1.Exploring Pathogenesis and Treatment Principles of Chronic Obstructive Pulmonary Disease Based on Spleen-mitochondria Correlation
Shiyi WANG ; Miao YU ; Xinyao HE ; Zi WANG ; Haijun LUAN ; Yibo SUN ; Haotong WANG ; Linlin WANG ; Lijian PANG
Chinese Journal of Experimental Traditional Medical Formulae 2026;32(3):258-264
According to the Qi-blood-body fluid theory and the association between the spleen in visceral manifestation theory of traditional Chinese medicine (TCM) and mitochondria in modern cellular biology, it is proposed that the role of the spleen in generating and transforming Qi and blood is analogous to the energy-producing function of mitochondria—both serving as fundamental power sources for vital activities of the human body. The spleen governs transportation and transformation, playing a critical role in energy metabolism and the digestion and absorption of nutrients. Similarly, mitochondria are vital for maintaining physiological functions such as cellular energy supply, cell survival, and overall human metabolism. Furthermore, spleen deficiency is closely linked to mitochondrial dysfunction. Accordingly, mitochondrial energy conversion and substance metabolism are regarded as the microscopic essence of the spleen's function in transportation and transformation. Spleen deficiency and mitochondrial dysfunction contribute to the formation of pathological products such as phlegm-turbidity and blood stasis. This aligns with the pathogenesis of chronic obstructive pulmonary disease (COPD), with Qi deficiency as the root cause and phlegm-turbidity and blood stasis as the manifestations. Therefore, the integrative treatment of COPD should follow the therapeutic principle of invigorating the spleen and reinforcing healthy Qi, while also resolving phlegm and removing blood stasis to address both root cause and manifestations. This approach can improve the mitochondrial function, regulate energy metabolism, and reduce oxidative stress levels to alleviate COPD symptoms, slow down disease progression, and improve prognosis. By integrating the holistic concept of TCM with molecular mechanisms of modern medicine, this paper explores the pathogenesis and therapeutic principles of COPD from the spleen-mitochondria correlation. It not only provides a new direction for the modern development of TCM and the integration of Chinese and Western medicine but also offers a theoretical foundation for the integrated treatment of chronic, complex age-related diseases.
2.Exploring Pathogenesis and Treatment Principles of Chronic Obstructive Pulmonary Disease Based on Spleen-mitochondria Correlation
Shiyi WANG ; Miao YU ; Xinyao HE ; Zi WANG ; Haijun LUAN ; Yibo SUN ; Haotong WANG ; Linlin WANG ; Lijian PANG
Chinese Journal of Experimental Traditional Medical Formulae 2026;32(3):258-264
According to the Qi-blood-body fluid theory and the association between the spleen in visceral manifestation theory of traditional Chinese medicine (TCM) and mitochondria in modern cellular biology, it is proposed that the role of the spleen in generating and transforming Qi and blood is analogous to the energy-producing function of mitochondria—both serving as fundamental power sources for vital activities of the human body. The spleen governs transportation and transformation, playing a critical role in energy metabolism and the digestion and absorption of nutrients. Similarly, mitochondria are vital for maintaining physiological functions such as cellular energy supply, cell survival, and overall human metabolism. Furthermore, spleen deficiency is closely linked to mitochondrial dysfunction. Accordingly, mitochondrial energy conversion and substance metabolism are regarded as the microscopic essence of the spleen's function in transportation and transformation. Spleen deficiency and mitochondrial dysfunction contribute to the formation of pathological products such as phlegm-turbidity and blood stasis. This aligns with the pathogenesis of chronic obstructive pulmonary disease (COPD), with Qi deficiency as the root cause and phlegm-turbidity and blood stasis as the manifestations. Therefore, the integrative treatment of COPD should follow the therapeutic principle of invigorating the spleen and reinforcing healthy Qi, while also resolving phlegm and removing blood stasis to address both root cause and manifestations. This approach can improve the mitochondrial function, regulate energy metabolism, and reduce oxidative stress levels to alleviate COPD symptoms, slow down disease progression, and improve prognosis. By integrating the holistic concept of TCM with molecular mechanisms of modern medicine, this paper explores the pathogenesis and therapeutic principles of COPD from the spleen-mitochondria correlation. It not only provides a new direction for the modern development of TCM and the integration of Chinese and Western medicine but also offers a theoretical foundation for the integrated treatment of chronic, complex age-related diseases.
3.Detection of residual DNA in host cells of Escherichia coli in levodopa by Real-time PCR
Bingyu XU ; YAN LIU ; Xinyao GUO ; Fang YAN ; Guibin SUN
Journal of China Pharmaceutical University 2025;56(2):176-182
Using Real-time PCR technology, a highly specific and sensitive method for detecting DNA residues of Escherichia coli host cells in levodopa was established, validated, and preliminarily applied. Escherichia coli strain MB6 16S ribosomal RNA gene was selected as the target gene to design multiple pairs of primers and the target fragment by specific amplification of PCR was obtained. The target fragment was cloned into the pLENTI-BSD-CON vector and the recombinant plasmid was constructed and named pLENTI-BSD-CON-E.coli-16S. A quantitative PCR detection method (SYBR Green method) with magnetic bead extraction and purification methods was established with the reference standard of the recombinant plasmid. Furthermore, the established method was validated, including linear and range, accuracy, precision, specificity, and quantification limit, and applied to the detection of levodopa raw materials. Meanwhile, the detection method was compared with the Taqman probe method by the commercial kit. The primer sequences of the quantitative PCR detection method (SYBR Green method) were TTCGATGCAACGCGAAGAAC (forward) and GTGTAGCCCTGGTCGTAAGG (reverse). The standard curve of DNA was in the range of 10 fg/μL to 3 ng/μL with good linearity (R2≥ 0.98). The quantitative limit was 10 fg/μL. In addition, the detection recovery rate was in the range of 59.7% to 80.7%, with RSD at less than 15%. Nine batches of levodopa were detected by this method, and the amount of E.coli DNA residue was below the limit. The developed qPCR method can be used for quantitative detection of residual DNA in biological products produced by E.coli as host cells, such as levodopa . The results indicate that the sensitivity of the detection method for recombinant plasmid construction standards is superior than the reagent kit detection method.
4.Protective effect of Xuebijing injection on sepsis-associated acute respiratory distress syndrome by suppressing the HIF-1α/p38 MAPK/NF-κB signaling pathway
Weichao DING ; Juan CHEN ; Xiaohang JI ; Yi REN ; Wei ZHANG ; Mengmeng WANG ; Jing FENG ; Xinyao WU ; Jiankang MENG ; Shinan NIE ; Zhaorui SUN
Chinese Journal of Emergency Medicine 2024;33(8):1140-1150
Objective:To explore the protective mechanism of Xuebijing injection (referred to as Xuebijing) on sepsis-associated acute respiratory distress syndrome (ARDS).Methods:① Animal experiments: 100 mice were randomly(random number) divided into 4 groups, including sham operation (Sham) group, cecal ligation and puncture (CLP) group, CLP+low-dose Xuebijing (L-XBJ) group, and CLP+high-dose Xuebijing (H-XBJ) group. The survival rate, lung histological changes, lung wet/dry (W/D) ratio, cell count and protein concentration in bronchoalveolar lavage fluids (BALF), inflammatory factors levels in serum, oxidative stress indicators, cell apoptosis, and key proteins of HIF-1α/p38 MAPK/NF-κB signaling pathway were measured. ② Cell experiments: Mouse alveolar macrophages (MH-S) were cultured in vitro and divided into 6 groups, including control (Con) group, lipopolysaccharide (LPS) group, LPS+L-XBJ group, and LPS+H-XBJ group, LPS+H-XBJ+ dimethyloxallyl glycine (DMOG, HIF-1α activator) group, LPS+H-XBJ+ 2-methoxyestradiol (2ME2, HIF-1α inhibitor) group. The effects of Xuebijing on inflammatory factors, oxidative stress, and cell apoptosis and their relationship with HIF-1α/p38 MAPK/NF-κB signaling pathway were detected.Results:Xuebijing increased the survival rate of mice with sepsis-associated ARDS, relieved lung tissue damage [lung injury score: CLP group (8.778±0.588), CLP+L-XBJ group (5.833±0.310), and CLP+H-XBJ group (4.750±0.246)], alleviated lung W/D ratio, and decreased pneumonia cell infiltration and protein exudation (all P<0.05). Additionally, Xuebijing treatment also diminished the expression of inflammatory factors (TNF-α, IL-1β, and IL-6), intracellular reactive oxygen species (ROS) accumulation, malondialdehyde (MDA) formation, superoxide dismutase (SOD) depletion, and cell apoptosis in LPS-induced MH-S cells and CLP-induced sepsis-associated ARDS mice (all P<0.05). Furthermore, mechanistic investigation further clarified the effects of Xuebijing on inflammation, oxidative stress, and cell apoptosis through the HIF-1α/p38 MAPK/NF-κB signaling pathway. Conclusions:Xuebijing can exert anti-inflammatory, anti-oxidative, and anti-apoptotic effects by suppressing the HIF-1α/p38 MAPK/NF-κB signaling pathway, thereby conferring protection against sepsis-associated ARDS.
5.Mining and analysis of adverse drug event signals related to macitentan
Zhenhu WU ; Xinyao CHEN ; Yaoxin CHEN ; Yinji XU
China Pharmacy 2024;35(13):1628-1633
OBJECTIVE To mine adverse drug event (ADE) signals related to the pulmonary arterial hypertension (PAH) therapeutic drug macitentan, and to provide reference for safe clinical medication. METHODS Macitentan-related ADE reports were collected from the US FDA Adverse Event Reporting System (FAERS) database from the fourth quarter of 2013 to the third quarter of 2023. Data mining was conducted by using the reporting odds ratio (ROR) method and the comprehensive standard method established by the UK Medicines and Healthcare Products Regulatory Agency (referred to as “MHRA method”) under the proportional imbalance approach. According to the systemic organ class (SOC) and preferred term (PT) stated in 26.0 edition of Medical Dictionary of Regulatory Activities, standardized coding of ADE names was performed, followed by the analysis of time to onset (TTO) and the Weibull shape parameter (WSP) test. RESULTS Overall, a total of 26 079 ADE reports were identified with macitentan as the primary suspect drug. These reports predominantly involved female patients (73.25%) and were concentrated in the age range of 18 to 65 years (42.39%). The majority of reports originated from the US (84.42%), with hospitalization or prolonged hospital stays (59.82%) being the most common in severe treatment outcome. A total of 269 ADE positive signals related to macitentan were identified. Among these, hypothyroidism, ADE related to renal injury such as the increase of serum creatinine and blood urea nitrogen, and ADE related to psychiatric disorders like apathy and despair were not included in the drug label. TTO analysis indicated that the majority of macitentan-related ADE signals occurred between 0-30 days after initial treatment (492 reports, 21.52%) and over 360 days (411 reports, 17.98%). The results of WSP test showed that most of the top 20 reported ADE signals conformed to the characteristics of an early failure curve. CONCLUSIONS When clinically using macitentan in patients with PAH, attention should be given not only to the adverse reactions mentioned on the drug label but also to thyroid dysfunction, kidney dysfunction and mental disorder-related ADEs.
6.Current status of tuberculosis burden in China
Xinyao WANG ; Meili JIANG ; Yuanjie PANG ; Dianjianyi SUN ; Canqing YU ; Lan WANG ; Jun LYU ; Liming LI
Chinese Journal of Epidemiology 2024;45(6):857-864
Tuberculosis, caused by Mycobacterium tuberculosis, is an infectious disease that most often affects the lungs. China is still among the high-burden tuberculosis countries in the world. Although the estimated incidence of tuberculosis in China has declined in recent years, the declining rate is slow. It still faces major issues such as a slower rate of decline, a widening gap between estimated and notified incidence, higher risk among middle-aged and older adults, a high number of cases among agriculture and related workers, and a heavier disease burden in the country's western regions. In addition, latent tuberculosis infection, drug-resistant tuberculosis, tuberculosis coinfection with HIV, and extrapulmonary tuberculosis have also exacerbated the disease burden of tuberculosis to some extent. This paper reviewed the epidemic characteristics of tuberculosis, the epidemiological triad, three links and two factors in the transmission process, the disease burden, and other aspects to provide a reference for formulating prevention and control strategies on tuberculosis.
7.Research progress of 18F-FDG PET/CT in the diagnosis and prognosis of follicular lymphoma
Wenpeng HUANG ; Xinyao SUN ; Lele SONG ; Qi YANG ; Lei KANG
Journal of Chinese Physician 2024;26(4):621-626
Follicular lymphoma (FL) is the most common inert B-cell lymphoproliferative disease characterized by extensive lymph node involvement, splenomegaly, and bone marrow infiltration. In recent years, with the development of molecular imaging technology and precision medicine, the imaging research of FL has been moving towards a more refined direction. 18F-FDG PET/CT plays an increasingly important role in the diagnosis, staging, efficacy evaluation, and prognosis judgment of FL patients, promoting more precise personalized treatment and improving the efficacy and survival of FL patients. This article reviews the research progress of 18F-FDG PET/CT in the diagnosis and prognosis of FL based on domestic and foreign research progress, summarizing existing literature, in order to provide reference for personalized diagnosis and treatment of FL.
8.Research progress in imaging manifestations and diagnosis and treatment of ectopic thyroid
Xinyao SUN ; Wenpeng HUANG ; Lele SONG ; Lei KANG
Journal of Chinese Physician 2023;25(12):1900-1904
Ectopic thyroid (ETG) is a thyroid tissue located outside the normal anatomical position, often occurring in the chest. Clinical symptoms are related to its location and its impact on adjacent structures. In ETG imaging examination, single photon emission computed tomography (SPECT) nuclide imaging of thyroid perchlorate ( 99Tc mO 4-) is the most commonly used method for localization and characterization. ETG with normal function shows high radiation uptake in the corresponding area. For difficult to distinguish tumors in the base of the tongue and the thyrohyoid region, 131I or 123I imaging with more specificity for thyroid tissue uptake is needed. ETG exhibits a variety of manifestations in computed tomography (CT) and magnetic resonance imaging (MRI), mostly irregular soft tissue density masses with clear boundaries and uneven density. There are low-density cystic changes or high-density calcifications within the masses, with uneven or uniform enhancement. In ultrasound, ETG is mainly hypoechoic, with some showing cystic solid echoes and abundant blood flow signals within the gland. Asymptomatic ETG patients usually do not require treatment, while symptomatic patients often require surgical resection and have a good prognosis. Before surgery, relevant examinations should be combined to clarify the nature of the tumor as much as possible, to avoid permanent hypothyroidism caused by misdiagnosis and misresection.
9.Voluntary blood donation among undergraduates in Beijing: status and influencing factors of knowledge, attitude and practice
Kexiang SHI ; Mei YOU ; Linyi CHEN ; Mingzhu XIE ; Xinyao LIAN ; Wenjun SUN ; Juan DU ; Qingbin LU
Chinese Journal of Blood Transfusion 2022;35(4):415-419
【Objective】 To explore the status quo and influencing factors of knowledge, attitude and practice of voluntary blood donation among undergraduates in Beijing. 【Methods】 A questionnaire was designed on the basis of literature, using the method of convenience sampling to survey the undergraduates from 39 universities in Beijing. The t-test, analysis of variance and χ2 test were used to compare the differences in knowledge, attitude and practice of voluntary blood donation among different groups, and logistic regression model was performed to analyze the influencing factors. 【Results】 A total of 1 075 valid questionnaires were collected from undergraduates of 39 universities in Beijing. The results showed that the proportion of the participants who had good knowledge about voluntary blood donation was 69.21% (744/1 075). No statistically significant difference was noticed on the scores of voluntary blood donation knowledge between males and females (P>0.05). The scores of voluntary blood donation knowledge of medical students were higher than those of other subjects (P<0.05). The scores of voluntary blood donation knowledge of juniors and above were higher than those of lower grades (P<0.05). The rate of undergraduates participating voluntary blood donation in Beijing was 30.98% (333/1 075). A total of 67.26% (723/1 075) of students had donation intention, 9.49% (102/1 075) didn’t and 23.25% (250/1 075) were not sure. No statistically significant differences in blood donation intention were observed among undergraduates by genders and grades (P>0.05). The rate of medical students’ intention to donate blood was higher than that of other subjects (P<0.05). 【Conclusion】 The rate of voluntary blood donation among undergraduates in Beijing was above the middle level compared with other regions in China, but the practice of voluntary blood donation is far away from the intention. Therefore, it’s necessary to improve the level of knowledge, attitude and practice of undergraduates, especially non-medical college students, so as to improve the rate of voluntary blood donation among the undergraduates in Beijing.
10.Study on the improvement of job competency among nursing students from the aspect of reforming the Fundamental Nursing courses
Weiwei TAO ; Shuzhen DING ; Xuejie SUN ; Dan LI ; Xinyao FU
Chinese Journal of Practical Nursing 2015;31(14):1043-1046
Objective To explore the effect on job competency by reforming Fundamental Nursing courses among undergraduate nursing students.Methods 86 nursing undergraduates in Grade 2011 were recruited as the control group receiving conventional teaching method,while 119 students in Grade 2012 were recruited as the experimental group receiving reform of fundamental nursing courses.The teaching outcomes were evaluated by using Job Competence of Nursing Students Evaluation Form and Medical education environment measurement table.Results The reform of fundamental nursing courses had significantly elevated all the aspects of professional competency among nursing undergraduates (P<0.01),including personal traits,clinical ability,communication,critical thinking,specialty construction[(35.71 ± 3.82) vs.(33.41 ± 4.77),(55.29 ± 8.29) vs.(43.93 ± 8.68),(22.19 ± 2.71) vs.(19.88 ± 2.96),(16.83 ± 2.85) vs.(14.37 ± 2.71),(37.78 ± 6.31) vs.(32.42 ± 5.72)].Meanwhile,three dimensions of medical education environment for nursing students were also improved,including the student's perception of the teacher,self academic perception,self social perception [(35.23 ±5.72) vs.(31.28 6..22),(21.42 ±4.19) vs.(23.42 ±3.53),(19.44 ± 3.86) vs.(18.19 ± 3.47),t=-4.523、-3.503、-2.308,P<0.01 or 0.05)].However,there was no significant differences in the aspects of learning perception,environment perception,and the total score of medical education environment (t=-1.866、0.725、-1.705,P>0.05).Conclusions The professional competence and parts of the teaching environment around the nursing students have been elevated through the reform of Fundamental Nursing course.The reform also laid a solid foundation for the employment of nursing students.

Result Analysis
Print
Save
E-mail