Objective: To investigate the distribution characteristics of ABO and Rh blood group antigen phenotypes among blood donors in the Yantai, Shandong. Methods: Blood samples from 310 180 voluntary blood donors in Yantai collected from January 2019 to December 2023 were tested for ABO and Rh blood group antigens using standard serological methods. RhD-negative samples were further typed for C, c, E, and e antigens. Population genetic analysis of blood groups was performed: allele frequencies were inferred from ABO phenotypes, and Rh allele/haplotype frequencies were estimated based on the proportion of RhD-negative donors and CcEe antigen typing, followed by Hardy-Weinberg equilibrium testing. Results: The phenotypic distribution frequency of ABO blood groups was B(32.72%)>O(28.93%)>A(27.65%)>AB(10.70%). The inferred allele frequencies were r(53.74%)>q(24.78%)>p(21.48%), consistent with Hardy-Weinberg equilibrium (P>0.05). A total of 1 872 Rh-negative donors (0.603%) were identified. The most common Rh phenotypes were ccdee (59.56%) and Ccdee (30.18%). The distribution of Rh antigen phenotypes deviated significantly from Hardy-Weinberg equilibrium (χ =37.15, P<0.001), with the cde haplotype showing the highest frequency. There was no statistically significant difference in ABO blood group distribution between RhD-positive and RhD-negative donors (P>0.05). Conclusion: The ABO blood group distribution among voluntary blood donors in Yantai is generally stable and consistent with population genetic equilibrium, whereas the Rh antigen phenotype distribution deviates from equilibrium, indicating potential underlying genetic structural differences.

Objective To investigate the role of activating transcription factor 4 (ATF4) in benign prostatic hyperplasia (BPH) in order to elucidate the molecular mechanism underlying BPH progression. Methods Firstly, we analyzed the correlation between the expression of ATF4 and the volume of prostate transition zone in BPH tissues using publicly available datasets. Subsequently, we explored the potential association among ATF4, epithelial-mesenchymal transition (EMT) and BPH through single-cell RNA sequencing (scRNA-seq). Finally, we validated the findings by silencing ATF4 and treating BPH cells with ATF4 protein inhibitors, followed by reverse transcription quantitative polymerase chain reaction (RT-qPCR), CCK-8 assay, and Western blot. Results The expression of ATF4 in BPH tissues exhibited a significant positive correlation with the volume of prostate transition zone (r=0.64, P＜0.05). scRNA-seq analysis revealed that ATF4 was significantly upregulated in the prostate epithelial cells of BPH patients (P＜0.05), and its expression demonstrated a significant positive correlation with the Hallmark EMT singscore (r=0.14, P＜0.05). In vitro experiments further indicated that knockdown of ATF4 led to a significant reduction in the proliferative activity of BPH-1 cells (P＜0.05). Similarly, inhibition of ATF4 activity resulted in a marked decrease in the proliferative capacity and EMT of BPH-1 cells (P＜0.05). Conclusion ATF4 may exert a promoting effect on BPH by modulating the EMT signaling pathway;therefore, ATF4 may serve as a novel therapeutic target of BPH.

Objective To examine the impact of climate, land use and their interaction effect on the population density of Oncomelania hupensis. Methods O. hupensis snail surveillance data in Yunnan Province from 2013 to 2022 were obtained from the National Information System for Parasitic Diseases Prevention and Control of Chinese Information System for Disease Control and Prevention, and the density of living snails was calculated in each county-level administrative district. Climate data were obtained from the China Meteorological Forcing Dataset version 2.0, and land use data were captured from the China Land Cover Dataset. The raster climate data and land use data were clipped to the administrative border of Yunnan Province in the R package version 4.5, and the climate data were resampled to a spatial resolution of 30 m × 30 m consistent with the land use data using bilinear interpolation. Annual meteorological indicators were extracted from each county-level schistosomiasis surveillance administrative area in Yunnan Province from 2013 to 2022, including average temperature, maximum temperature, minimum temperature, temperature difference, average precipitation rate, maximum precipitation rate, minimum precipitation rate, downward shortwave radiation flux, downward longwave radiation flux, air pressure, wind speed, specific humidity and relative humidity. Annual land use structure and landscape pattern index in each county-level schistosomiasis surveillance administrative area in Yunnan Province from 2013 to 2022 were extracted and calculated, including the proportion of areas occupied by each type of land use, patch density, largest patch index, landscape separation index, landscape fragmentation index, landscape segmentation index, contagion index, patch cohesion index, edge density, and shape index. Land use entropy index was introduced to represent the degree of habitat fragmentation and ecological niche breadth. The density of living snails and environmental factors were subjected to rank correlation analysis, and variables with no statistically significant correlation (P>0.1) were excluded. Then, a correlation coefficient matrix was constructed, and |r_s| of 0.85 and greater was defined as the threshold of high collinearity. For highly correlated variables in each group, indicators with a more biological explanatory power or a better statistical efficiency were retained. A generalized additive model (GAM) was constructed with O. hupensis snail density as a response variable and screened environmental variables as independent variables, and the model performance was evaluated using the variance explained. Results The area occupied by O. hupensis snail habitats was 1 056 to 1 680 hm² in Yunnan Province from 2013 to 2022, appearing an overall tendency towards a decline; however, the density of living snails appeared a tendency towards a slight rise. Based on the correlation coefficient matrix, 14 core explanatory variables were retained, including farmland, water bodies, bare land, impervious surface, landscape separation index, landscape fragmentation index, edge density, shape index, land use entropy index, downward longwave radiation flux, downward shortwave radiation flux, maximum temperature, minimum precipitation rate and specific humidity. Two types of GAM were constructed, including the main-effects model without interaction terms and the interaction model with interaction terms. The corrected Akaike information criterion (AICc) of the optimal main-effects model was −285.223, and the core variables included bare land, impervious surface, landscape separation index, edge density, shape index, land use entropy index and downward shortwave radiation flux. Following introduction of second-order interaction terms, the AICc value of the optimal interaction model was −345.526, and the significant interaction combinations included: farmland × impervious surface, farmland × landscape separation index, farmland × shape index, farmland × land use entropy index, impervious surface × landscape separation index, impervious surface × edge density, and shape index × downward shortwave radiation flux. The proportion of the main-effects model explaining the variation of O. hupensis snail density was 39.8%, and the explanatory power of GAM increased to 79.0% following introduction of interaction terms. Conclusion Landscape separation index, edge density, shape index and other landscape pattern indicators pose significant impacts on the intensity and direction of changes in O. hupensis snail density in Yunnan Province.

ObjectiveTo summarize the incidence and clinical features of drug hypersensitivity reactions in children treated with sustained-releasing gonadotropin-releasing hormone agonists （GnRHa）， aiming to provide guidance for the safe clinical application of GnRHa in children. MethodsThe medical data of children diagnosed with central precocious puberty （CPP） or early and fast puberty （EFP） were retrospectively analyzed， who received GnRHa treatment at the Children's Growth Center of the First Affiliated Hospital of Sun Yat-sen University between January 1990 and July 2023. The occurrence of GnRHa-related drug hypersensitivity reactions were summarized， including the incidence and clinical features of systemic reactions and sterile abscesses. ResultsAmong the 1 684 children treated with GnRHa for CPP/EFP， the female-to-male ratio was 3.8∶1. A total of nine children （0.53%） developed 44 occurrences of drug hypersensitivity reactions. Four children （0.24%） presented with sterile abscesses （21 occurrences）， and five children （0.30%） experienced systemic hypersensitivity reactions （14 occurrences）. Four children were hypersensitive to triptorelin acetate， three were hypersensitive to leuprorelin acetate， and two were hypersensitive to both triptorelin acetate and leuprorelin acetate. The predominant hypersensitivity reactions to leuprorelin acetate were sterile abscesses， observed in four cases （4/277， 1.44%）， whereas the main reactions to triptorelin acetate were systemic hypersensitivity reactions， affecting five cases （5/1 501， 0.33%）. Case one presented with a severe and complex condition， exhibiting hypersensitivity to multiple GnRHa preparations （sustained-releasing triptorelin， sustained-releasing leuprorelin， and short-acting triptorelin）， and presenting with diverse manifestations， including induration， sterile abscesses， systemic hypersensitivity reactions， and even loss of suppression of the hypothalamic-pituitary-gonadal axis， leading to treatment failure. ConclusionsThe proportion of children experiencing drug hypersensitivity reactions to sustained-releasing GnRHa is relatively low at 0.53%， with diverse manifestations. The reactions primarily manifest as sterile abscesses and systemic hypersensitivity reactions， and in severe cases， may lead to treatment failure due to loss of suppression of the hypothalamic-pituitary-gonadal axis.

BACKGROUND:A network-based pharmacological approach has identified multifunctional effects of the main bioactive compounds in the Trichosanthis Fructus-Allii Macrostemonis Bulbus on coronary heart disease;however,the mechanism of its therapeutic effect on coronary heart disease has not been fully elucidated. OBJECTIVE:To investigate the role and mechanism of Trichosanthis Fructus-Allii Macrostemonis Bulbus in improving coronary heart disease by regulating the composition of gut microbiota. METHODS:Forty Sprague-Dawley rats were randomly divided into four groups:blank control group(n=10),model group(n=10),positive drug group(n=10),and medicine pair group(n=10).A rat model of coronary heart disease was established by continuous gastric perfusion of fat emulsion and injection of pituitrin.After modeling,rats in the model group were gavaged with distilled water(10 mL/kg)for control,rats in the positive drug group were gavaged with simvastatin 4 mg/kg per day,and rats in the medicine pair group were gavaged with Trichosanthis Fructus-Allii Macrostemonis Bulbus pairs 7.56 g/kg per day.All interventions lasted for 14 days.Electrocardiograms and myocardial pathology were observed,and blood lipid levels were measured.The structure of gut microbiota was analyzed using 16S rDNA sequencing technology. RESULTS AND CONCLUSION:Electrocardiogram results showed ST segment elevation in the model group.There were no significant abnormalities in the electrocardiograms of the positive drug group and medicine pair group.Compared with the blank control group,the levels of total cholesterol,triacylglycerol,and low-density lipoprotein cholesterol were significantly higher in the model group(P<0.05).Compared with the model group,the levels of total cholesterol,triacylglycerol,and low-density lipoprotein cholesterol were significantly lower in the positive drug group and medicine pair group(P<0.05).Compared with the blank control group,focal myocardial cell necrosis was observed in the model group,while partial myocardial cell disarray was observed in the positive drug group and medicine pair group.Compared with the blank control group,the Ace,Shannon,and Chao indices were increased(P<0.05)and the Simpson index was decreased(P<0.05)in the model group,positive drug group and medicine pair group.Compared with the model group,the Ace and Chao indices were decreased(P<0.05),while the Shannon index showed no significant difference(P>0.05)and the Simpson index was also decreased(P<0.05)in the positive drug group and medicine pair group.Compared with the blank control group,the relative abundances of Desulfovibrionia,Muribaculaceae_norank,etc.were increased in the model group,while those of Clostridia,[Eubacterium]_coprostanoligenes_group_norank,etc.were decreased.Compared with the model group,the relative abundances of WPS-2_norank,Muribaculaceae_norank,etc.were increased in the medicine pair group,while those of Clostridia,[Eubacterium]_coprostanoligenes_group_norank,etc.were decreased;the relative abundances of Desulfobacterota,[Eubacterium]_coprostanoligenes_group_norank,etc.were increased in the positive drug group,while those of Firmicutes,Muribaculaceae_norank,etc.were decreased.Compared with the positive drug group,the relative abundances of Desulfobacterota,Bacteroides,etc.were increased in the medicine pair group,while those of Firmicutes,[Eubacterium]_coprostanoligenes_group_norank,etc.were decreased.The LEfSe results showed that the medicine pair group had the highest microbial enrichment,followed by the blank control group and positive drug group,with the model group having the lowest microbial enrichment.To conclude,Trichosanthis Fructus-Allii Macrostemonis Bulbus pairs can improve the development of coronary heart disease by regulating gut microbiota composition,providing new insights for further research and development of Trichosanthis Fructus-Allii Macrostemonis Bulbus pairs.

Using Real-time PCR technology, a highly specific and sensitive method for detecting DNA residues of Escherichia coli host cells in levodopa was established, validated, and preliminarily applied. Escherichia coli strain MB6 16S ribosomal RNA gene was selected as the target gene to design multiple pairs of primers and the target fragment by specific amplification of PCR was obtained. The target fragment was cloned into the pLENTI-BSD-CON vector and the recombinant plasmid was constructed and named pLENTI-BSD-CON-E.coli-16S. A quantitative PCR detection method (SYBR Green method) with magnetic bead extraction and purification methods was established with the reference standard of the recombinant plasmid. Furthermore, the established method was validated, including linear and range, accuracy, precision, specificity, and quantification limit, and applied to the detection of levodopa raw materials. Meanwhile, the detection method was compared with the Taqman probe method by the commercial kit. The primer sequences of the quantitative PCR detection method (SYBR Green method) were TTCGATGCAACGCGAAGAAC (forward) and GTGTAGCCCTGGTCGTAAGG (reverse). The standard curve of DNA was in the range of 10 fg/μL to 3 ng/μL with good linearity (R2≥ 0.98). The quantitative limit was 10 fg/μL. In addition, the detection recovery rate was in the range of 59.7% to 80.7%, with RSD at less than 15%. Nine batches of levodopa were detected by this method, and the amount of E.coli DNA residue was below the limit. The developed qPCR method can be used for quantitative detection of residual DNA in biological products produced by E.coli as host cells, such as levodopa . The results indicate that the sensitivity of the detection method for recombinant plasmid construction standards is superior than the reagent kit detection method.

Genitourinary system tumors, as a major clinical challenge posing a serious threat to human health, urgently require breakthroughs in the construction of a precision diagnosis and treatment system. The innovative application of molecular imaging technologies, particularly the development of novel molecular probes, is revolutionizing the diagnostic and therapeutic paradigms for urinary tumors. The application of novel molecular probes in the early diagnosis and staging of genitourinary tumors, the role of multimodal molecular imaging probes in guiding precision surgery/radiotherapy, and the clinical translation challenges and strategies for theranostic-integrated probes are systematically reviewed in this article to provide valuable insights and references for related research and clinical practice.

BACKGROUND: The available evidence regarding the benefits of percutaneous coronary intervention (PCI) on patients receiving dialysis with coronary artery disease (CAD) is limited and inconsistent. This study aimed to evaluate the association between PCI and clinical outcomes as compared with medical therapy alone in patients undergoing dialysis with CAD in China. METHODS: This multicenter, retrospective study was conducted in 30 tertiary medical centers across 12 provinces in China from January 2015 to June 2021 to include patients on dialysis with CAD. The primary outcome was major adverse cardiovascular events (MACE), defined as a composite of cardiovascular death, non-fatal myocardial infarction, and non-fatal stroke. Secondary outcomes included all-cause death, the individual components of MACE, and Bleeding Academic Research Consortium criteria types 2, 3, or 5 bleeding. Multivariable Cox proportional hazard models were used to assess the association between PCI and outcomes. Inverse probability of treatment weighting (IPTW) and propensity score matching (PSM) were performed to account for potential between-group differences. RESULTS: Of the 1146 patients on dialysis with significant CAD, 821 (71.6%) underwent PCI. After a median follow-up of 23.0 months, PCI was associated with a 43.0% significantly lower risk for MACE (33.9% [ n  = 278] vs . 43.7% [ n  = 142]; adjusted hazards ratio 0.57, 95% confidence interval 0.45-0.71), along with a slightly increased risk for bleeding outcomes that did not reach statistical significance (11.1% vs . 8.3%; adjusted hazards ratio 1.31, 95% confidence interval, 0.82-2.11). Furthermore, PCI was associated with a significant reduction in all-cause and cardiovascular mortalities. Subgroup analysis did not modify the association of PCI with patient outcomes. These primary findings were consistent across IPTW, PSM, and competing risk analyses. CONCLUSION This study indicated that PCI in patients on dialysis with CAD was significantly associated with lower MACE and mortality when comparing with those with medical therapy alone, albeit with a slightly increased risk for bleeding events that did not reach statistical significance.
Humans ; Percutaneous Coronary Intervention/methods* ; Male ; Female ; Coronary Artery Disease/drug therapy* ; Retrospective Studies ; Renal Dialysis/methods* ; Middle Aged ; Aged ; China ; Proportional Hazards Models ; Treatment Outcome

BACKGROUND: Generalized pustular psoriasis (GPP), a rare and recurrent autoinflammatory disease, imposes a substantial burden on patients and society. Awareness of GPP in China remains limited. METHODS: This cross-sectional survey, conducted between September 2021 and May 2023 across 14 hospitals in China, included GPP patients of all ages and disease phases. Data collected encompassed demographics, clinical characteristics, economic impact, disease severity, quality of life, and treatment-related complications. Risk factors for GPP recurrence were analyzed. RESULTS: Among 127 patients (female/male ratio = 1.35:1), the mean age of disease onset was 25 years (1st quartile [Q1]-3rd quartile [Q3]: 11-44 years); 29.2% had experienced GPP for more than 10 years. Recurrence occurred in 75.6% of patients, and nearly half reported no identifiable triggers. Younger age at disease onset ( P  = 0.021) and transitioning to plaque psoriasis ( P  = 0.022) were associated with higher recurrence rates. The median diagnostic delay was 8 months (Q1-Q3: 2-41 months), and 32.3% of patients reported misdiagnoses. Comorbidities were present in 53.5% of patients, whereas 51.1% experienced systemic complications during treatment. Depression and anxiety affected 84.5% and 95.6% of patients, respectively. During GPP flares, the median Dermatology Life Quality Index score was 19.0 (Q1-Q3: 13.0-23.5). This score showed significant differences between patients with and without systemic symptoms; it demonstrated correlations with both depression and anxiety scores. Treatment costs caused financial hardship in 55.9% of patients, underscoring the burden associated with GPP. CONCLUSIONS The substantial disease and economic burdens among Chinese GPP patients warrant increased attention. Patients with early onset disease and those transitioning to plaque psoriasis require targeted interventions to mitigate the high recurrence risk.
Humans ; Male ; Female ; Psoriasis/pathology* ; Adult ; Cross-Sectional Studies ; Adolescent ; Child ; Young Adult ; Quality of Life ; Middle Aged ; China/epidemiology* ; Recurrence ; Risk Factors ; Surveys and Questionnaires ; East Asian People