This article adopts Professor CHEN Chaozu′s " sanjiao composed by membrane-striae" theory as its foundation to explore the relationship between irritable bowel syndrome and functional/structural abnormalities of the membrane-striae. Sanjiao encompasses both the tangible membrane and the intangible striae. These striae permeate the entire body，and their pathological changes comprehensively reflect qi，body fluids，and fasciae. Based on the physiological function of the membrane-striae in regulating qi and fluids，the pathogenesis of irritable bowel syndrome is characterized by a disharmony of membrane-striae and an imbalance of the qi-fluid interactions. In the early stage，external pathogens，emotional factors，or dietary stimuli often cause membrane-striae constriction and disordered qi-fluid circulation. In the middle stage，stagnant fluids gradually transform into phlegm retention，leading to membrane-striae obstruction. In the late stage，deficiency of vital qi becomes predominant，manifesting as laxity of membrane-striae with impaired control or weakened conduction. The treatment of irritable bowel syndrome should adopt " unblocking" as the guiding principle. In the early stage，therapy should focus on eliminating pathogenic factors and soothing membrane-striae to promptly restore qi-fluid circulation，thereby attaining unblocking through spasm relief. In the middle stage，treatment should focus on resolving tangible obstructions in membrane-striae，achieving unblocking via dredging. In the late stage，the emphasis should shift to reinforcing healthy qi，particularly by strengthening spleen-kidney yang qi，and achieving unblocking through supplementation. Concurrently，throughout the entire treatment process，the regulation of mental state and easing of emotional tension should be integrated to alleviate patient′s anxiety，achieving the goal of holistic treatment of both body and mind.

ObjectiveTranscranial magneto-acoustic stimulation (TMAS) is an emerging non-invasive neuromodulation technique that may provide a novel non-pharmacological intervention strategy for Parkinson's disease (PD). PD is characterized by the progressive degeneration of dopaminergic neurons in the substantia nigra pars compacta (SNc), leading to motor impairments such as bradykinesia, tremor, and rigidity. Increasing evidence indicates that mitochondrial dysfunction and impaired mitochondrial quality control are central mechanisms underlying dopaminergic neuronal loss. In particular, abnormalities in mitophagy and mitochondrial fission-fusion balance contribute substantially to oxidative stress, energy metabolic failure, and neuronal injury. At present, most clinical treatments for PD mainly alleviate symptoms but do not effectively halt disease progression. Therefore, exploring new interventions targeting the core pathological mechanisms is of considerable significance. This study aims to investigate whether TMAS can improve neural damage and motor dysfunction in PD mice by regulating mitophagy and the fission/fusion dynamic balance, thereby providing theoretical and experimental support for its application in PD treatment. MethodsMale C57BL/6 mice were used in this study. A PD model was established by intraperitoneal injection of 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) for 7 consecutive days. After model induction, mice in the intervention group received TMAS once daily for 14 consecutive days, whereas the corresponding control group received sham stimulation. The stimulation target was positioned over the primary motor cortex (M1). Motor performance was evaluated using the pole test and the open-field test. To verify the activation effect of TMAS on the target cortical region, c-Fos immunohistochemistry was performed in the M1. To assess nigral dopaminergic neuronal injury, tyrosine hydroxylase (TH) immunohistochemistry was used to quantify TH-positive neurons in the SNc. Mitochondrial function was evaluated by measuring reactive oxygen species (ROS) levels and adenosine triphosphate (ATP) content in the SNc. Western blot was further performed to determine the expression of mitophagy-related proteins, including PINK1, Parkin, LC3-II, and p62, as well as mitochondrial dynamics-related proteins, including Drp1 and Opa1. ResultsTMAS significantly increased the number of c-Fos-positive cells in M1 (P<0.000 1), indicating effective activation of neurons in the targeted cortical region. Compared with the control group, MPTP-treated mice exhibited marked motor dysfunction, including a significant reduction in total distance traveled in the open-field test (P<0.000 1) and mean speed (P=0.000 1), as well as significant prolongation of turn time and total climbing time in the pole test (P<0.000 1). These behavioral impairments were accompanied by a substantial loss of TH-positive dopaminergic neurons in the SNc, whereas TMAS significantly increased TH-positive neuron survival (P<0.000 1). In parallel, MPTP induced a pronounced increase in ROS levels and a significant reduction in ATP content, indicating severe mitochondrial dysfunction and energy metabolism impairment (P<0.01). TMAS treatment significantly improved motor performance, as reflected by the reversal of MPTP-induced impairment in the open-field and pole tests, and significantly reduced ROS accumulation (P<0.01) while restoring ATP production (P<0.001). At the molecular level, MPTP markedly downregulated PINK1 and Parkin, decreased p62 expression, increased LC3-II accumulation, elevated Drp1 expression, and reduced Opa1 expression, whereas TMAS significantly reversed these abnormalities, suggesting restoration of mitophagy-related mitochondrial quality control and re-establishment of mitochondrial fission-fusion balance. Collectively, these findings indicate that TMAS ameliorates MPTP-induced neurotoxicity and restores mitochondrial homeostasis and energy metabolism. ConclusionTMAS effectively attenuates neural damage and improves motor dysfunction in MPTP-induced PD mice. Its neuroprotective effects are closely associated with multidimensional regulation of the mitochondrial quality control system, including restoration of PINK1/Parkin-mediated mitophagy and rebalancing of Drp1/Opa1-related mitochondrial dynamics. Rather than acting only as a symptomatic neuromodulatory intervention, TMAS may influence a key pathological axis of PD by improving mitochondrial homeostasis in SNc and protecting nigral dopaminergic neurons. These findings provide experimental evidence supporting TMAS as a promising non-invasive physical intervention for PD.

ObjectiveTranscranial magneto-acoustic stimulation (TMAS) is an emerging non-invasive neuromodulation technique that may provide a novel non-pharmacological intervention strategy for Parkinson's disease (PD). PD is characterized by the progressive degeneration of dopaminergic neurons in the substantia nigra pars compacta (SNc), leading to motor impairments such as bradykinesia, tremor, and rigidity. Increasing evidence indicates that mitochondrial dysfunction and impaired mitochondrial quality control are central mechanisms underlying dopaminergic neuronal loss. In particular, abnormalities in mitophagy and mitochondrial fission-fusion balance contribute substantially to oxidative stress, energy metabolic failure, and neuronal injury. At present, most clinical treatments for PD mainly alleviate symptoms but do not effectively halt disease progression. Therefore, exploring new interventions targeting the core pathological mechanisms is of considerable significance. This study aims to investigate whether TMAS can improve neural damage and motor dysfunction in PD mice by regulating mitophagy and the fission/fusion dynamic balance, thereby providing theoretical and experimental support for its application in PD treatment. MethodsMale C57BL/6 mice were used in this study. A PD model was established by intraperitoneal injection of 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) for 7 consecutive days. After model induction, mice in the intervention group received TMAS once daily for 14 consecutive days, whereas the corresponding control group received sham stimulation. The stimulation target was positioned over the primary motor cortex (M1). Motor performance was evaluated using the pole test and the open-field test. To verify the activation effect of TMAS on the target cortical region, c-Fos immunohistochemistry was performed in the M1. To assess nigral dopaminergic neuronal injury, tyrosine hydroxylase (TH) immunohistochemistry was used to quantify TH-positive neurons in the SNc. Mitochondrial function was evaluated by measuring reactive oxygen species (ROS) levels and adenosine triphosphate (ATP) content in the SNc. Western blot was further performed to determine the expression of mitophagy-related proteins, including PINK1, Parkin, LC3-II, and p62, as well as mitochondrial dynamics-related proteins, including Drp1 and Opa1. ResultsTMAS significantly increased the number of c-Fos-positive cells in M1 (P<0.000 1), indicating effective activation of neurons in the targeted cortical region. Compared with the control group, MPTP-treated mice exhibited marked motor dysfunction, including a significant reduction in total distance traveled in the open-field test (P<0.000 1) and mean speed (P=0.000 1), as well as significant prolongation of turn time and total climbing time in the pole test (P<0.000 1). These behavioral impairments were accompanied by a substantial loss of TH-positive dopaminergic neurons in the SNc, whereas TMAS significantly increased TH-positive neuron survival (P<0.000 1). In parallel, MPTP induced a pronounced increase in ROS levels and a significant reduction in ATP content, indicating severe mitochondrial dysfunction and energy metabolism impairment (P<0.01). TMAS treatment significantly improved motor performance, as reflected by the reversal of MPTP-induced impairment in the open-field and pole tests, and significantly reduced ROS accumulation (P<0.01) while restoring ATP production (P<0.001). At the molecular level, MPTP markedly downregulated PINK1 and Parkin, decreased p62 expression, increased LC3-II accumulation, elevated Drp1 expression, and reduced Opa1 expression, whereas TMAS significantly reversed these abnormalities, suggesting restoration of mitophagy-related mitochondrial quality control and re-establishment of mitochondrial fission-fusion balance. Collectively, these findings indicate that TMAS ameliorates MPTP-induced neurotoxicity and restores mitochondrial homeostasis and energy metabolism. ConclusionTMAS effectively attenuates neural damage and improves motor dysfunction in MPTP-induced PD mice. Its neuroprotective effects are closely associated with multidimensional regulation of the mitochondrial quality control system, including restoration of PINK1/Parkin-mediated mitophagy and rebalancing of Drp1/Opa1-related mitochondrial dynamics. Rather than acting only as a symptomatic neuromodulatory intervention, TMAS may influence a key pathological axis of PD by improving mitochondrial homeostasis in SNc and protecting nigral dopaminergic neurons. These findings provide experimental evidence supporting TMAS as a promising non-invasive physical intervention for PD.

Objective To investigate the temporal changes in pathological damage and macrophage polarization in liver and spleen tissues of mice infected with Angiostrongylus cantonensis, and to preliminarily unravel the peripheral immune responses during the early stage of A. cantonensis infection. Methods Forty female BALB/c mice at ages of 6 to 8 weeks were randomly divided into four groups, including the control group and 7-, 14-, and 21-day infection groups, with 10 mice in each group. Each mouse in the infection groups was inoculated with 30 third-stage (L3) larvae of A. cantonensis by oral gavage, and five mice were randomly selected from each infection group on days 7, 14, and 21 post-infection, while mice in the control group were given the same volume of physiological saline and five mice were randomly selected from the control group on the day of oral gavage. Mouse liver and spleen tissues were sampled. The histopathological changes of mouse liver and spleen tissues were observed using hematoxylin and eosin (HE) staining, and the percentage of positive staining area and the co-localization positive rates of the macrophage surface antigens F4/80, CD86, and CD206 were quantified in mouse liver and spleen tissues using immunohistochemical and immunofluorescence staining. In addition, five mice were collected from each infection group on days 7, 14, and 21 post-infection, and five mice were collected from the control group on the day of oral gavage. Mouse liver and spleen tissues were sampled for detection of macrophage markers CD86 and CD206 and macrophage phenotyping using flow cytometry, and the expression of M1 macrophage markers, including inducible nitric oxide synthase (Nos2), tumor necrosis factor-α (TNF-α), interleukin-1β (IL-1β) and M2 markers, including arginase 1 (Arg1), mannose receptor C-type 1 (Mrc1) and chitinase-like protein 3 (Chil3) was quantified in mouse liver and spleen tissues using real-time quantitative PCR (RT-qPCR) assay. Results Proliferative lesions of the hepatocyte were observed in mouse liver tissues and the follicular structures of the mouse spleen white pulp were disrupted 21 days post-infection with A. cantonensis. Immunohistochemical staining showed that there were significant differences in the percentages of F4/80, CD86 and CD206 positive staining areas in the liver and spleen tissues among the four groups of mice (F = 242.40, 197.14, 183.19, 157.65, 242.35 and 146.24; all P values < 0.001), and the percentages of positive staining in the liver and spleen tissues of mice in the 14-day infection group [(4.45 ± 0.51)%, (3.74 ± 0.67)%, (8.32 ± 0.72)%, (16.56 ± 1.14)%, (11.62 ± 0.52)%, and (8.29 ± 0.72)%, respectively] and the 21-day infection group [(3.70 ± 0.11)%, (3.22 ± 0.43)%, (11.53 ± 1.03)%, (12.59 ± 1.05)%, (9.02 ± 0.83)%, and (11.67 ± 1.10)%, respectively] were higher than in the control group [(0.35 ± 0.16)%, (0.40 ± 0.02)%, (0.93 ± 0.05)%, (2.78 ± 0.26)%, (2.33 ± 0.20)%, and (1.85 ± 0.20)%, respectively] (all P values < 0.05). Immunofluorescence staining showed significant differences in the positive rates of F4/80 co-localization with CD86 and CD206 in mouse liver and spleen tissues among the four groups (F = 24.42, 25.28, 54.51 and 130.55; all P values < 0.001). Flow cytometry detected significant differences in the proportions of CD86⁺ and CD206⁺ macrophages in mouse liver and spleen tissues among the four groups (F = 67.98, 18.41, 29.77, 172.80; all P values < 0.001), and the proportions of CD206⁺ macrophages in the liver and spleen of the 21-day infection group were significantly higher than those in the control group [(9.25 ± 2.55)% vs (3.83 ± 0.72)%, and (4.22 ± 0.56)% vs (0.47 ± 0.18)%, respectively] (both P values < 0.05). In addition, RT-qPCR assay quantified significant differences in the relative mRNA expression of M1 macrophage markers (IL-1β, TNF-α and Nos2) and M2 macrophage markers (Arg1, Chil3 and Mrc1) in mouse liver and spleen tissues among the four groups (F = 41.30, 31.82, 199.33, 19.96, 62.01, 119.76, 23.67, 95.90, 72.27, 82.59, 123.41 and 29.75; all P values < 0.05). Conclusions A. cantonensis infection may cause progressive pathological damage in mouse liver and spleen tissues, accompanied by dynamic temporal changes in macrophage polarization. M1 macrophage polarization predominates at the early stage of A. cantonensis infection and shifts towards M2 polarization at the later stages, suggesting that M2 polarization may participate in immune regulation at late stages of A. cantonensis infection by suppressing excessive inflammatory responses and promoting tissue repair.

Using Real-time PCR technology, a highly specific and sensitive method for detecting DNA residues of Escherichia coli host cells in levodopa was established, validated, and preliminarily applied. Escherichia coli strain MB6 16S ribosomal RNA gene was selected as the target gene to design multiple pairs of primers and the target fragment by specific amplification of PCR was obtained. The target fragment was cloned into the pLENTI-BSD-CON vector and the recombinant plasmid was constructed and named pLENTI-BSD-CON-E.coli-16S. A quantitative PCR detection method (SYBR Green method) with magnetic bead extraction and purification methods was established with the reference standard of the recombinant plasmid. Furthermore, the established method was validated, including linear and range, accuracy, precision, specificity, and quantification limit, and applied to the detection of levodopa raw materials. Meanwhile, the detection method was compared with the Taqman probe method by the commercial kit. The primer sequences of the quantitative PCR detection method (SYBR Green method) were TTCGATGCAACGCGAAGAAC (forward) and GTGTAGCCCTGGTCGTAAGG (reverse). The standard curve of DNA was in the range of 10 fg/μL to 3 ng/μL with good linearity (R2≥ 0.98). The quantitative limit was 10 fg/μL. In addition, the detection recovery rate was in the range of 59.7% to 80.7%, with RSD at less than 15%. Nine batches of levodopa were detected by this method, and the amount of E.coli DNA residue was below the limit. The developed qPCR method can be used for quantitative detection of residual DNA in biological products produced by E.coli as host cells, such as levodopa . The results indicate that the sensitivity of the detection method for recombinant plasmid construction standards is superior than the reagent kit detection method.

OBJECTIVE To optimize the prescription pre-review system in our hospital and evaluate its application effects. METHODS Aiming at the problems of imperfect rule base and high false positive rate in the early operation of the system， optimization measures were taken， including improving the content of the rule base， adjusting the interception level and prompt mode， refining the working model of prescription review pharmacists， and strengthening clinical communication. A retrospective cohort study was conducted， with prescription data from June to December 2023 （before optimization） as the control group and June to December 2024 （after optimization） as the observation group. Through inter group comparative analysis， the actual effect of optimizing the prescription pre-approval system was evaluated. RESULTS The prescription qualified rate increased from （82.51± 4.04）% before optimization to （90.98±1.55）% after optimization； the false positive rate decreased from （20.87±1.64）% before optimization to （7.41±2.04）% after optimization. The monthly range of prescription qualified rate narrowed from 10.24% to 4.11%， and the coefficient of variation decreased from 4.92% to 1.73%. The monthly range of false positive rate slightly increased from 4.40% to 5.34%， the coefficient of variation rose from 8.32% to 26.18%. CONCLUSIONS Through multi-dimensional optimizations of the prescription pre-review system in our hospital， its prescription review efficiency has been significantly enhanced， the quality of prescriptions has steadily improved， and the accuracy of reviews has notably improved.

Implementation Science is an interdisciplinary field dedicated to systematically studying how to effectively translate evidence-based research findings into practical application and implementation. In the health-related context, it focuses on enhancing the efficiency and quality of healthcare services, thereby facilitating the transition from scientific evidence to real-world practice. This article elaborates on Theories, Models, and Frameworks (TMF) within health-related Implementation Science, clarifying their basic concepts and classifications, and discussing their roles in guiding implementation processes. Furthermore, it reviews and prospects current research from three aspects: the constituent elements of TMF, their practical applications, and future directions. Five representative frameworks are emphasized, including the Consolidated Framework for Implementation Research (CFIR), the Practical Robust Implementation and Sustainability Model (PRISM), the Exploration, Preparation, Implementation, Sustainment (EPIS)framework, the Behavior Change Wheel (BCW), and the Normalization Process Theory (NPT). Additionally, resources such as the Dissemination & Implementation Models Webtool and the T-CaST tool are introduced to assist researchers in selecting appropriate TMFs based on project-specific needs.

Objective: To investigate the willingness to receive the pneumococcal vaccine and its influencing factors among middle-aged and elderly population in Zhejiang Province, so as to provide a basis for increasing the vaccination rate of pueumococcal among middle-aged and elderly population. Methods: From March to May 2024, a multi-stage random sampling method was employed to recruit residents aged ≥50 years from 35 counties (cities or districts) in Zhejiang Province. Data on basic information, knowledge of pneumonia, pneumococcal vaccine, and willingness to receive pneumococcal vaccine were collected through questionnaire surveys. A multivariable logistic regression model was used to analyze influencing factors for the willingness to receive pneumococcal vaccine among middle-aged and elderly population. Results: A total of 10 500 middle-aged and elderly population were surveyed. Among them, there were 5 202 males, accounting for 49.54%, and 5 298 females, accounting for 50.46%. The mean age was (65.11±9.05) years. Of the participants, 7 732 individuals were aware of pneumonia, accounting for 73.64%. A total of 1 724 individuals had received pneumococcal vaccine, corresponding to a vaccination rate of 16.42%. Furthermore, 5 138 participants expressed willingness to receive pneumococcal vaccine, with a willingness rate of 48.93%. The multivariable logistic regression analysis showed that middle-aged and elderly population aged ≥60 years (60-<70 years, OR=1.577, 95%CI: 1.433-1.736; ≥70 years, OR=2.110, 95%CI: 1.918-2.321), those with a history of chronic diseases (OR=1.250, 95%CI: 1.154-1.353), those who were recommended to receive the pneumonia vaccine by doctors (OR=4.896, 95%CI: 4.507-5.318), those who were aware of pneumonia (OR=1.460, 95%CI: 1.338-1.594), those who were aware that the elderly are prone to pneumonia (OR=1.490, 95%CI: 1.375-1.614), those who were aware of the causes of pneumonia (OR=1.559, 95%CI: 1.434-1.694), those who were aware that vaccination can prevent pneumonia (OR=2.196, 95%CI: 2.031-2.375), and those who were aware of the immunization schedule for pneumonia vaccine (OR=1.897, 95%CI: 1.683-2.124) had a higher willingness to receive pneumonia vaccine. Conclusions The willingness of middle-aged and elderly population in Zhejiang Province to receive pneumonia vaccine is related to age, history of chronic diseases, awareness of pneumonia, and awareness of pneumonia vaccine. It is recommended to strengthen health education on pneumonia and pneumonia vaccine for middle-aged and elderly population, in order to increase the willingness to receive the vaccine and vaccination rate.

Objective To establish radioresistant human non-small cell lung cancer NCI-H460R model cells and evaluate the sensitivity of these radioresistant cells to a ferroptosis inducer. Methods Radioresistant cell lines, designated as NCI-H460 R20Gy and NCI-H460 R116Gy, were generated by subjecting parental NCI-H460 cells to fractionated irradiation with varying cumulative doses. Both parental cells and the established radioresistant cell lines were each randomly divided into four groups and exposed to irradiation at 0, 2, 4, and 6 Gy, respectively. Successful establishment of the radioresistant cell lines was confirmed by colony formation assay. Subsequently, cells were treated with increasing concentrations of the ferroptosis inducer RSL-3 to assess differential sensitivity between parental and radioresistant cells to ferroptosis. Results In comparison to the parental NCI-H460 cells (D_0WT=1.2), both NCI-H460 R116Gy and NCI-H460 R20Gy cells exhibited radioresistance, with NCI-H460 R116Gy demonstrating a stronger radioresistance (D_0R116Gy=1.5) than NCI-H460 R20Gy (D_0R20Gy=1.4). Furthermore, NCI-H460 R116Gy cells exhibited increased sensitivity to RSL-3 relative to the parental cells (P < 0.001), while NCI-H460 R20Gy cells did not display a significant difference in sensitivity to RSL-3. Conclusion Human non-small cell lung cancer cells with radioresistance induced by a high cumulative irradiation dose exhibit increased sensitivity to the glutathione peroxidase 4-specific ferroptosis inducer RSL-3. This finding provides an experimental basis for optimizing combined treatment regimens involving radiotherapy and RSL-3 for non-small cell lung cancer patients with radiotherapy resistance.

Objective:To investigate the clinical efficacy of moxibustion(Mox)combined with low-dose tadalafil(TAD)in the treatment of diabetes mellitus-induced erectile dysfunction(DMED)with the syndrome of Qi deficiency and blood stasis.Meth-ods:According to the inclusion and exclusion criteria,we selected 90 patients with DMED for this trial and equally randomized them into a Mox,a TAD,and a Mox combined with TAD(Mox+TAD)group to be treated by mild Mox applied to the acupoints Zusanli,Sanyinjiao and Yinlingquan qd alt,oral medication with low-dose TAD at 5 mg per dose qd,and combination of the above two thera-pies,respectively,all for 4 weeks.We obtained from the patients their IIEF-5 scores,traditional Chinese medicine(TCM)symptoms scores,Erectile Hardness Scale(EHS)scores,corpus cavernosal hemodynamic indexes,and the peak systolic velocity(PSV),end diastolic velocity(EDV)and resistance index(RI)of the corpus cavernosal arteries before and after treatment,and compared them among the three groups.Results:The total effectiveness rate was significantly higher in the Mox+TAD(90.0％)than in the Mox(46.7％)and TAD groups(60.0％)(P＜0.05).Compared with the baseline,the IIEF-5 and EHS scores were increased,while the TCM symptoms scores decreased in all the three groups after treatment,more significantly in the Mox+TAD group than in the other two(P＜0.05).And the PSV and RI were remarkably increased,while the EDV decreased(P＜0.05)in all the three groups(P＜0.05)after treatment,with PSV even higher in the Mox+TAD than in the Mox and TAD groups(P＜0.05).Conclusion:Moxi-bustion combined with tadalafil has a definite efficacy and safety for the treatment of DMED,which can effectively improve the erectile function of the patients by increasing penile blood supply,benefiting qi and activating blood circulation.