1.A qualitative study on the driving forces for oncology nurses’ participation in palliative care work
Xinyao YUAN ; Pengyun LI ; Sujuan HAO ; Fen WANG ; Dan XU ; Jiahe LI ; Xuancheng CHEN ; Huiling LI
Chinese Medical Ethics 2026;39(3):358-364
ObjectiveTo explore the driving forces for oncology nurses’ participation in palliative care work, thereby providing a theoretical basis for the improvement of education and training, incentive mechanisms, and other aspects of the palliative care nursing staff. MethodsEmploying a qualitative research method, semi-structured interviews lasting 40-60 minutes were conducted with 14 nurses who had participated in palliative care work. The interview data were analyzed using the Colaizzi seven-step analysis method. ResultsInternal positive driving forces were job interest, empathy, and a sense of professional responsibility, while the negative was low psychological resilience. External positive driving forces included high work support, professional identity, mutual benefits for nurses and patients, and positive patient attitudes, whereas negative driving forces comprised busy routine clinical work, lack of a reward and incentive system, and bland or negative patient attitudes. ConclusionIt is essential to provide a flexible platform for the enhancement of nurses’ professional capabilities in palliative care, intensify the publicity of palliative care and death education; intervene and guide nurses’ negative emotions, improve and implement relevant incentive systems, and standardize the job recognition and scope of responsibilities of palliative care nurses.
2.Transcriptomic responses of Bulinus globosus to extreme temperature and drought stress
Xinyao WANG ; Dandan PENG ; Ying YANG ; Jianfeng ZHANG ; Zhiqiang QIN ; Kun YANG ; Shizhu LI ; Jing XU
Chinese Journal of Schistosomiasis Control 2026;38(1):29-37
Objective To examine the impact of extreme temperature and drought stress on the survival of Bulinus globosus, so as to provide the theoretical evidence for the genomic research of Bulinus in absence of reference genes. Methods B. globosus snail samples were collected from Kiwani Shehia in Pemba Island, Zanzibar, Tanzania, and offspring snails were obtained through laboratory breeding and reproduction. A total of 120 10-week-old B. globosus snails from the same generation were selected and randomly assigned into four groups, including the high-temperature drought (HD) group, normal temperature drought (D) group, low-temperature drought (LD) group, and the control (C) group, of 30 snails in each group. Snails in HD, D, and LD groups were placed in beakers containing dry soil at the bottom and subsequently housed in climate chambers at 35, 26 ℃, and 10 ℃, respectively, while snails in Group C were maintained in 500 mL petri dishes containing dechlorinated tap water at 26 ℃. Following 3 days of breeding, living snails in each group were collected, and soft tissues were dissected and isolated. Total RNA was extracted from snail soft tissues for library construction, followed by high-throughput sequencing on the Illumina HiSeq 4000 sequencing system. De novo transcriptome assembly was performed using the Trinity software, and the longest transcripts were selected as unigenes. Gene functional annotations of unigenes were conducted using the Diamond software against Gene Ontology (GO) knowledgebase, Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway database, NCBI non-redundant (NR) protein sequences database, Protein Family (Pfam) database, and UniProtKB/Swiss-Prot (Swiss-Prot) knowledgebase. GO and KEGG enrichment analyses of differentially expressed genes (DEGs) were performed using the topGO and clusterProfiler software, respectively. In addition, four relevant genes were selected for validation using a real-time quantitative PCR (qRT-PCR) assay to verify the reliability of transcriptome sequencing results. Results Following 3 days of breeding, there were 7, 20, 28, and 30 survival B. globosus snails in HD, LD, D, and C groups, with corresponding survival rates of 23.33% (7/30), 66.67% (20/30), 93.33% (28/30), and 100.00% (30/30), respectively (χ2 = 52.72, P < 0.001). De novo transcriptome assembly generated 176 942 unigenes, with annotation rates of 0.98%, 13.49%, 26.46%, 12.48%, and 14.39% against GO knowledgebase, KEGG pathway database, NR protein sequences database, Pfam database, and Swiss-Prot knowledgebase, respectively. There were 33 up-regulated and 72 down-regulated genes in Group D, 483 up-regulated and 815 down-regulated genes in Group HD, and 245 up-regulated and 172 down-regulated genes in Group LD relative to in Group C. Following removal of overlapping genes across groups and unmatched genes, 11 candidate genes were identified. GO and KEGG analyses revealed 3 heat shock protein (HSP)-related DEGs in these 11 candidate genes, which were annotated as HSP12.2, HSP70, and HSP20 genes and were all significantly up-regulated in each treatment group. Three immune and nervous system-related DEGs were identified, and were all significantly down-regulated in each treatment group, which were involved in the neural cell adhesion molecule L1-like protein pathway, fibrinogen binding protein pathway, and leukocyte elastase inhibitor-like protein pathway. qRT-PCR assay quantified that the expression trends of four genes related to temperature and drought stress across different treatment groups were highly consistent with transcriptome sequencing data. Conclusion The survival rate of B. globosus significantly reduces under combined stresses of extreme temperature and drought, possibly due to an imbalance in its cellular homeostasis regulatory system.
3.Detection of residual DNA in host cells of Escherichia coli in levodopa by Real-time PCR
Bingyu XU ; YAN LIU ; Xinyao GUO ; Fang YAN ; Guibin SUN
Journal of China Pharmaceutical University 2025;56(2):176-182
Using Real-time PCR technology, a highly specific and sensitive method for detecting DNA residues of Escherichia coli host cells in levodopa was established, validated, and preliminarily applied. Escherichia coli strain MB6 16S ribosomal RNA gene was selected as the target gene to design multiple pairs of primers and the target fragment by specific amplification of PCR was obtained. The target fragment was cloned into the pLENTI-BSD-CON vector and the recombinant plasmid was constructed and named pLENTI-BSD-CON-E.coli-16S. A quantitative PCR detection method (SYBR Green method) with magnetic bead extraction and purification methods was established with the reference standard of the recombinant plasmid. Furthermore, the established method was validated, including linear and range, accuracy, precision, specificity, and quantification limit, and applied to the detection of levodopa raw materials. Meanwhile, the detection method was compared with the Taqman probe method by the commercial kit. The primer sequences of the quantitative PCR detection method (SYBR Green method) were TTCGATGCAACGCGAAGAAC (forward) and GTGTAGCCCTGGTCGTAAGG (reverse). The standard curve of DNA was in the range of 10 fg/μL to 3 ng/μL with good linearity (R2≥ 0.98). The quantitative limit was 10 fg/μL. In addition, the detection recovery rate was in the range of 59.7% to 80.7%, with RSD at less than 15%. Nine batches of levodopa were detected by this method, and the amount of E.coli DNA residue was below the limit. The developed qPCR method can be used for quantitative detection of residual DNA in biological products produced by E.coli as host cells, such as levodopa . The results indicate that the sensitivity of the detection method for recombinant plasmid construction standards is superior than the reagent kit detection method.
4.Interpretation of advances in the treatment of esophageal cancer and gastroesophageal junction cancer at the 2025 American Society of Clinical Oncology Gastrointestinal Cancers Symposium (ASCO-GI)
Jiahe LI ; Jiayu LU ; Xuxu ZHANG ; Xinyao XU ; Jipeng ZHANG ; Wei LI ; Guizhen LI ; Qiang LU
Chinese Journal of Clinical Thoracic and Cardiovascular Surgery 2025;32(06):771-778
The 2025 American Society of Clinical Oncology Gastrointestinal Cancers Symposium (ASCO-GI) was held from January 23 to 25, 2025. Several significant studies on the treatment of esophageal and gastroesophageal junction (GEJ) cancer were presented at the symposium, highlighting notable advances, particularly in the perioperative and advanced settings. Immunotherapy has demonstrated significant promise in the neoadjuvant treatment of esophageal cancer, showing potential to become a standard treatment. Furthermore, the long-term survival benefits of combining immunotherapy with chemotherapy for advanced GEJ cancer were further validated. This article summarizes and interprets the researches presented at the symposium concerning perioperative and advanced treatments for esophageal and GEJ cancers.
5.Interpretation of advances in immune therapy for non-small cell lung cancer at the 2025 European Lung Cancer Congress
Wen LIU ; Jiayu LU ; Xuxu ZHANG ; Xinyao XU ; Jipeng ZHANG ; Wei LI ; Guizhen LI ; Bo BAO ; Qiang LU
Chinese Journal of Clinical Thoracic and Cardiovascular Surgery 2025;32(08):1063-1071
The 2025 European Lung Cancer Congress (ELCC) convened in Paris, France, centering on the optimization and innovation of immunotherapy for non-small cell lung cancer (NSCLC). Key topics at the congress included the application strategies for perioperative immunotherapy, breakthroughs in combination therapy models for advanced NSCLC, and the emerging roles of biomarkers in predicting diverse treatment outcomes. This paper integrates data from several key pivotal studies to systematically analyze the clinical value of neoadjuvant therapy within the perioperative setting, the potential of targeted combination regimens, and the challenges of managing drug resistance, thus offering new directions for clinical practice.
6.Interpretation of perioperative immunotherapy for lung cancer in 2024 WCLC/ESMO
Jiahe LI ; Xiaopeng REN ; Jiayu LU ; Chenyuan ZHANG ; Ruitao FAN ; Xuxu ZHANG ; Xinyao XU ; Guizhen LI ; Jipeng ZHANG ; Wei LI ; Qiang LU
Chinese Journal of Clinical Thoracic and Cardiovascular Surgery 2025;32(03):300-307
The 2024 World Conference on Lung Cancer (WCLC) and the European Society for Medical Oncology (ESMO) Annual Meeting, two of the most prestigious events in oncology, have concluded sequentially. As the most authoritative annual gatherings in lung cancer and the entire oncology field, the WCLC and ESMO conferences brought together top oncology experts and scientists from around the world to share, discuss, and publish the latest cutting-edge advancements in oncology. In both conferences, lung cancer immunotherapy remained a hot topic of considerable interest. This article aims to summarize and discuss the important research progress on perioperative immunotherapy for non-small cell lung cancer reported at the two conferences.
7.Research advances in triggering receptor expressed on myeloid cells 2 in the pathogenesis of Alzheimer's disease
Lishu SU ; Shuohan WANG ; Xinyao QI ; Jing GAO ; Pengjuan XU
Journal of Chongqing Medical University 2025;50(8):1016-1020
Alzheimer's disease(AD)is a highly destructive neurodegenerative disorder,and due to its complex pathology and insuffi-cient treatment,it is urgent to explore new targets that can directly address the root cause of the disease.In recent years,numerous stud-ies have shown that triggering receptor expressed on myeloid cells 2(TREM2)in microglial cells has the function of delaying the pro-gression of AD,and its abnormality plays a key role in the development and progression of AD,with a potential of being used as a target for the treatment of AD.This article reviews the biological characteristics of TREM2 and discusses its important role in the three major pathological features of AD and its potential as a target for AD treatment,in order to deepen the understanding of the role of TREM2 in AD and provide a theoretical reference for exploring new targets for AD treatment in the future.
8.Effect of electroacupuncture on lipophagy in hepatocytes in a hyperlipidemia rat model
Manqi LIU ; Lang QIN ; Xinyao SUN ; Shirong XU ; Houyu TAO ; Chuan HE ; Xiaoli PAN ; Hongxing ZHANG
Journal of Beijing University of Traditional Chinese Medicine 2025;48(11):1608-1618
Objective To explore the mechanism of electroacupuncture in alleviating hyperlipidemia in a rat model by modulating mammalian target of rapamycin complex 1(mTORC1)-mediated lipophagy in hepatocytes.Methods A total of 30 SD rats were randomly divided into blank(n=6)and modeling groups(n=24)using the random number table method.A hyperlipidemic rat model was established by feeding rats a high-fat diet(feeding for 8 weeks).After successful modeling,the modeling group was randomly divided into the model,electroacupuncture,mTORC1 inhibitor,and electroacupuncture+mTORC1 agonist groups,with six rats in each group.Except for the blank group,all other rats were fed with high fat diet.Rats in the electroacupuncture and electroacupuncture+mTORC1 agonist groups received electroacupuncture intervention at bilateral"Fenglong"(ST40)acupoints(dilatational wave 2 Hz/100 Hz,current intensity 1 mA)for 30 min once daily.Rats in the mTORC1 inhibitor group received intraperitoneal injections of the mTORC1 inhibitor,rapamycin(2 mg/kg),once daily.Rats in the electroacupuncture+mTORC1 agonist group received intraperitoneal injections of the mTORC1 agonist MHY1485(10 mg/kg)once daily.The interventions were administered for five consecutive days per week for 4 weeks.Upon completion of the intervention,the following analyses were performed:serum contents of total cholesterol(TC),triglycerides(TAG),low-density lipoprotein cholesterol(LDL-C),high-density lipoprotein cholesterol(HDL-C),free fatty acids(FFA),alanine aminotransferase(ALT),and aspartate aminotransferase(AST)were measured using a fully automated biochemical analyzer.Hepatic histopathological changes and lipid deposition were observed using hematoxylin-eosin and oil red O staining.The liver condition was observed and the liver index was calculated.Hepatic TC and TAG levels were measured using an enzyme-linked immunosorbent assay.The ultrastructure of the liver tissue was observed using transmission electron microscopy,and the mean fluorescence intensity of perilipin 2(PLIN2)and microtubule-associated protein 1 light chain 3(LC3)-Ⅱ in the liver tissue was detected using immunofluorescence.Protein expression of LC3-Ⅱ/LC3-Ⅰ,phosphorylated mammalian target of rapamycin(p-mTOR)/mTOR,and mTORC1 in liver tissue was detected using Western blotting.Results Compared to the blank group,the model group rats showed increased serum TC,TAG,LDL-C,ALT,AST,and FFA levels,along with decreased HDL-C levels(P<0.05).The liver index and hepatic TC and TAG levels were also elevated(P<0.05).Histological examination of liver tissue revealed substantial lipid accumulation,numerous lipid droplets within hepatocytes,abnormal mitochondrial morphology,and scarce autophagic vacuole.The mean fluorescence intensity of PLIN2 increased,whereas that of LC3-Ⅱ decreased(P<0.05).Additionally,the LC3-Ⅱ/LC3-Ⅰ ratio was reduced,whereas the p-mTOR/mTOR ratio and mTORC1 protein expression were increased(P<0.05).Compared to the model group,rats in the mTORC1 inhibitor and electroacupuncture groups exhibited decreased serum TC,TAG,LDL-C,ALT,AST,and FFA levels(P<0.05),along with a reduced liver index and hepatic TC and TAG levels(P<0.05).Histological examination showed markedly attenuated lipid accumulation and visible autophagic vacuole in the hepatocytes.The mean fluorescence intensity of PLIN2 decreased,whereas that of LC3-Ⅱ increased(P<0.05).Moreover,the LC3-Ⅱ/LC3-Ⅰ ratio increased,whereas the p-mTOR/mTOR ratio and mTORC1 protein expression decreased(P<0.05).In comparison with both the electroacupuncture and mTORC1 inhibitor groups,the electroacupuncture+mTORC1 agonist group demonstrated increased serum TAG,TC,LDL-C,ALT,AST,and FFA levels(P<0.05)as well as elevated liver index and hepatic TC and TAG levels(P<0.05).Liver tissues exhibited aggravated lipid deposition and absence of autophagic vacuole in liver cells.The mean fluorescence intensity of PLIN2 was enhanced,whereas that of LC3-Ⅱ was reduced(P<0.05).Furthermore,the LC3-Ⅱ/LC3-Ⅰ ratio decreased,and the p-mTOR/mTOR ratio and mTORC1 protein expression increased(P<0.05).Conclusion Electroacupuncture at"Fenglong"(ST40)may improve blood lipid levels in hyperlipidemic rats by inhibiting mTORC1 and promoting hepatocyte lipophagy.
9.Effect of electroacupuncture on lipophagy in hepatocytes in a hyperlipidemia rat model
Manqi LIU ; Lang QIN ; Xinyao SUN ; Shirong XU ; Houyu TAO ; Chuan HE ; Xiaoli PAN ; Hongxing ZHANG
Journal of Beijing University of Traditional Chinese Medicine 2025;48(11):1608-1618
Objective To explore the mechanism of electroacupuncture in alleviating hyperlipidemia in a rat model by modulating mammalian target of rapamycin complex 1(mTORC1)-mediated lipophagy in hepatocytes.Methods A total of 30 SD rats were randomly divided into blank(n=6)and modeling groups(n=24)using the random number table method.A hyperlipidemic rat model was established by feeding rats a high-fat diet(feeding for 8 weeks).After successful modeling,the modeling group was randomly divided into the model,electroacupuncture,mTORC1 inhibitor,and electroacupuncture+mTORC1 agonist groups,with six rats in each group.Except for the blank group,all other rats were fed with high fat diet.Rats in the electroacupuncture and electroacupuncture+mTORC1 agonist groups received electroacupuncture intervention at bilateral"Fenglong"(ST40)acupoints(dilatational wave 2 Hz/100 Hz,current intensity 1 mA)for 30 min once daily.Rats in the mTORC1 inhibitor group received intraperitoneal injections of the mTORC1 inhibitor,rapamycin(2 mg/kg),once daily.Rats in the electroacupuncture+mTORC1 agonist group received intraperitoneal injections of the mTORC1 agonist MHY1485(10 mg/kg)once daily.The interventions were administered for five consecutive days per week for 4 weeks.Upon completion of the intervention,the following analyses were performed:serum contents of total cholesterol(TC),triglycerides(TAG),low-density lipoprotein cholesterol(LDL-C),high-density lipoprotein cholesterol(HDL-C),free fatty acids(FFA),alanine aminotransferase(ALT),and aspartate aminotransferase(AST)were measured using a fully automated biochemical analyzer.Hepatic histopathological changes and lipid deposition were observed using hematoxylin-eosin and oil red O staining.The liver condition was observed and the liver index was calculated.Hepatic TC and TAG levels were measured using an enzyme-linked immunosorbent assay.The ultrastructure of the liver tissue was observed using transmission electron microscopy,and the mean fluorescence intensity of perilipin 2(PLIN2)and microtubule-associated protein 1 light chain 3(LC3)-Ⅱ in the liver tissue was detected using immunofluorescence.Protein expression of LC3-Ⅱ/LC3-Ⅰ,phosphorylated mammalian target of rapamycin(p-mTOR)/mTOR,and mTORC1 in liver tissue was detected using Western blotting.Results Compared to the blank group,the model group rats showed increased serum TC,TAG,LDL-C,ALT,AST,and FFA levels,along with decreased HDL-C levels(P<0.05).The liver index and hepatic TC and TAG levels were also elevated(P<0.05).Histological examination of liver tissue revealed substantial lipid accumulation,numerous lipid droplets within hepatocytes,abnormal mitochondrial morphology,and scarce autophagic vacuole.The mean fluorescence intensity of PLIN2 increased,whereas that of LC3-Ⅱ decreased(P<0.05).Additionally,the LC3-Ⅱ/LC3-Ⅰ ratio was reduced,whereas the p-mTOR/mTOR ratio and mTORC1 protein expression were increased(P<0.05).Compared to the model group,rats in the mTORC1 inhibitor and electroacupuncture groups exhibited decreased serum TC,TAG,LDL-C,ALT,AST,and FFA levels(P<0.05),along with a reduced liver index and hepatic TC and TAG levels(P<0.05).Histological examination showed markedly attenuated lipid accumulation and visible autophagic vacuole in the hepatocytes.The mean fluorescence intensity of PLIN2 decreased,whereas that of LC3-Ⅱ increased(P<0.05).Moreover,the LC3-Ⅱ/LC3-Ⅰ ratio increased,whereas the p-mTOR/mTOR ratio and mTORC1 protein expression decreased(P<0.05).In comparison with both the electroacupuncture and mTORC1 inhibitor groups,the electroacupuncture+mTORC1 agonist group demonstrated increased serum TAG,TC,LDL-C,ALT,AST,and FFA levels(P<0.05)as well as elevated liver index and hepatic TC and TAG levels(P<0.05).Liver tissues exhibited aggravated lipid deposition and absence of autophagic vacuole in liver cells.The mean fluorescence intensity of PLIN2 was enhanced,whereas that of LC3-Ⅱ was reduced(P<0.05).Furthermore,the LC3-Ⅱ/LC3-Ⅰ ratio decreased,and the p-mTOR/mTOR ratio and mTORC1 protein expression increased(P<0.05).Conclusion Electroacupuncture at"Fenglong"(ST40)may improve blood lipid levels in hyperlipidemic rats by inhibiting mTORC1 and promoting hepatocyte lipophagy.
10.A meta-analysis of prevalent characteristics of injury-related behaviors among adolescents based on Chinese literature
Xiaodi BAI ; Yunlan JIANG ; Ting XU ; Siyu LIN ; Heyao XU ; Shulan LIU ; Xinyao ZHOU
Shanghai Journal of Preventive Medicine 2024;36(10):969-976
ObjectiveTo conduct a meta-analysis of the prevalent characteristics of the injury-related behaviors among adolescents in China based on Chinese literature, so as to inform the prevention and control of injury-related behaviors of this population. MethodsA cross-sectional study on the prevalent characteristics of adolescent injury-related behaviors was conducted with the data collected from CNKI, VIP, Wanfang Data, CBM, PubMed, and Web of Science. The review included publications from the inception of the databases to November 2023. Meta-analysis was performed with Stata 15.1 software. ResultsA total of 40 articles were included in this study, and the meta-analysis results showed that cycling violation rate was 38% (95%CI: 32%‒43%), walking violation rate was 29% (95%CI: 22%‒36%), rate of unsafe swimming was 13% (95%CI: 11%‒14%), suicidal ideation rate was 13% (95%CI: 12%‒15%) and the prevalence of fighting was 19% (95%CI: 17%‒22%). Subgroup analysis showed that the cycling violation rate was (44%) for boys and 34% (95%CI: 28%‒40%) for girls. Adolescents in Northeast, East, and Southwest of China had the highest rate of cycling violation (44%), of which junior high school students had the highest rate of violation [42% (95%CI: 36%‒49%)]. As for the walking violation rate, male students [29% (95%CI: 21%‒37%)] was higher than that of female students [22% (95%CI: 15%‒30%)]. Adolescents in North of China had the highest rate of walking violation [54% (95%CI: 30%‒76%)], of which vocational school students accounted for 38% (95%CI:21%‒56%) of the total violation. In terms of the detection rate of unsafe swimming, male students [18% (95%CI: 14%‒24%)] was higher than that of female students [8% (95%CI: 6%‒10%)]. Adolescents in Central South China had the highest rate of unsafe swimming [15% (95%CI: 12%‒18%)], of which, vocational school students accounted for the highest [15% (95%CI: 10%‒19%)]. When it comes to the prevalence of suicidal ideation, female students [16% (95%CI: 13%‒19%)] was higher than that of male students [13% (95%CI: 11%‒15%)]. Adolescents in Southwest of China had the highest rate of suicidal ideation [17% (95%CI: 10%‒25%)], of which high school students accounted for the highest [15% (95%CI: 12%‒18%)]. Finally, the detection rate of fights was 30% (95%CI: 26%‒34%) for boys and 11% (95%CI: 10%‒14%) for girls. Adolescents from Southwest of China had the highest rate [29% (95%CI: 24%‒34%)] for fights, and junior high school students accounted for the highest [26% (95%CI: 22%‒31%)]. ConclusionThe prevalence of harmful behaviors among adolescents in China is notably high, with statistical differences across gender, region, and school stages. These behaviors pose a risk to adolescent health, underscoring the need for targeted interventions by health and educational authorities.

Result Analysis
Print
Save
E-mail