According to the Qi-blood-body fluid theory and the association between the spleen in visceral manifestation theory of traditional Chinese medicine （TCM） and mitochondria in modern cellular biology， it is proposed that the role of the spleen in generating and transforming Qi and blood is analogous to the energy-producing function of mitochondria—both serving as fundamental power sources for vital activities of the human body. The spleen governs transportation and transformation， playing a critical role in energy metabolism and the digestion and absorption of nutrients. Similarly， mitochondria are vital for maintaining physiological functions such as cellular energy supply， cell survival， and overall human metabolism. Furthermore， spleen deficiency is closely linked to mitochondrial dysfunction. Accordingly， mitochondrial energy conversion and substance metabolism are regarded as the microscopic essence of the spleen's function in transportation and transformation. Spleen deficiency and mitochondrial dysfunction contribute to the formation of pathological products such as phlegm-turbidity and blood stasis. This aligns with the pathogenesis of chronic obstructive pulmonary disease （COPD）， with Qi deficiency as the root cause and phlegm-turbidity and blood stasis as the manifestations. Therefore， the integrative treatment of COPD should follow the therapeutic principle of invigorating the spleen and reinforcing healthy Qi， while also resolving phlegm and removing blood stasis to address both root cause and manifestations. This approach can improve the mitochondrial function， regulate energy metabolism， and reduce oxidative stress levels to alleviate COPD symptoms， slow down disease progression， and improve prognosis. By integrating the holistic concept of TCM with molecular mechanisms of modern medicine， this paper explores the pathogenesis and therapeutic principles of COPD from the spleen-mitochondria correlation. It not only provides a new direction for the modern development of TCM and the integration of Chinese and Western medicine but also offers a theoretical foundation for the integrated treatment of chronic， complex age-related diseases.

According to the Qi-blood-body fluid theory and the association between the spleen in visceral manifestation theory of traditional Chinese medicine （TCM） and mitochondria in modern cellular biology， it is proposed that the role of the spleen in generating and transforming Qi and blood is analogous to the energy-producing function of mitochondria—both serving as fundamental power sources for vital activities of the human body. The spleen governs transportation and transformation， playing a critical role in energy metabolism and the digestion and absorption of nutrients. Similarly， mitochondria are vital for maintaining physiological functions such as cellular energy supply， cell survival， and overall human metabolism. Furthermore， spleen deficiency is closely linked to mitochondrial dysfunction. Accordingly， mitochondrial energy conversion and substance metabolism are regarded as the microscopic essence of the spleen's function in transportation and transformation. Spleen deficiency and mitochondrial dysfunction contribute to the formation of pathological products such as phlegm-turbidity and blood stasis. This aligns with the pathogenesis of chronic obstructive pulmonary disease （COPD）， with Qi deficiency as the root cause and phlegm-turbidity and blood stasis as the manifestations. Therefore， the integrative treatment of COPD should follow the therapeutic principle of invigorating the spleen and reinforcing healthy Qi， while also resolving phlegm and removing blood stasis to address both root cause and manifestations. This approach can improve the mitochondrial function， regulate energy metabolism， and reduce oxidative stress levels to alleviate COPD symptoms， slow down disease progression， and improve prognosis. By integrating the holistic concept of TCM with molecular mechanisms of modern medicine， this paper explores the pathogenesis and therapeutic principles of COPD from the spleen-mitochondria correlation. It not only provides a new direction for the modern development of TCM and the integration of Chinese and Western medicine but also offers a theoretical foundation for the integrated treatment of chronic， complex age-related diseases.

To address the problem of data silos in dental specialties caused by equipment heterogeneity, this study developed an Intelligent Internet of Things (IoT)-enabled dental chair platform (hereinafter referred to as the intelligent platform) based on the concept of medical-engineering integration. The platform adopts a three-tier chair-domain interconnection architecture: the bottom tier integrates multi-source sensors and standardized interfaces for automated data acquisition and linkage with hospital information systems; the middle tier provides clinic-level management and remote teaching collaboration; and the top tier employs a blockchain-based secure cloud database for resource allocation and data management. Clinical validation at The Affiliated Stomatological Hospital of Nanjing Medical University demonstrated that, compared with a control group from the same period in 2023, the trial group achieved a 38.0% increase in average daily patient visits (80.6±6.8 vs. 58.4±5.2, t=15.16, P<0.001), a 24.6% reduction in average treatment time [(36.1±6.3) min vs. (47.9±8.5) min, t=7.72, P<0.001], a 39.2% reduction in waiting time [23.3 (16.5, 30.1) min vs. 38.3 (28.3, 48.3) min, U=32.00, P<0.001], a 30.4% reduction in equipment idle rate [8.7% (5.1%, 12.3%) vs. 12.5% (7.4%, 17.6%), U=251.00, P=0.003], and an increase in patient satisfaction from 88.2% (1 519/1 723) to 94.3% (2 186/2 318) ( t=7.26, P<0.001). User research confirmed that the functions most favored by clinicians and patients were "dental chair parameter updating and clinical data integration" [74.7% (80/107)] and "chairside display of diagnostic images" [76.8% (119/155)], respectively. Looking forward, the intelligent platform has the potential to integrate artificial intelligence-assisted diagnosis and 5G-enabled multicenter collaboration to further expand its clinical applications and accelerate the digital transformation of dental healthcare.

Tuberculosis (TB) is still a major public health issue today. A novel TB vaccine is a key approach to reaching the targets of WHO's End-TB Strategy. In recent years, significant progress has been made in the research and development of TB vaccines both in China and abroad. A breakthrough has been made in both application scenarios and technological routes, and several vaccine candidates have entered phase Ⅲ clinical trials. This review summarizes information from clinical trials involving key TB vaccine candidates under development in China and abroad. It highlights six candidates that are most promising for marketing or inspiring future research and development, analyzes the current difficulties in the research and development of novel TB vaccines, and provides an outlook for the future.

Objective:To analyze the association between moderate-to-vigorous-physical activity (MVPA) and obesity, poor sleep quality, as well as multimorbidity in 7- to 8-year-old children in Shanghai City.Methods:From September to November 2023, a cluster sampling method was used to select second-grade students from four primary schools in Jinshan District, Shanghai. Three-axis acceleration motion sensors (GT3X+, Acti-graph) were used to monitor daily physical activity for seven consecutive days. A multivariate logistic regression model was used to analyze the association between MVPA duration characteristics and obesity, poor sleep quality and multimorbidity in school-age children.Results:Of the 937 study participants, 512 (54.64%) were boys and 425 (45.36%) were girls. Among them, 89 (9.50%) were obese and 782 (83.46%) had poor sleep quality. A total of 77 cases (8.22%) were affected by obesity and poor sleep quality. The average daily MVPA time was (45.97±15.87) minutes, and the MVPA attainment rate was 17.18%. The multivariate logistic regression model analysis showed that, after adjusting for covariates, the daily average MVPA time was negatively associated with the risk of obesity ( OR=0.982, 95% CI: 0.968-0.997), as well as multimorbidity ( OR=0.981, 95% CI: 0.965-0.997). The risk of obesity, poor sleep quality and multimorbidity in <1 d was 2.228 ( OR=2.228, 95% CI: 1.398-3.549), 1.702 ( OR=1.702, 95% CI: 1.141-2.540) and 2.150 ( OR=2.150, 95% CI: 1.310-3.528) times higher than that in ≥1 d. Conclusion:Obesity, poor sleep quality and multimorbidity of school-age children are closely related to the level of moderate-to-vigorous physical activity.

Objective To explore the mechanism of electroacupuncture in alleviating hyperlipidemia in a rat model by modulating mammalian target of rapamycin complex 1(mTORC1)-mediated lipophagy in hepatocytes.Methods A total of 30 SD rats were randomly divided into blank(n=6)and modeling groups(n=24)using the random number table method.A hyperlipidemic rat model was established by feeding rats a high-fat diet(feeding for 8 weeks).After successful modeling,the modeling group was randomly divided into the model,electroacupuncture,mTORC1 inhibitor,and electroacupuncture+mTORC1 agonist groups,with six rats in each group.Except for the blank group,all other rats were fed with high fat diet.Rats in the electroacupuncture and electroacupuncture+mTORC1 agonist groups received electroacupuncture intervention at bilateral"Fenglong"(ST40)acupoints(dilatational wave 2 Hz/100 Hz,current intensity 1 mA)for 30 min once daily.Rats in the mTORC1 inhibitor group received intraperitoneal injections of the mTORC1 inhibitor,rapamycin(2 mg/kg),once daily.Rats in the electroacupuncture+mTORC1 agonist group received intraperitoneal injections of the mTORC1 agonist MHY1485(10 mg/kg)once daily.The interventions were administered for five consecutive days per week for 4 weeks.Upon completion of the intervention,the following analyses were performed:serum contents of total cholesterol(TC),triglycerides(TAG),low-density lipoprotein cholesterol(LDL-C),high-density lipoprotein cholesterol(HDL-C),free fatty acids(FFA),alanine aminotransferase(ALT),and aspartate aminotransferase(AST)were measured using a fully automated biochemical analyzer.Hepatic histopathological changes and lipid deposition were observed using hematoxylin-eosin and oil red O staining.The liver condition was observed and the liver index was calculated.Hepatic TC and TAG levels were measured using an enzyme-linked immunosorbent assay.The ultrastructure of the liver tissue was observed using transmission electron microscopy,and the mean fluorescence intensity of perilipin 2(PLIN2)and microtubule-associated protein 1 light chain 3(LC3)-Ⅱ in the liver tissue was detected using immunofluorescence.Protein expression of LC3-Ⅱ/LC3-Ⅰ,phosphorylated mammalian target of rapamycin(p-mTOR)/mTOR,and mTORC1 in liver tissue was detected using Western blotting.Results Compared to the blank group,the model group rats showed increased serum TC,TAG,LDL-C,ALT,AST,and FFA levels,along with decreased HDL-C levels(P<0.05).The liver index and hepatic TC and TAG levels were also elevated(P<0.05).Histological examination of liver tissue revealed substantial lipid accumulation,numerous lipid droplets within hepatocytes,abnormal mitochondrial morphology,and scarce autophagic vacuole.The mean fluorescence intensity of PLIN2 increased,whereas that of LC3-Ⅱ decreased(P<0.05).Additionally,the LC3-Ⅱ/LC3-Ⅰ ratio was reduced,whereas the p-mTOR/mTOR ratio and mTORC1 protein expression were increased(P<0.05).Compared to the model group,rats in the mTORC1 inhibitor and electroacupuncture groups exhibited decreased serum TC,TAG,LDL-C,ALT,AST,and FFA levels(P<0.05),along with a reduced liver index and hepatic TC and TAG levels(P<0.05).Histological examination showed markedly attenuated lipid accumulation and visible autophagic vacuole in the hepatocytes.The mean fluorescence intensity of PLIN2 decreased,whereas that of LC3-Ⅱ increased(P<0.05).Moreover,the LC3-Ⅱ/LC3-Ⅰ ratio increased,whereas the p-mTOR/mTOR ratio and mTORC1 protein expression decreased(P<0.05).In comparison with both the electroacupuncture and mTORC1 inhibitor groups,the electroacupuncture+mTORC1 agonist group demonstrated increased serum TAG,TC,LDL-C,ALT,AST,and FFA levels(P<0.05)as well as elevated liver index and hepatic TC and TAG levels(P<0.05).Liver tissues exhibited aggravated lipid deposition and absence of autophagic vacuole in liver cells.The mean fluorescence intensity of PLIN2 was enhanced,whereas that of LC3-Ⅱ was reduced(P<0.05).Furthermore,the LC3-Ⅱ/LC3-Ⅰ ratio decreased,and the p-mTOR/mTOR ratio and mTORC1 protein expression increased(P<0.05).Conclusion Electroacupuncture at"Fenglong"(ST40)may improve blood lipid levels in hyperlipidemic rats by inhibiting mTORC1 and promoting hepatocyte lipophagy.

Using Real-time PCR technology, a highly specific and sensitive method for detecting DNA residues of Escherichia coli host cells in levodopa was established, validated, and preliminarily applied. Escherichia coli strain MB6 16S ribosomal RNA gene was selected as the target gene to design multiple pairs of primers and the target fragment by specific amplification of PCR was obtained. The target fragment was cloned into the pLENTI-BSD-CON vector and the recombinant plasmid was constructed and named pLENTI-BSD-CON-E.coli-16S. A quantitative PCR detection method (SYBR Green method) with magnetic bead extraction and purification methods was established with the reference standard of the recombinant plasmid. Furthermore, the established method was validated, including linear and range, accuracy, precision, specificity, and quantification limit, and applied to the detection of levodopa raw materials. Meanwhile, the detection method was compared with the Taqman probe method by the commercial kit. The primer sequences of the quantitative PCR detection method (SYBR Green method) were TTCGATGCAACGCGAAGAAC (forward) and GTGTAGCCCTGGTCGTAAGG (reverse). The standard curve of DNA was in the range of 10 fg/μL to 3 ng/μL with good linearity (R2≥ 0.98). The quantitative limit was 10 fg/μL. In addition, the detection recovery rate was in the range of 59.7% to 80.7%, with RSD at less than 15%. Nine batches of levodopa were detected by this method, and the amount of E.coli DNA residue was below the limit. The developed qPCR method can be used for quantitative detection of residual DNA in biological products produced by E.coli as host cells, such as levodopa . The results indicate that the sensitivity of the detection method for recombinant plasmid construction standards is superior than the reagent kit detection method.

Trophoblast cell surface antigen 2 (Trop2) is a transmembrane glycoprotein. It promotes development and coordinates intracellular calcium signal transduction in healthy tissues, but is overexpressed in a variety of solid malignant tumors (such as gastrointestinal tumors, ovarian cancer, prostate cancer, and breast cancer). Moreover, it is closely associated with poor tumor prognosis and metastasis risk. As a powerful tool, molecular imaging technology can directly characterize and quantify the molecular metabolic changes after the combination of probes and targets through imaging technology at the in vivo level. It has become a key technology for Trop2 research and plays an important role in specific diagnosis, tumor staging, and therapeutic effect monitoring. A variety of Trop2-targeted molecular probes based on monoclonal antibodies, antibody-drug conjugates, and antibody fragments have been used in preclinical and clinical studies of various solid tumors. This article reviews the latest progress of Trop2-related research in the field of tumor molecular imaging technology.

To address the problem of data silos in dental specialties caused by equipment heterogeneity, this study developed an Intelligent Internet of Things (IoT)-enabled dental chair platform (hereinafter referred to as the intelligent platform) based on the concept of medical-engineering integration. The platform adopts a three-tier chair-domain interconnection architecture: the bottom tier integrates multi-source sensors and standardized interfaces for automated data acquisition and linkage with hospital information systems; the middle tier provides clinic-level management and remote teaching collaboration; and the top tier employs a blockchain-based secure cloud database for resource allocation and data management. Clinical validation at The Affiliated Stomatological Hospital of Nanjing Medical University demonstrated that, compared with a control group from the same period in 2023, the trial group achieved a 38.0% increase in average daily patient visits (80.6±6.8 vs. 58.4±5.2, t=15.16, P<0.001), a 24.6% reduction in average treatment time [(36.1±6.3) min vs. (47.9±8.5) min, t=7.72, P<0.001], a 39.2% reduction in waiting time [23.3 (16.5, 30.1) min vs. 38.3 (28.3, 48.3) min, U=32.00, P<0.001], a 30.4% reduction in equipment idle rate [8.7% (5.1%, 12.3%) vs. 12.5% (7.4%, 17.6%), U=251.00, P=0.003], and an increase in patient satisfaction from 88.2% (1 519/1 723) to 94.3% (2 186/2 318) ( t=7.26, P<0.001). User research confirmed that the functions most favored by clinicians and patients were "dental chair parameter updating and clinical data integration" [74.7% (80/107)] and "chairside display of diagnostic images" [76.8% (119/155)], respectively. Looking forward, the intelligent platform has the potential to integrate artificial intelligence-assisted diagnosis and 5G-enabled multicenter collaboration to further expand its clinical applications and accelerate the digital transformation of dental healthcare.

Tuberculosis (TB) is still a major public health issue today. A novel TB vaccine is a key approach to reaching the targets of WHO's End-TB Strategy. In recent years, significant progress has been made in the research and development of TB vaccines both in China and abroad. A breakthrough has been made in both application scenarios and technological routes, and several vaccine candidates have entered phase Ⅲ clinical trials. This review summarizes information from clinical trials involving key TB vaccine candidates under development in China and abroad. It highlights six candidates that are most promising for marketing or inspiring future research and development, analyzes the current difficulties in the research and development of novel TB vaccines, and provides an outlook for the future.