1.Short-term outcomes of pocket endoscopic submucosal dissection and endoscopic mucosal resection in treatment of early colorectal cancer
Xinyao WU ; Zhili ZHAO ; Dandan JIANG ; Xiaoqi LONG ; Bin YANG
Journal of Navy Medicine 2025;46(4):383-386
Objective To compare the short-term outcomes and postoperative complications of endoscopic submucosal dissection(ESD)and endoscopic mucosal resection(EMR)in the treatment of early colorectal cancer.Methods A total of 110 patients with early colorectal cancer who were admitted to Suining Central Hospital from June 2020 to June 2022 were prospectively enrolled and randomly assigned to two groups by random number table.Of them,58 patients underwent ESD and 52 patients underwent EMR.Operation related indexes,inflammatory factors(interleukin-6[IL-6],tumor necrosis factor-α[TNF-α],and C-reactive protein[CRP])before operation and 3 days after operation,and postoperative quality of life index(QL-Index)were compared between the two groups.The complications of the two groups were observed.Results The operation time,hospital stay,postoperative exhaust time,defecation time,and intraoperative blood loss in ESD group were lower than those in EMR group,and the rates of complete resection and en bloc resection in ESD group were higher than those in EMR group(P<0.05).The levels of IL-6,TNF-α and CRP were increased 3 d after operation in both groups,but the levels of IL-6,TNF-α and CRP in ESD group were lower than those in EMR group(P<0.05).The total score of QL-Index and the scores of activity,daily activities,health,and overall situation in ESD group were significantly higher than those in EMR group(P<0.05).The incidence of complications in ESD group was higher than that in EMR group,without significant difference(P>0.05).Conclusion The pocket ESD can effectively promote postoperative rehabilitation,increase resection rate,reduce postoperative inflammation,and improve the quality of life of patients with early colorectal cancer,and there is no obvious complication.
2.Mining and analysis of adverse drug event signals related to macitentan
Zhenhu WU ; Xinyao CHEN ; Yaoxin CHEN ; Yinji XU
China Pharmacy 2024;35(13):1628-1633
OBJECTIVE To mine adverse drug event (ADE) signals related to the pulmonary arterial hypertension (PAH) therapeutic drug macitentan, and to provide reference for safe clinical medication. METHODS Macitentan-related ADE reports were collected from the US FDA Adverse Event Reporting System (FAERS) database from the fourth quarter of 2013 to the third quarter of 2023. Data mining was conducted by using the reporting odds ratio (ROR) method and the comprehensive standard method established by the UK Medicines and Healthcare Products Regulatory Agency (referred to as “MHRA method”) under the proportional imbalance approach. According to the systemic organ class (SOC) and preferred term (PT) stated in 26.0 edition of Medical Dictionary of Regulatory Activities, standardized coding of ADE names was performed, followed by the analysis of time to onset (TTO) and the Weibull shape parameter (WSP) test. RESULTS Overall, a total of 26 079 ADE reports were identified with macitentan as the primary suspect drug. These reports predominantly involved female patients (73.25%) and were concentrated in the age range of 18 to 65 years (42.39%). The majority of reports originated from the US (84.42%), with hospitalization or prolonged hospital stays (59.82%) being the most common in severe treatment outcome. A total of 269 ADE positive signals related to macitentan were identified. Among these, hypothyroidism, ADE related to renal injury such as the increase of serum creatinine and blood urea nitrogen, and ADE related to psychiatric disorders like apathy and despair were not included in the drug label. TTO analysis indicated that the majority of macitentan-related ADE signals occurred between 0-30 days after initial treatment (492 reports, 21.52%) and over 360 days (411 reports, 17.98%). The results of WSP test showed that most of the top 20 reported ADE signals conformed to the characteristics of an early failure curve. CONCLUSIONS When clinically using macitentan in patients with PAH, attention should be given not only to the adverse reactions mentioned on the drug label but also to thyroid dysfunction, kidney dysfunction and mental disorder-related ADEs.
3.Methodological Evaluation of Advantages of Traditional Chinese Medicine Treatment of Sjögren's Syndrome
Wenjing LIU ; Shiya WU ; Ruihua LIU ; Xinyao ZHOU ; Juan JIAO ; Ying LIU ; Zeguang LI ; Zhenbin LI ; Huadong ZHANG ; Xiaopo TANG ; Quan JIANG
Chinese Journal of Experimental Traditional Medical Formulae 2024;30(1):192-197
Screening and evaluating the diseases responding specifically to traditional Chinese medicine (TCM) will help to highlight the advantages of TCM treatment, and the evaluation method should be standardized with consideration to the unique characteristics of the diseases. The incidence of Sjögren's Syndrome (SS) is increasing year by year, while the pathogenesis of this disease remains unclear. Modern therapies for this disease include biological agents and immunosuppressants, which generally have unsatisfactory efficacy. The TCM treatment of SS focuses on the harmony of the physical and mental health. The Rheumatology Branch of the China Association of Chinese Medicine organizes experts in TCM, Western medicine, and evidence-based medicine to form working groups. Delphi method and bibliometric method were used for analysis, and SS was selected as a disease responding specifically to TCM. Furthermore, the evaluation system was established for this disease, and the consensus regarding this disease was reached after seminar discussion. This paper summarized the whole process of the evaluation of the advantages of TCM treatment of SS. First, because TCM atomization is widely used in clinical practice and enriches TCM administration methods, this therapy is included after other non-drug therapies were taken as characteristic therapies. Second, the evaluation indicators of therapeutic effect should be determined with consideration to international acceptance and the current research status. Third, the expression method should be accurate, standardized, and objective, highlight the natural advantages of TCM, and avoid arbitrary extension. This paper provides a reference for clinicians to explore other diseases responding specifically to TCM.
4.Protective effect of Xuebijing injection on sepsis-associated acute respiratory distress syndrome by suppressing the HIF-1α/p38 MAPK/NF-κB signaling pathway
Weichao DING ; Juan CHEN ; Xiaohang JI ; Yi REN ; Wei ZHANG ; Mengmeng WANG ; Jing FENG ; Xinyao WU ; Jiankang MENG ; Shinan NIE ; Zhaorui SUN
Chinese Journal of Emergency Medicine 2024;33(8):1140-1150
Objective:To explore the protective mechanism of Xuebijing injection (referred to as Xuebijing) on sepsis-associated acute respiratory distress syndrome (ARDS).Methods:① Animal experiments: 100 mice were randomly(random number) divided into 4 groups, including sham operation (Sham) group, cecal ligation and puncture (CLP) group, CLP+low-dose Xuebijing (L-XBJ) group, and CLP+high-dose Xuebijing (H-XBJ) group. The survival rate, lung histological changes, lung wet/dry (W/D) ratio, cell count and protein concentration in bronchoalveolar lavage fluids (BALF), inflammatory factors levels in serum, oxidative stress indicators, cell apoptosis, and key proteins of HIF-1α/p38 MAPK/NF-κB signaling pathway were measured. ② Cell experiments: Mouse alveolar macrophages (MH-S) were cultured in vitro and divided into 6 groups, including control (Con) group, lipopolysaccharide (LPS) group, LPS+L-XBJ group, and LPS+H-XBJ group, LPS+H-XBJ+ dimethyloxallyl glycine (DMOG, HIF-1α activator) group, LPS+H-XBJ+ 2-methoxyestradiol (2ME2, HIF-1α inhibitor) group. The effects of Xuebijing on inflammatory factors, oxidative stress, and cell apoptosis and their relationship with HIF-1α/p38 MAPK/NF-κB signaling pathway were detected.Results:Xuebijing increased the survival rate of mice with sepsis-associated ARDS, relieved lung tissue damage [lung injury score: CLP group (8.778±0.588), CLP+L-XBJ group (5.833±0.310), and CLP+H-XBJ group (4.750±0.246)], alleviated lung W/D ratio, and decreased pneumonia cell infiltration and protein exudation (all P<0.05). Additionally, Xuebijing treatment also diminished the expression of inflammatory factors (TNF-α, IL-1β, and IL-6), intracellular reactive oxygen species (ROS) accumulation, malondialdehyde (MDA) formation, superoxide dismutase (SOD) depletion, and cell apoptosis in LPS-induced MH-S cells and CLP-induced sepsis-associated ARDS mice (all P<0.05). Furthermore, mechanistic investigation further clarified the effects of Xuebijing on inflammation, oxidative stress, and cell apoptosis through the HIF-1α/p38 MAPK/NF-κB signaling pathway. Conclusions:Xuebijing can exert anti-inflammatory, anti-oxidative, and anti-apoptotic effects by suppressing the HIF-1α/p38 MAPK/NF-κB signaling pathway, thereby conferring protection against sepsis-associated ARDS.
5.The application value of SWE in early hepatic fibrosis and renal fibrosis in MAFLD
Mengmeng QIAN ; Xiaochen GUO ; Pengfei WANG ; Xiu CHEN ; Xinyao WU ; Chunpeng ZOU ; Maosheng XU
China Modern Doctor 2024;62(33):23-27
Objective To explore the value of shear wave elastography(SWE)in the early assessment of hepatic and renal fibrosis in patients with metabolic associated fatty liver disease(MAFLD).Methods A total of 52 MAFLD patients admitted to the Second Affiliated Hospital of Wenzhou Medical University from July 2023 to May 2024 were selected as MAFLD group,and 40 non-MAFLD patients treated during the same period were served as control group.General information,laboratory data and ultrasound data were collected and compared between two groups.The differences as well as the correlation of the indicators between two groups were compared.The value of SWE in hepatic fibrosis and renal fibrosis in MAFLD patients was assessed.Results Liver function indicators,uric acid and aspartate aminotransferase-to-platelet ratio index(APRI)in MAFLD group were higher than those in control group(P<0.01);There were no statistically significant differences between two groups in fibrosis 4 index,estimated glomerular filtration rate,serum creatinine and blood urea nitrogen(P>0.05).The brightness of the liver,liver-kidney ratio,and liver elasticity value were higher in MAFLD group than those in control group(P<0.05);There was no significant difference in the elasticity value of the right renal cortex between two groups(P>0.05).Liver elasticity values was positively correlated with alanine aminotransferase(ALT);The liver-kidney ratio was positively correlated with body mass index(BMI),ALT,aspartate aminotransferase,alkaline phosphatase,y-glutamyl transferase and APRI.No significant correlation was found between the right renal cortex elasticity and BMI,estimated glomerular filtration rate,serum creatinine,blood urea nitrogen,or serum uric acid.Conclusion SWE helps in early identification of liver hardness in the MAFLD patients.But the application of SWE in early renal fibrosis in the MAFLD patients needs further evaluation.
6.Differentially expressed genes of ulcerative colitis and associated microRNAs based on bioinformatics analysis
Shengnan WU ; Huanyu JIANG ; Haoran CHEN ; Xinyao WANG ; Jiahui WU ; Luqi WANG
Journal of Clinical Medicine in Practice 2024;28(1):48-55
Objective To analyze differentially expressed genes and potential microRNA (miRNAs) with diagnostic and therapeutic potential in ulcerative colitis (UC) based on bioinformatics. Methods The chip raw data in GEO database was screened by weighted gene coexpression network analysis. UC related differentially expressed genes were obtained for enrichment analysis. Potential miRNAs associated with differentially expressed genes were predicted based on key genes, and gene-miRNA regulatory networks were constructed. Results A total of 277 differentially expressed genes were screened, of which 200 genes were up-regulated and 77 genes were down-regulated. Gene set enrichment analysis (GSEA) showed that the main enrichment pathways were neuroactive ligand-receptor interaction, leishmania infection, prion disease and electrocardiogram receptor interaction. The results of gene ontology (GO) analysis showed that it was mainly involved in chemokine activity, heparin binding as well as chemokine receptor binding and other items. The Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis showed that the main enrichment pathways were cytokine receptor interaction pathway, phosphatidylinositol-3 kinase/protein kinase B(PI3K-AKT) signaling pathway, chemokine signaling pathway as well as nuclear transcription factor kappa B(NF-κB) signaling pathway and other pathway. A total of 10 hub genes were screened: C-X-C chemokine ligand 8 (
7.Exploration of compatibility rules of traditional Chinese medicine and prediction of combination medication for acute rhinopharyngitis based on weighted projection of bipartite networks
Shengnan WU ; Luqi WANG ; Xinyao WANG ; Jiahui WU ; Huanyu JIANG
Journal of Clinical Medicine in Practice 2024;28(14):30-37
Objective To propose a new method for mining compatibility rules of traditional Chinese medicine (TCM) formulation from the perspective of weighted projection of bipartite networks, and to predict the combination of new drugs to provide a basis for guiding the clinical treatment of acute nasopharyngitis. Methods Using the acute nasopharyngitis prescription data in the Traditional Chinese Medicine Integrated Database (TCMID) as the data source, a bipartite network is constructed by extracting the prescription and drug nodes.A drug network projection map was then obtained using weighted projection.Social network analysis was performed combined with weighted projection of bipartite networks, and compatibility rules of "Jun-Chen-Zuo-Shi" in TCM via hierachical cluster analysis based on Pearson correlation.Besides, link prediction was used for core drug prediction. Results The combination of bipartite network weighted projection and Pearson correlation for systematic clustering analysis played a significant role in the study of the compatibility rules of TCM prescriptions.In link prediction, 11 link prediction indicators were selected, and weighted and unweighted algorithms were distinguished.The final calculation showed that the area under the curve (AUC) of the weighted indicators were generally higher than that of the unweighted network.Among the weighted indicators, the indicator with the highest AUC index was the network resource allocation Index.A total of 7 groups of drug combinations were predicted, including Baitouweng-Maokezi, Anxixiang-Shijiaocao, Baihuacha-Fuzi, etc. Conclusion The bipartite network weighted projection method is practical and effective in revealing the compatibility rules of TCM and predicting drug combination.
8.Preliminary study on the clinical application of four cytokines in serum of autoimmune diseases
Wei LI ; Ziyan WU ; Leili MAO ; Xinyao ZHANG ; Songxin YAN ; Honglin XU ; Futai FENG ; Shulan ZHANG ; Yongzhe LI
Chinese Journal of Laboratory Medicine 2023;46(11):1173-1179
Objectives:the purpose of this study was to systematically evaluate the clinical value of cytokines in autoimmune diseases (AID). It was a kind of complex disease, and its pathogenesis involved cytokines, autoantibodies, immune cells and other immune factors. Especially some AID, such as Adult still′s disease (AOSD) and Takayasu arteritis(TA), had no specific biomarkers at present. This study was a retrospective case-control study.Methods:the data of tumor necrosis factor-α (TNF-α), interleukin-6 (IL-6), interleukin-8(IL-8) and interleukin-10(IL-10) in 834 AID patients from January 2019 to August 2022 were collected, and the serum levels of those cytokines in 30 healthy controls (HC) were detected at the same time. And AOSD, TA, systemic lupus erythematosus (SLE) and Behcet′s syndrome (BS) were divided into active group and inactive group. In addition, we also made a subgroup analysis of two important organs involved in SLE (kidney and nervous system). GraphPad Prism 9 and R 4.2.2 software were used. Nonparametric tests (Kruskal-Wallis H test, Mann-Whitney U test) were used to compare the differences among groups, and Dunn′s method was used to correct the false positive caused by multiple tests. Results:To compare the level of IL-6 in each group, except Behcet syndrome (BS) group and antiphospholipid syndrome (APS) group, the serum IL-6 level of AID group was higher than that of HC group, with antineutrophil cytoplasmic antibodies associated vasculitis(AAV) [3.85(2.00,8.55) pg/ml], idiopathic inflammatory myopathies(IIM) [7.80(2.50,6.50)pg/ml], IgG4-related disease(IgG4RD) [3.65(2.08,12.83) pg/ml], rheumatoid arthritis (RA) [5.50(2.20,16.10) pg/ml], SLE[4.70(2.75,16.55) pg/ml], Sj?gren syndrome(SS) [3.20(2.00,8.90) pg/ml], systemic sclerosis(SSc) [2.70(2.00,8.90) pg/ml], TA[3.40 (2.00,6.50) pg/ml], other AID diseases[4.40(2.00,11.10) pg/ml], especially AOSD [15.20(2.10, 39.20) pg/ml]. After correction, the differences were statistically significant ( P c<0.05). At the same time, the levels of serum TNF-α [7.40(5.60,10.95) pg/ml]and IL-10 [5.00(5.00, 7.58) pg/ml] in AOSD group were significantly higher than those in HC group[7.15(5.93,8.00) pg/ml,5.00(5.00,5.00) pg/ml] after correction ( P c<0.05). At the same time, the levels of serum TNF-α and IL-10 in AOSD group were higher than those in HC group. The serum levels of IL-6 and IL-8 in patients with active AOSD, BS, SLE and TA were significantly higher than those in patients without active disease (all P<0.05). In addition, the level of serum IL-8 in lupus nephritis group was significantly higher than that in non-lupus nephritis group ( P<0.05). At the same time, the serum levels of IL-6, IL-8 and TNF-α in neuropsychiatric lupus erythematosus group were significantly higher than those in non-neuropsychiatric lupus erythematosus group ( P<0.05), but there was no significant difference in IL-10 between neuropsychiatric lupus group and non-neuropsychiatric lupus erythematosus group. Conclusions:there was a close relationship between AID and cytokines. At present, the change of serum IL-6 level was the most classic one in clinical routine.
9.Akinesia deformation sequence in a fetus suspected by prenatal ultrasound and confirmed after mid-term termination
Xinyao LUO ; Qiuyang GU ; Xinxiu LIU ; Jianhua LI ; Liyan HUANG ; Xiaohua HUANG ; Shengnan WU ; Jingping YANG ; Meihua TAN
Chinese Journal of Perinatal Medicine 2022;25(3):218-221
We report a case of fetal akinesia deformation sequence (FADS), which was prenatally suspected on ultrasound and confirmed by whole exome sequencing and Sanger sequencing after mid-term termination. Prenatal ultrasonography revealed multiple abnormalities in a fetus at 21 +4 weeks of gestation, consisting of fixed posture of limbs, narrow thorax, markedly shrunken gastric vacuole, and thickened nuchal fold. After genetic counseling, the pregnancy was terminated, and the appearance of the fetus was consistent with the ultrasound findings. Whole exome sequencing and Sanger sequencing of the fetal tissue verified a compound heterozygous variation of the RAPSN gene--c.149_153delins AGATGGGCCGCTACAAGGAGATGG (p.V50Efs*114) and c.227T>C (p.L76P), which were inherited from the father and mother, respectively, ultimately confirming the diagnosis of FADS.
10.The progress on post-exposure prophylaxis of tetanus immunological preparation in adults
Juan DU ; Zhongsong ZHANG ; Xinyao LIAN ; Xuezeng WANG ; Mingzhu XIE ; Tianshuo ZHAO ; Qingbin LU ; Jiang WU
Chinese Journal of Preventive Medicine 2022;56(7):1004-1010
The tetanus has been eliminated in the pregnancy women and newborns in China. However, there is a gap for adult tetanus immunization, and the risk of tetanus infection cannot be ignored. In order to clearly understand the effect of the tetanus to human beings and the current use of tetanus immunological preparation for adult post-exposure prophylaxis, the incidence of the tetanus, the use status of tetanus immunological preparation and recommendations for post-exposure prophylaxis at home and abroad were reviewed and summarized, which may provide academic evidence for post-exposure prophylaxis procedures and use of tetanus immunological preparation.


Result Analysis
Print
Save
E-mail