BACKGROUND:A network-based pharmacological approach has identified multifunctional effects of the main bioactive compounds in the Trichosanthis Fructus-Allii Macrostemonis Bulbus on coronary heart disease;however,the mechanism of its therapeutic effect on coronary heart disease has not been fully elucidated. OBJECTIVE:To investigate the role and mechanism of Trichosanthis Fructus-Allii Macrostemonis Bulbus in improving coronary heart disease by regulating the composition of gut microbiota. METHODS:Forty Sprague-Dawley rats were randomly divided into four groups:blank control group(n=10),model group(n=10),positive drug group(n=10),and medicine pair group(n=10).A rat model of coronary heart disease was established by continuous gastric perfusion of fat emulsion and injection of pituitrin.After modeling,rats in the model group were gavaged with distilled water(10 mL/kg)for control,rats in the positive drug group were gavaged with simvastatin 4 mg/kg per day,and rats in the medicine pair group were gavaged with Trichosanthis Fructus-Allii Macrostemonis Bulbus pairs 7.56 g/kg per day.All interventions lasted for 14 days.Electrocardiograms and myocardial pathology were observed,and blood lipid levels were measured.The structure of gut microbiota was analyzed using 16S rDNA sequencing technology. RESULTS AND CONCLUSION:Electrocardiogram results showed ST segment elevation in the model group.There were no significant abnormalities in the electrocardiograms of the positive drug group and medicine pair group.Compared with the blank control group,the levels of total cholesterol,triacylglycerol,and low-density lipoprotein cholesterol were significantly higher in the model group(P<0.05).Compared with the model group,the levels of total cholesterol,triacylglycerol,and low-density lipoprotein cholesterol were significantly lower in the positive drug group and medicine pair group(P<0.05).Compared with the blank control group,focal myocardial cell necrosis was observed in the model group,while partial myocardial cell disarray was observed in the positive drug group and medicine pair group.Compared with the blank control group,the Ace,Shannon,and Chao indices were increased(P<0.05)and the Simpson index was decreased(P<0.05)in the model group,positive drug group and medicine pair group.Compared with the model group,the Ace and Chao indices were decreased(P<0.05),while the Shannon index showed no significant difference(P>0.05)and the Simpson index was also decreased(P<0.05)in the positive drug group and medicine pair group.Compared with the blank control group,the relative abundances of Desulfovibrionia,Muribaculaceae_norank,etc.were increased in the model group,while those of Clostridia,[Eubacterium]_coprostanoligenes_group_norank,etc.were decreased.Compared with the model group,the relative abundances of WPS-2_norank,Muribaculaceae_norank,etc.were increased in the medicine pair group,while those of Clostridia,[Eubacterium]_coprostanoligenes_group_norank,etc.were decreased;the relative abundances of Desulfobacterota,[Eubacterium]_coprostanoligenes_group_norank,etc.were increased in the positive drug group,while those of Firmicutes,Muribaculaceae_norank,etc.were decreased.Compared with the positive drug group,the relative abundances of Desulfobacterota,Bacteroides,etc.were increased in the medicine pair group,while those of Firmicutes,[Eubacterium]_coprostanoligenes_group_norank,etc.were decreased.The LEfSe results showed that the medicine pair group had the highest microbial enrichment,followed by the blank control group and positive drug group,with the model group having the lowest microbial enrichment.To conclude,Trichosanthis Fructus-Allii Macrostemonis Bulbus pairs can improve the development of coronary heart disease by regulating gut microbiota composition,providing new insights for further research and development of Trichosanthis Fructus-Allii Macrostemonis Bulbus pairs.

Objective To investigate the changes in eosinophil counts and the activation of microglial cells in the brain tissues of mice at different stages of Angiostrongylus cantonensis infection, and to examine the role of microglia in regulating the progression of angiostrongyliasis and unravel the possible molecular mechanisms. Methods Fifty BALB/c mice were randomly divided into the control group and the 7-d, 14-d, 21-day and 25-d infection groups, of 10 mice in each group. All mice in infection groups were infected with 30 stage III A. cantonensis larvae by gavage, and animals in the control group was given an equal amount of physiological saline. Five mice were collected from each of infection groups on days 7, 14, 21 d and 25 d post-infection, and 5 mice were collected from the control group on the day of oral gavage. The general and focal functional impairment was scored using the Clark scoring method to assess the degree of mouse neurological impairment. Five mice from each of infection groups were sacrificed on days 7, 14, 21 d and 25 d post-infection, and 5 mice from the control group were sacrificed on the day of oral gavage. Mouse brain tissues were sampled, and the pathological changes of brain tissues were dynamically observed using hematoxylin and eosin (HE) staining. Immunofluorescence staining with eosinophilic cationic protein (ECP) and ionized calcium binding adaptor molecule 1 (Iba1) was used to assess the degree of eosinophil infiltration and the counts of microglial cells in mouse brain tissues in each group, and the morphological parameters of microglial cells (skeleton analysis and fractal analysis) were quantified by using Image J software to determine the morphological changes of microglial cells. In addition, the expression of M1 microglia markers Fcγ receptor III (Fcgr3), Fcγ receptor IIb (Fcgr2b) and CD86 antigen (Cd86), M2 microglia markers Arginase 1 (Arg1), macrophage mannose receptor C-type 1 (Mrc1), chitinase-like 3 (Chil3), and phagocytosis genes myeloid cell triggering receptor expressed on myeloid cells 2 (Trem2), CD68 antigen (Cd68), and apolipoprotein E (Apoe) was quantified using real-time quantitative reverse transcription PCR (RT-qPCR) assay in the mouse cerebral cortex of mice post-infection. Results A large number of A. cantonensis larvae were seen on the mouse meninges surface post-infection, and many neuronal nuclei were crumpled and deeply stained, with a large number of bleeding points in the meninges. The median Clark scores of mouse general functional impairment were 0 (interquartile range, 0), 0 (interquartile range, 0.5), 6 (interquartile range, 1.0), 14 (interquartile range, 8.5) points and 20 (interquartile range, 9.0) points in the control group and the 7-d, 14-d, 21-d and 25-d groups, respectively (H = 22.45, P < 0.01), and the median Clark scores of mouse focal functional impairment were 0 (interquartile range, 0), 2 (interquartile range, 2.5), 7 (interquartile range, 3.0), 18 (interquartile range, 5.0) points and 25 (interquartile range, 6.5) points in the control group and the 7-d, 14-d, 21-d and 25-d groups, respectively (H = 22.72, P < 0.01). The mean scores of mice general and focal functional impairment were all higher in the infection groups than in the control group (all P values < 0.05). Immunofluorescence staining showed a significant difference in the eosinophil counts in mouse brain tissues among the five groups (F = 40.05, P < 0.000 1), and the eosinophil counts were significantly higher in mouse brain tissues in the 14-d (3.08 ± 0.78) and 21-d infection groups (5.97 ± 1.37) than in the control group (1.00 ± 0.28) (both P values < 0.05). Semi-quantitative analysis of microglia immunofluorescence showed a significant difference in the counts of microglial cells among the five groups (F = 17.66, P < 0.000 1), and higher Iba1 levels were detected in mouse brain tissues in 14-d (5.75 ± 1.28), 21-d (6.23 ± 1.89) and 25-d infection groups (3.70 ± 1.30) than in the control group (1.00 ± 0.30) (all P values < 0.05). Skeleton and fractal analyses showed that the branch length [(162.04 ± 34.10) μm vs. (395.37 ± 64.11) μm; t = 5.566, P < 0.05] and fractal dimension of microglial cells (1.30 ± 0.01 vs. 1.41 ± 0.03; t = 5.266, P < 0.05) were reduced in mouse brain tissues in the 21-d infection group relative to the control group. In addition, there were significant differences among the 5 groups in terms of M1 and M2 microglia markers Fcgr3 (F = 48.34, P < 0.05), Fcgr2b (F = 55.46, P < 0.05), Cd86 (F = 24.44, P < 0.05), Arg1 (F = 31.18, P < 0.05), Mrc1 (F = 15.42, P < 0.05) and Chil3 (F = 24.41, P < 0.05), as well as phagocytosis markers Trem2 (F = 21.19, P < 0.05), Cd68 (F = 43.95, P < 0.05) and Apoe (F = 7.12, P < 0.05) in mice brain tissues. Conclusions A. cantonensis infections may induce severe pathological injuries in mouse brain tissues that are characterized by massive eosinophil infiltration and persistent activation of microglia cells, thereby resulting in progressive deterioration of neurological functions.

Background Air pollution remains a critical public health issue, with persistent exposure to air pollutants continuing to pose significant health risks. Currently, research investigating the association between air pollution and myocardial infarction mortality in Shenzhen remains inadequate. Objective To quantitatively assess the association between air pollutants and myocardial infarction mortality in residents. Methods Based on the mortality surveillance system of Shenzhen Center for Disease Control and Prevention, we conducted a time-stratified case-crossover study of 10089 permanent residents who died from myocardial infarction in Shenzhen between 2013 and 2022. Using residential address information, we obtained individual-level exposure data for air pollutants from the China High Air Pollutants dataset and meteorological factors from the China Meteorological Administration Land Data Assimilation System. A time-stratified case-crossover study design was employed to construct a conditional logistic regression model to assess the association between short-term exposure to air pollutants and myocardial infarction mortality. The exposure-response relationship was visualized, and a comprehensive health risk assessment was performed. Results This study included a total of 10 089 cases of myocardial infarction deaths in Shenzhen. The median [interquartile range (IQR)] concentrations of fine particulate matter (PM_2.5), inhalable particulate matter (PM₁₀), sulfur dioxide (SO₂), nitrogen dioxide (NO₂), carbon monoxide (CO), and ozone (O₃) in Shenzhen from 2013 to 2022 were 24.59 (20.19) μg·m⁻³, 42.85 (28.42) μg·m⁻³, 8.53 (3.39) μg·m⁻³, 29.47 (13.56) μg·m⁻³, 0.77 (0.27) mg·m⁻³, and 86.53 (51.39) μg·m⁻³, respectively. The moving average concentrations of PM_2.5 and PM₁₀ over the current day and the previous 2 days (lag02) showed the highest risk of myocardial infarction mortality, with an odds ratio (OR) and 95% confidence interval (95%CI) of 1.004 (1.001, 1.007) and 1.004 (1.002, 1.006), respectively. At lag05, SO₂ demonstrated the strongest association with the risk of myocardial infarction mortality, with an OR (95%CI) of 1.042 (1.019, 1.065). The exposure-response relationships of PM_2.5, PM₁₀, and SO₂ with myocardial infarction mortality were approximately linear, whereas NO₂ exhibited a nonlinear relationship. At lag05, the highest risk of myocardial infarction mortality associated with NO₂ exposure was observed when the NO₂ concentration was ≤21.92 μg·m⁻³, with an OR (95% CI) of 1.024 (1.003, 1.046). The health risk assessment indicated that, using the WHO Air Quality Guidelines as the reference, the local PM_2.5 and NO₂ exposure led to an excess mortality of 398 and 298 cases, respectively. The sensitivity analysis revealed that after adjusting for O₃ and restricting the study period to 2013—2019, the effect estimates for PM_2.5, PM₁₀, NO₂, and SO₂ on myocardial infarction mortality slightly increased. Conclusion Short-term exposure to air pollutants, including PM_2.5, PM₁₀, NO₂, and SO₂, could increase the risk of myocardial infarction mortality. This study provides important scientific evidence for environmental health risk assessment and environmental management in Shenzhen.

Using Real-time PCR technology, a highly specific and sensitive method for detecting DNA residues of Escherichia coli host cells in levodopa was established, validated, and preliminarily applied. Escherichia coli strain MB6 16S ribosomal RNA gene was selected as the target gene to design multiple pairs of primers and the target fragment by specific amplification of PCR was obtained. The target fragment was cloned into the pLENTI-BSD-CON vector and the recombinant plasmid was constructed and named pLENTI-BSD-CON-E.coli-16S. A quantitative PCR detection method (SYBR Green method) with magnetic bead extraction and purification methods was established with the reference standard of the recombinant plasmid. Furthermore, the established method was validated, including linear and range, accuracy, precision, specificity, and quantification limit, and applied to the detection of levodopa raw materials. Meanwhile, the detection method was compared with the Taqman probe method by the commercial kit. The primer sequences of the quantitative PCR detection method (SYBR Green method) were TTCGATGCAACGCGAAGAAC (forward) and GTGTAGCCCTGGTCGTAAGG (reverse). The standard curve of DNA was in the range of 10 fg/μL to 3 ng/μL with good linearity (R2≥ 0.98). The quantitative limit was 10 fg/μL. In addition, the detection recovery rate was in the range of 59.7% to 80.7%, with RSD at less than 15%. Nine batches of levodopa were detected by this method, and the amount of E.coli DNA residue was below the limit. The developed qPCR method can be used for quantitative detection of residual DNA in biological products produced by E.coli as host cells, such as levodopa . The results indicate that the sensitivity of the detection method for recombinant plasmid construction standards is superior than the reagent kit detection method.

Genitourinary system tumors, as a major clinical challenge posing a serious threat to human health, urgently require breakthroughs in the construction of a precision diagnosis and treatment system. The innovative application of molecular imaging technologies, particularly the development of novel molecular probes, is revolutionizing the diagnostic and therapeutic paradigms for urinary tumors. The application of novel molecular probes in the early diagnosis and staging of genitourinary tumors, the role of multimodal molecular imaging probes in guiding precision surgery/radiotherapy, and the clinical translation challenges and strategies for theranostic-integrated probes are systematically reviewed in this article to provide valuable insights and references for related research and clinical practice.

Background::Genetic variants of dopaminergic transcription factor-encoding genes are suggested to be Parkinson’s disease (PD) risk factors; however, no comprehensive analyses of these genes in patients with PD have been undertaken. Therefore, we aimed to genetically analyze 16 dopaminergic transcription factor genes in Chinese patients with PD.Methods::Whole-exome sequencing (WES) was performed using a Chinese cohort comprising 1917 unrelated patients with familial or sporadic early-onset PD and 1652 controls. Additionally, whole-genome sequencing (WGS) was performed using another Chinese cohort comprising 1962 unrelated patients with sporadic late-onset PD and 1279 controls.Results::We detected 308 rare and 208 rare protein-altering variants in the WES and WGS cohorts, respectively. Gene-based association analyses of rare variants suggested that MSX1 is enriched in sporadic late-onset PD. However, the significance did not pass the Bonferroni correction. Meanwhile, 72 and 1730 common variants were found in the WES and WGS cohorts, respectively. Unfortunately, single-variant logistic association analyses did not identify significant associations between common variants and PD. Conclusions::Variants of 16 typical dopaminergic transcription factors might not be major genetic risk factors for PD in Chinese patients. However, we highlight the complexity of PD and the need for extensive research elucidating its etiology.

Background::There is a need for effective and safe therapies for psoriasis that provide sustained benefits. The aim of this study was to assess the efficacy and safety of tildrakizumab, an anti-interleukin-23p19 monoclonal antibody, for treating moderate-to-severe plaque psoriasis in Chinese patients.Methods::In this multi-center, double-blind, phase III trial, patients with moderate-to-severe plaque psoriasis were enrolled and randomly assigned (1:1) to receive subcutaneous tildrakizumab 100 mg or placebo at weeks 0 and 4. Patients initially assigned to placebo were switched to receive tildrakizumab at weeks 12, 16, and every 12 weeks thereafter. Patients in the tildrakizumab group continued with tildrakizumab at week 16, and every 12 weeks until week 52. The primary endpoint was the Psoriasis Area and Severity Index (PASI 75) response rate at week 12.Results::At week 12, tildrakizumab demonstrated significantly higher PASI 75 response rates (66.4% [73/110] vs. 12.7% [14/110]; difference, 51.4% [95% confidence interval (CI), 40.72, 62.13]; P <0.001) and Physician’s Global Assessment (60.9% [67/110] vs. 10.0% [11/110]; difference, 49.1% [95% CI, 38.64, 59.62]; P <0.001) compared to placebo. PASI 75 response continued to improve over time in both tildrakizumab and placebo-switching to tildrakizumab groups, reaching maximal efficacy after 28 weeks (86.8% [92/106] vs. 82.4% [89/108]) and maintained up to 52 weeks (91.3% [95/104] vs. 87.4% [90/103]). Most treatment-emergent adverse events were mild and not related to tildrakizumab. Conclusion::Tildrakizumab demonstrated durable efficacy through week 52 and was well tolerated in Chinese patients with moderate-to-severe plaque psoriasis.Trial registration::ClinicalTrials.gov, NCT05108766.

Anti-angiogenic drugs (AADs), which mainly target the vascular endothelial growth factor-A signaling pathway, have become a therapeutic option for cancer patients for two decades. During this period, tremendous clinical experience of anti-angiogenic therapy has been acquired, new AADs have been developed, and the clinical indications for AAD treatment of various cancers have been expanded using monotherapy and combination therapy. However, improvements in the therapeutic outcomes of clinically available AADs and the development of more effective next-generation AADs are still urgently required. This review aims to provide historical and perspective views on tumor angiogenesis to allow readers to gain mechanistic insights and learn new therapeutic development. We revisit the history of concept initiation and AAD discovery, and summarize the up-to-date clinical translation of anti-angiogenic cancer therapy in this field.

In recent decades,the prevalence of diabetes has been increasing year by year,and a series of complications caused by diabetes include diabetic cardiomyopathy,retinopathy,nephropa-thy,osteoporosis and neuropathy.The pathogenesis of these com-plications is still very unclear,and there is an urgent need for some therapeutic drugs to meet the clinical needs.In this re-view,we summarize the pathogenesis of various diabetic compli-cations in the past five years,the markers that have received more attention and the main therapeutic drugs,in order to pro-vide references for the drug research and development of diabetic complications.

Objective To monitor the susceptibility of clinical isolates to antimicrobial agents in tertiary hospitals in major regions of China in 2022.Methods Clinical isolates from 58 hospitals in China were tested for antimicrobial susceptibility using a unified protocol based on disc diffusion method or automated testing systems.Results were interpreted using the 2022 Clinical &Laboratory Standards Institute(CLSI)breakpoints.Results A total of 318 013 clinical isolates were collected from January 1,2022 to December 31,2022,of which 29.5％were gram-positive and 70.5％were gram-negative.The prevalence of methicillin-resistant strains in Staphylococcus aureus,Staphylococcus epidermidis and other coagulase-negative Staphylococcus species(excluding Staphylococcus pseudintermedius and Staphylococcus schleiferi)was 28.3％,76.7％and 77.9％,respectively.Overall,94.0％of MRSA strains were susceptible to trimethoprim-sulfamethoxazole and 90.8％of MRSE strains were susceptible to rifampicin.No vancomycin-resistant strains were found.Enterococcus faecalis showed significantly lower resistance rates to most antimicrobial agents tested than Enterococcus faecium.A few vancomycin-resistant strains were identified in both E.faecalis and E.faecium.The prevalence of penicillin-susceptible Streptococcus pneumoniae was 94.2％in the isolates from children and 95.7％in the isolates from adults.The resistance rate to carbapenems was lower than 13.1％in most Enterobacterales species except for Klebsiella,21.7％-23.1％of which were resistant to carbapenems.Most Enterobacterales isolates were highly susceptible to tigecycline,colistin and polymyxin B,with resistance rates ranging from 0.1％to 13.3％.The prevalence of meropenem-resistant strains decreased from 23.5％in 2019 to 18.0％in 2022 in Pseudomonas aeruginosa,and decreased from 79.0％in 2019 to 72.5％in 2022 in Acinetobacter baumannii.Conclusions The resistance of clinical isolates to the commonly used antimicrobial agents is still increasing in tertiary hospitals.However,the prevalence of important carbapenem-resistant organisms such as carbapenem-resistant K.pneumoniae,P.aeruginosa,and A.baumannii showed a downward trend in recent years.This finding suggests that the strategy of combining antimicrobial resistance surveillance with multidisciplinary concerted action works well in curbing the spread of resistant bacteria.