critical quality attributes(CQAs), and calcination temperature, calcination time, spreading thickness and particle size as critical process parameters(CPPs) determined by the failure mode and effect analysis(FMEA), the processing technology of calcined Haematitum was optimized by orthogonal test combined with analytic hierarchy process-criteria importance through intercriteria correlation(AHP-CRITIC) hybrid weighting method. The contents of heavy metals and harmful elements were determined by inductively coupled plasma mass spectrometry, and the health risk assessment was carried out by daily exposure(EXP), target hazard quotient(THQ) and lifetime cancer risk(LCR), and the theoretical value of the maximum limit was deduced. ResultsThe optimal processing technology for calcined Haematitum was calcination at 650 ℃, calcination time of 1 h, particle size of 0.2-0.5 cm, spreading thickness of 1 cm, and vinegar quenching for 1 time[Haematitum-vinegar(10:3)]. The contents of 5 heavy metals and harmful elements in 13 batches of calcined Haematitum were all decreased with reductions of up to 5-fold. The cumulative THQ of 2 batches of samples was>1, while the cumulative THQ of all batches of Haematitum was>1. The LCR of As in 1 batches of Haematitum was 1×10-6-1×10-4, and the LCR of the rest was<1×10-6, and the LCRs of calcined Haematitum were all<1×10-6, indicating that the carcinogenic risk of calcined Haematitum was low, but special attention should still be paid to Haematitum medicinal materials. Preliminary theoretical values of the maximum limits of Cu, As, Cd, Pb and Hg were formulated as 1 014, 25, 17, 27, 7 mg·kg-1. ConclusionThe optimized processing technology of calcined Haematitum is stable and feasible, and the contents of heavy metals and harmful elements are reduced after processing. Preliminary theoretical values of the maximum limits of Cu, As, Cd, Pb and Hg are formulated to provide a scientific basis for the formulation of standards for the limits of harmful elements in Haematitum.
10.Optimization of Processing Technology of Calcined Pyritum Based on QbD Concept and Its XRD Fingerprint Analysis
Xin CHEN ; Jingwei ZHOU ; Haiying GOU ; Lei ZHONG ; Tianxing HE ; Wenbo FEI ; Jialiang ZOU ; Yue YANG ; Dewen ZENG ; Lin CHEN ; Hongping CHEN ; Shilin CHEN ; Yuan HU ; Youping LIU
Chinese Journal of Experimental Traditional Medical Formulae 2025;31(13):197-205
ObjectiveBased on the concept of quality by design(QbD), the processing process of calcined Pyritum was optimized, and its X-ray diffraction(XRD) fingerprint was established. MethodsThe safety, effectiveness and quality controllability of calcined Pyritum were taken as the quality profile(QTPP), the color, hardness, metallic luster, phase composition, the contents of heavy metals and hazardous elements were taken as the critical quality attributes(CQAs), and the calcination temperature, calcination time, paving thickness and particle size were determined as the critical process parameters(CPPs). Differential thermal analysis, X-ray diffraction(XRD) and inductively coupled plasma mass spectrometry(ICP-MS) were used to analyze the correlation between the calcination temperature and CQAs of calcined Pyritum. Then, based on the criteria importance through intercriteria correlation(CRITIC)-entropy weight method, the optimal processing process of calcined Pyritum was optimized by orthogonal test. Powder XRD was used to analyze the phase of calcined Pyritum samples processed according to the best process, and the mean and median maps of calcined Pyritum were established by the superposition of geometric topological figures, and similarity evaluation and cluster analysis were carried out. ResultsThe results of single factor experiments showed that the physical phase of Pyritum changed from FeS2 to Fe7S8 during the process of temperature increase, the color gradually deepened from dark yellow, and the contents of heavy metals and harmful elements decreased. The optimized processing process of calcined Pyritum was as follows:calcination temperature at 750 ℃, calcination time of 2.5 h, paving thickness of 3 cm, particle size of 0.8-1.2 cm, vinegar quenching 1 time[Pyritum-vinegar(10∶3)]. After calcination, the internal structure of Pyritum was honeycomb-shaped, which was conducive to the dissolution of active ingredients. XRD fingerprints of 13 batches of calcined Pyritum characterized by 10 common peaks were established. The similarities of the relative peak intensities of the XRD fingerprints of the analyzed samples were>0.96, and it could effectively distinguish the raw products and unqualified products. ConclusionTemperature is the main factor affecting the quality of calcined Pyritum. After processing, the dissolution of the effective components in Pyritum increases, and the contents of heavy metals and harmful substances decrease, reflecting the function of processing to increase efficiency and reduce toxicity. The optimized processing process is stable and feasible, and the established XRD fingerprint can be used as one of the quality control standards of calcined Pyritum.

Result Analysis
Print
Save
E-mail