Objective: To investigate the distribution characteristics of ABO and Rh blood group antigen phenotypes among blood donors in the Yantai, Shandong. Methods: Blood samples from 310 180 voluntary blood donors in Yantai collected from January 2019 to December 2023 were tested for ABO and Rh blood group antigens using standard serological methods. RhD-negative samples were further typed for C, c, E, and e antigens. Population genetic analysis of blood groups was performed: allele frequencies were inferred from ABO phenotypes, and Rh allele/haplotype frequencies were estimated based on the proportion of RhD-negative donors and CcEe antigen typing, followed by Hardy-Weinberg equilibrium testing. Results: The phenotypic distribution frequency of ABO blood groups was B(32.72%)>O(28.93%)>A(27.65%)>AB(10.70%). The inferred allele frequencies were r(53.74%)>q(24.78%)>p(21.48%), consistent with Hardy-Weinberg equilibrium (P>0.05). A total of 1 872 Rh-negative donors (0.603%) were identified. The most common Rh phenotypes were ccdee (59.56%) and Ccdee (30.18%). The distribution of Rh antigen phenotypes deviated significantly from Hardy-Weinberg equilibrium (χ =37.15, P<0.001), with the cde haplotype showing the highest frequency. There was no statistically significant difference in ABO blood group distribution between RhD-positive and RhD-negative donors (P>0.05). Conclusion: The ABO blood group distribution among voluntary blood donors in Yantai is generally stable and consistent with population genetic equilibrium, whereas the Rh antigen phenotype distribution deviates from equilibrium, indicating potential underlying genetic structural differences.

BACKGROUND:A network-based pharmacological approach has identified multifunctional effects of the main bioactive compounds in the Trichosanthis Fructus-Allii Macrostemonis Bulbus on coronary heart disease;however,the mechanism of its therapeutic effect on coronary heart disease has not been fully elucidated. OBJECTIVE:To investigate the role and mechanism of Trichosanthis Fructus-Allii Macrostemonis Bulbus in improving coronary heart disease by regulating the composition of gut microbiota. METHODS:Forty Sprague-Dawley rats were randomly divided into four groups:blank control group(n=10),model group(n=10),positive drug group(n=10),and medicine pair group(n=10).A rat model of coronary heart disease was established by continuous gastric perfusion of fat emulsion and injection of pituitrin.After modeling,rats in the model group were gavaged with distilled water(10 mL/kg)for control,rats in the positive drug group were gavaged with simvastatin 4 mg/kg per day,and rats in the medicine pair group were gavaged with Trichosanthis Fructus-Allii Macrostemonis Bulbus pairs 7.56 g/kg per day.All interventions lasted for 14 days.Electrocardiograms and myocardial pathology were observed,and blood lipid levels were measured.The structure of gut microbiota was analyzed using 16S rDNA sequencing technology. RESULTS AND CONCLUSION:Electrocardiogram results showed ST segment elevation in the model group.There were no significant abnormalities in the electrocardiograms of the positive drug group and medicine pair group.Compared with the blank control group,the levels of total cholesterol,triacylglycerol,and low-density lipoprotein cholesterol were significantly higher in the model group(P<0.05).Compared with the model group,the levels of total cholesterol,triacylglycerol,and low-density lipoprotein cholesterol were significantly lower in the positive drug group and medicine pair group(P<0.05).Compared with the blank control group,focal myocardial cell necrosis was observed in the model group,while partial myocardial cell disarray was observed in the positive drug group and medicine pair group.Compared with the blank control group,the Ace,Shannon,and Chao indices were increased(P<0.05)and the Simpson index was decreased(P<0.05)in the model group,positive drug group and medicine pair group.Compared with the model group,the Ace and Chao indices were decreased(P<0.05),while the Shannon index showed no significant difference(P>0.05)and the Simpson index was also decreased(P<0.05)in the positive drug group and medicine pair group.Compared with the blank control group,the relative abundances of Desulfovibrionia,Muribaculaceae_norank,etc.were increased in the model group,while those of Clostridia,[Eubacterium]_coprostanoligenes_group_norank,etc.were decreased.Compared with the model group,the relative abundances of WPS-2_norank,Muribaculaceae_norank,etc.were increased in the medicine pair group,while those of Clostridia,[Eubacterium]_coprostanoligenes_group_norank,etc.were decreased;the relative abundances of Desulfobacterota,[Eubacterium]_coprostanoligenes_group_norank,etc.were increased in the positive drug group,while those of Firmicutes,Muribaculaceae_norank,etc.were decreased.Compared with the positive drug group,the relative abundances of Desulfobacterota,Bacteroides,etc.were increased in the medicine pair group,while those of Firmicutes,[Eubacterium]_coprostanoligenes_group_norank,etc.were decreased.The LEfSe results showed that the medicine pair group had the highest microbial enrichment,followed by the blank control group and positive drug group,with the model group having the lowest microbial enrichment.To conclude,Trichosanthis Fructus-Allii Macrostemonis Bulbus pairs can improve the development of coronary heart disease by regulating gut microbiota composition,providing new insights for further research and development of Trichosanthis Fructus-Allii Macrostemonis Bulbus pairs.

Using Real-time PCR technology, a highly specific and sensitive method for detecting DNA residues of Escherichia coli host cells in levodopa was established, validated, and preliminarily applied. Escherichia coli strain MB6 16S ribosomal RNA gene was selected as the target gene to design multiple pairs of primers and the target fragment by specific amplification of PCR was obtained. The target fragment was cloned into the pLENTI-BSD-CON vector and the recombinant plasmid was constructed and named pLENTI-BSD-CON-E.coli-16S. A quantitative PCR detection method (SYBR Green method) with magnetic bead extraction and purification methods was established with the reference standard of the recombinant plasmid. Furthermore, the established method was validated, including linear and range, accuracy, precision, specificity, and quantification limit, and applied to the detection of levodopa raw materials. Meanwhile, the detection method was compared with the Taqman probe method by the commercial kit. The primer sequences of the quantitative PCR detection method (SYBR Green method) were TTCGATGCAACGCGAAGAAC (forward) and GTGTAGCCCTGGTCGTAAGG (reverse). The standard curve of DNA was in the range of 10 fg/μL to 3 ng/μL with good linearity (R2≥ 0.98). The quantitative limit was 10 fg/μL. In addition, the detection recovery rate was in the range of 59.7% to 80.7%, with RSD at less than 15%. Nine batches of levodopa were detected by this method, and the amount of E.coli DNA residue was below the limit. The developed qPCR method can be used for quantitative detection of residual DNA in biological products produced by E.coli as host cells, such as levodopa . The results indicate that the sensitivity of the detection method for recombinant plasmid construction standards is superior than the reagent kit detection method.

Genitourinary system tumors, as a major clinical challenge posing a serious threat to human health, urgently require breakthroughs in the construction of a precision diagnosis and treatment system. The innovative application of molecular imaging technologies, particularly the development of novel molecular probes, is revolutionizing the diagnostic and therapeutic paradigms for urinary tumors. The application of novel molecular probes in the early diagnosis and staging of genitourinary tumors, the role of multimodal molecular imaging probes in guiding precision surgery/radiotherapy, and the clinical translation challenges and strategies for theranostic-integrated probes are systematically reviewed in this article to provide valuable insights and references for related research and clinical practice.

Lingguizhugan Decoction (LGZG) demonstrates significant efficacy in treating various cardiovascular diseases clinically, yet its precise mechanism of action remains elusive. This study aimed to elucidate the potential mechanisms and effects of LGZG on isoproterenol (ISO) continuous stimulation-induced chronic heart failure (CHF) in mice, providing direct experimental evidence for further clinical applications. In vivo, continuous ISO infusion was administered to mice, and ventricular myocytes were utilized to explore LGZG?s potential mechanism of action on the ?1-adrenergic receptor (?1-AR)/Gs/G protein-coupled receptor kinases (GRKs)/?-arrestin signaling deflection system in the heart. The findings reveal that LGZG significantly reduced the messenger ribonucleic acid (mRNA) expression of hypertrophy-related biomarkers [atrial natriuretic peptide (ANP) and B-type natriuretic peptide (BNP)] and improved cardiac remodeling and left ventricular diastolic function in mice with ISO-induced CHF. Furthermore, LGZG inhibited the overactivation of Gs/cyclic adenosine monophosphate (cAMP)/protein kinase A (PKA) signaling and downregulated the downstream transcriptional activity of cAMP-response element binding protein (CREB) and the expression of the coactivator CBP/P300. Notably, LGZG downregulated the expression of ?-arrestin1 and GRK 2/3/5 while upregulating the expression of ?1-AR and ?-arrestin2. These results suggest that LGZG inhibits Gs/cAMP/PKA signaling and ?-arrestin/GRK-mediated desensitization and internalization of ?1-AR, potentially exerting cardioprotective effects through the synergistic regulation of the ?1-AR/Gs/GRKs/?-arrestin signaling deflection system via multiple pathways.
Animals ; Heart Failure/genetics* ; Signal Transduction/drug effects* ; Drugs, Chinese Herbal/pharmacology* ; Mice ; Male ; G-Protein-Coupled Receptor Kinases/genetics* ; Mice, Inbred C57BL ; Humans ; Isoproterenol ; Arrestins/genetics* ; Chronic Disease

Dental treatments for children and adolescents have unique clinical characteristics that differ from dental care for adults in terms of children's physiology, psychology, and behavior. These differences impose specific requirements on the application of local anesthesia in pediatric dental procedures. This article presents expert consensus on the principles of local anesthesia techniques in pediatric dental therapies, including the use of common anesthetic drugs and dosage control, safety and efficacy evaluation, and prevention and management of complications. The aim is to improve the safety and quality of pediatric dental treatments and offer guidance for clinical application by dentists.
Humans ; Child ; Anesthesia, Local/methods* ; Consensus ; Anesthesia, Dental/methods* ; Adolescent ; Anesthetics, Local/administration & dosage* ; Dental Care for Children

Objective To evaluate the efficacy and safety of obinutuzumab(OBZ)in the treatment of refractory primary membranous nephropathy(pMN).Methods The clinical data of 15 patients with refractory pMN who received OBZ treatment in Department of Nephrology of The First Affiliated Hospital of Naval Medical University between Jan.2022 and Sep.2024 were retrospectively analyzed,and they included basic information,relevant laboratory indexes,clinical and immunological outcomes,and adverse events.Results Among the 15 patients with refractory pMN,14(93.3％)were phospholipase A2 receptor(PLA2R)-associated membranous nephropathy(10 cases with positive PLA2R by renal biopsy and 4 cases with no recorded PLA2R results by renal biopsy but with positive serum PLA2R antibodies).During the follow-up period,all 15 patients achieved clinical remission,with 4(26.7％)patients achieving complete remission and 11(73.3％)patients achieving partial remission.Of the 12 patients with positive serum PLA2R antibodies,11 patients had continuously positive serum PLA2R antibodies before OBZ treatment,and 9(81.8％)patients achieved immunological remission after OBZ treatment.All the 15 patients had previously received immunosuppressive therapy,and all of them were classified as refractory pMN,with 7(46.7％)patients having been treated with cyclophosphamide combined with corticosteroids,2(13.3％)patients having been treated with calcineurin inhibitor combined with corticosteroids,11(73.3％)patients having received rituximab.During the treatment,2(13.3％)cases of adverse events were observed:1 patient experienced transient liver dysfunction,and the transaminase returned to normal after discontinuing atorvastatin;another patient developed a positive T-cell spot test for Tuberculosis infection during the intertreatment interval and successfully completed the subsequent OBZ treatment and achieved clinical remission after treatment with isoniazid and rifampicin.Conclusion OBZ demonstrates favorable clinical efficacy in the treatment of refractory pMN,with a low incidence of adverse events.

Objective To analyze the main epidemiological characteristics of fungal infection in this hospital in the past 7 years,and to provide reference for clinical treatment and prevention and control strategies of fun-gal infection.Methods The fungal data and clinical data of related patients isolated from clinical samples in Peking Union Medical College Hospital from early January 2018 to the end of May 2024 were selected,and the main epidemiological characteristics of fungal infection in this hospital were identified and described through multi-angle statistical analysis.Results A total of 4 479 patients with filamentous fungal infection were en-rolled.The proportion of male patients[57.5％(2 576/4 479)]was higher than that of female patients[42.5％(1 903/4 143)],mainly distributed in internal medicine,Intensive Care Unit(ICU)and emergency de-partment,among which internal medicine accounted for the highest proportion[50.0％(2 241/4 479)].About 90.0％of the specimens were from the lower respiratory tract,in addition to specimens from skin and soft tis-sue,tissue,ear and blood culture.In terms of seasonal distribution,there are more patients in winter.The fun-gi were mainly composed of Aspergillus,Mucor,Cerdosporium,Fusarium and Penicillium,among which As-pergillus was the most abundant,accounting for 74.6％of the total.Aspergillus fumigatus was the most a-bundant Aspergillus,accounting for 42.5％of the total Aspergillus(1 418/3 340).Among the related infec-tions caused by mold,Aspergillus was the most common in the lower respiratory tract,accounting for 76.8％.Among them,Aspergillus fumigatus accounted for the highest proportion(33.6％).98.6％of the molds infected the ear were Aspergillus,of which Aspergillus niger and Aspergillus terreus were the most common.Skin infections are mainly caused by Sporothrix schenckii,Trichophyton rubrum,Microsporum ca-nis.The results of in vitro drug sensitivity test showed that the four common Aspergillus isolated in this hos-pital were sensitive to voriconazole,and amphotericin B had better antifungal activity against Mucorales in vitro.Conclusion Based on the main epidemiological characteristics of fungal infections in this hospital,it is recommended that special attention be paid to the admission of patients in the respiratory department during the peak infection period in autumn and winter.In the treatment of fungal infections in different regions and on different body parts,attention should be paid to the differences in the distribution of bacterial species.

Objective To analyze the factors affecting the prevalence of hyperuricemia(HUA)in an island troop.Methods A total of 1 113 soldiers stationed on an island from December 2021 to December 2022 were selected as research objects by cluster sampling.Their lifestyle and health information were collected.Physical examination and laboratory detection were conducted.Multivariate logistic regression was used to analyze the influencing factors of HUA.Results The prevalence rate of HUA was 21.02%(234/1 113).There were significant differences in the body mass index(BMI),waist-to-hip ratio,triglyceride,alanine aminotransferase,and creatinine between the soldiers with hyperuricemia and the soldiers with normal blood uric acid(P<0.05).Multivariate logistic regression analysis showed that BMI≥24(OR=1.49,95%CI:1.09-2.05),abnormal liver function(OR=2.26,95%CI:1.31-3.92),and dyslipidemia(OR=1.46,95%CI:1.01-2.12)were positively correlated with hyperuricemia;age>30 years old(OR=0.59,95%CI:0.37-0.93)and exercise time>1 h per week(OR=0.46,95%CI:0.22-0.97)were negatively correlated with HUA.Conclusion The prevalence rate of hyperuricemia is at a high level in an island troop.BMI≥24,age≤30 years old,exercise time≤1 h per week,abnormal liver function,and dyslipidemia are the risk factors for HUA.Prevention and control measures should be taken as early as possible for the soldiers with these risk factors.

Objective This study aimed to investigate natural infection of rodents with Ehrlichia and Neoehrlichia at major Chinese land-border ports along the"Belt and Road".Methods In 2022,rodents were monitored in 10 ports in northern and southern China and identified based on diagnostic morphological characteristics.The 16S rRNA genes of Ehrlichia and Neoehrlichia were detected by PCR using universal primers from rodent samples and phylogenetic analysis was performed based on the sequences of the detected positive pathogens.Results A total of 356 rodents were sampled,including 2 orders,5 families,15 genera,and 20 species.Predominantly,73,61,56,and 58 were Meriones unguiculatus(20.51%),Rattus norvegicus(17.13%),Apodemus agrarius(15.73%),and Microtus gregalis(16.29%).Only one Microtus fortis from Suifenghe Port was infected with Ehrlichia sp.Moreover,12 rodents were infected with Neoehrlichia spp.(overall positivity rate:3.37%).Conclusions Natural infections with Ehrlichia spp.and Neoehrlichia spp.were demonstrated in rodents at important Chinese land-border ports.The positivity rate of Neoehrlichia spp.was high in some ports,indicating that surveillance for ticks and their prevention and control measures should be intensified in these regions.