Radiotherapy is a crucial treatment modality for head and neck tumors. However, while effectively killing tumor cells, it significantly disrupts the homeostasis of the oral microecology, which is closely associated with various complications such as radiation-induced oral mucositis. Literature review indicates that as radiotherapy doses accumulate and treatment durations extend, the richness and diversity of the oral microbiota show a declining trend, with the genus Streptococcus decreasing most markedly. In contrast, radiotherapy selectively promotes the proliferation of bacterial phyla such as Proteobacteria and Bacteroidetes, which are rich in opportunistic pathogens. Mechanistically, radiotherapy activates the nuclear factor-kappa B pathway, triggering chronic inflammation and oxidative stress, damaging the epithelial barrier, suppressing local immunity, and causing damage to organs such as the salivary glands. It can also induce systemic diseases via the oral-gut axis, forming a multi-level, interconnected pathogenic network. In terms of interventions, treatment strategies including probiotics and prebiotics have shown promising efficacy against side effects such as radiation-induced oral mucositis. Saliva-based oral microbiota transplantation is an emerging strategy that is expected to become widely utilized for restoring oral microecological balance. Existing interventions provide preliminary pathways for clinical practice, but this field still faces several key scientific questions. The association between oral microecology and systemic diseases remains largely correlative, lacking causal evidence. Furthermore, critical parameters for oral microbiota transplantation, such as donor screening criteria, transplantation protocols, and long-term safety, are not yet well-defined. Therefore, future research should focus on conducting large-scale clinical trials to establish standardized protocols and safety evaluation systems for oral microecological interventions, and explore combined treatment therapies such as probiotics, prebiotics, and microbiota transplantation to advance the development of personalized precision modulation. These will enable more effective management of radiotherapy-induced oral microecological dysbiosis and improve treatment outcomes and quality of life for patients with head and neck tumors.

Using Real-time PCR technology, a highly specific and sensitive method for detecting DNA residues of Escherichia coli host cells in levodopa was established, validated, and preliminarily applied. Escherichia coli strain MB6 16S ribosomal RNA gene was selected as the target gene to design multiple pairs of primers and the target fragment by specific amplification of PCR was obtained. The target fragment was cloned into the pLENTI-BSD-CON vector and the recombinant plasmid was constructed and named pLENTI-BSD-CON-E.coli-16S. A quantitative PCR detection method (SYBR Green method) with magnetic bead extraction and purification methods was established with the reference standard of the recombinant plasmid. Furthermore, the established method was validated, including linear and range, accuracy, precision, specificity, and quantification limit, and applied to the detection of levodopa raw materials. Meanwhile, the detection method was compared with the Taqman probe method by the commercial kit. The primer sequences of the quantitative PCR detection method (SYBR Green method) were TTCGATGCAACGCGAAGAAC (forward) and GTGTAGCCCTGGTCGTAAGG (reverse). The standard curve of DNA was in the range of 10 fg/μL to 3 ng/μL with good linearity (R2≥ 0.98). The quantitative limit was 10 fg/μL. In addition, the detection recovery rate was in the range of 59.7% to 80.7%, with RSD at less than 15%. Nine batches of levodopa were detected by this method, and the amount of E.coli DNA residue was below the limit. The developed qPCR method can be used for quantitative detection of residual DNA in biological products produced by E.coli as host cells, such as levodopa . The results indicate that the sensitivity of the detection method for recombinant plasmid construction standards is superior than the reagent kit detection method.

The 2025 European Lung Cancer Congress (ELCC) convened in Paris, France, centering on the optimization and innovation of immunotherapy for non-small cell lung cancer (NSCLC). Key topics at the congress included the application strategies for perioperative immunotherapy, breakthroughs in combination therapy models for advanced NSCLC, and the emerging roles of biomarkers in predicting diverse treatment outcomes. This paper integrates data from several key pivotal studies to systematically analyze the clinical value of neoadjuvant therapy within the perioperative setting, the potential of targeted combination regimens, and the challenges of managing drug resistance, thus offering new directions for clinical practice.

Among numerous medical imaging modalities, diffusion weighted imaging (DWI) is extremely sensitive to acute ischemic stroke lesions, especially small infarcts. However, magnetic resonance imaging is time-consuming and expensive, and it is also prone to interference from metal implants. Therefore, the aim of this study is to design a medical image synthesis method based on generative adversarial network, Stroke-p2pHD, for synthesizing DWI images from computed tomography (CT). Stroke-p2pHD consisted of a generator that effectively fused local image features and global context information (Global_to_Local) and a multi-scale discriminator (M ²Dis). Specifically, in the Global_to_Local generator, a fully convolutional Transformer (FCT) and a local attention module (LAM) were integrated to achieve the synthesis of detailed information such as textures and lesions in DWI images. In the M ²Dis discriminator, a multi-scale convolutional network was adopted to perform the discrimination function of the input images. Meanwhile, an optimization balance with the Global_to_Local generator was ensured and the consistency of features in each layer of the M ²Dis discriminator was constrained. In this study, the public Acute Ischemic Stroke Dataset (AISD) and the acute cerebral infarction dataset from Yantaishan Hospital were used to verify the performance of the Stroke-p2pHD model in synthesizing DWI based on CT. Compared with other methods, the Stroke-p2pHD model showed excellent quantitative results (mean-square error = 0.008, peak signal-to-noise ratio = 23.766, structural similarity = 0.743). At the same time, relevant experimental analyses such as computational efficiency verify that the Stroke-p2pHD model has great potential for clinical applications.
Humans ; Tomography, X-Ray Computed/methods* ; Diffusion Magnetic Resonance Imaging/methods* ; Cerebral Infarction/diagnostic imaging* ; Stroke/diagnostic imaging* ; Neural Networks, Computer ; Image Processing, Computer-Assisted/methods* ; Algorithms

Stroke is a critical health issue in China, and carotid artery stenosis and plaque play key roles in its prevalence. Despite the acknowledged significance of this condition, detailed information regarding the prevalence of carotid artery stenosis and plaque across the Chinese population has been scarce. This study analyzed data from the China Stroke High-risk Population Screening and Intervention Program for 2020-2021, focusing on 194 878 Chinese adults aged 40 years and above. It assessed the prevalence of carotid artery stenosis and plaque and identified their associated risk factors. Results revealed a standardized prevalence of 0.40% for carotid artery stenosis and 36.27% for carotid plaque. Notably, the highest rates of stenosis were observed in north and south China at 0.61%, while southwestern China exhibited the highest plaque prevalence at 43.17%. Key risk factors included older age, male gender, hypertension, diabetes, stroke, smoking, and atrial fibrillation. This study highlights significant geographical and demographic disparities in the prevalence of these conditions, underlining the urgent need for targeted interventions and policy reforms. These measures are essential for reducing the incidence of stroke and improving patient outcomes, addressing this significant health challenge in China.
Humans ; China/epidemiology* ; Male ; Female ; Prevalence ; Middle Aged ; Carotid Stenosis/epidemiology* ; Risk Factors ; Aged ; Adult ; Plaque, Atherosclerotic/epidemiology* ; Stroke/epidemiology* ; Aged, 80 and over

Pinellia ternata， belonging to the Pinellia genus within the Araceae family， is a medicinal plant due to its tubers. There are severe issues with unclear germplasm and mixed varieties in its cultivation， necessitating urgent new variety protection efforts. The distinctness， uniformity， and stability （DUS） testing of the plant variety is the basis for protecting new plant varieties， and the DUS test guidelines are the technical basis for DUS testing. To develop the DUS test guidelines for P. ternata， agronomic traits of 229 germplasm of P. ternata were observed and measured during its two growth stages over the years， and each character was graded and described. A total of 38 traits were selected as the test traits of the DUS test guideline for P. ternata. There were three plant traits， 19 leaf traits， six flower traits， two fruit traits， two tuber traits， five bulbil traits， and one ploidy trait. These traits could be divided into 22 quality characters， 12 quantitative characters， and four pseudo-quantitative characters， as well as seven groups， including plants， leaves， flowers， fruit， tubers， bulbils， and ploidy. By searching for standard traits， 10 standard varieties were ultimately determined. Preparing these guidelines will have great significance for reviewing and protecting P. ternata varieties， safeguarding breeders' rights， and promoting the development of the P. ternata industry.

Objective:To explore the application effect of special quality control management for thyroid and breast ultrasound in community hospitals.Methods:This study was a prospective interventional study. From November 2024 to March 2025, the Department of Ultrasound, China-Japan Friendship Hospital conducted special quality control management for thyroid and breast ultrasound in 17 community hospitals in Chaoyang District. Through measures such as standardized training in thyroid and breast ultrasound as well as quality control investigations before and after the training, changes in the qualification rates of ultrasound image storage, report writing, and nodule grading accuracy for thyroid and breast in community hospitals before and after the implementation of this management were compared, A paired t-test was used for statistical analysis. Results:Thyroid ultrasound quality control effects: Image storage qualification rates significantly improved: the qualification rate of image adjustment increased from 62.94%±22.01% to 85.88%±14.17% ( t=6.35, P<0.001), and body markers application rose from 76.47%±4.93% to 95.29%±7.17% ( t=11.14, P<0.001). The qualification rates for nodule sections and blood flow sections both exceeded 95% ( P<0.001). In report writing: the qualification rates for items such as nodule location, measurement, and echo increased by 10%-25%. The description of nodule margins reached 100% ( t=8.79, P<0.001), and the description of echogenic foci features increased from 41.76% to 79.41% ( t=5.46, P<0.001). Nodule classification accuracy significantly improved: The guideline application rate increased from 55.29% to 91.18% ( t=4.84, P<0.001), and the classification correctness rate rose from 54.71% to 69.41% ( t=5.14, P<0.001). Breast ultrasound quality control effects: Overall improvement in image storage qualification rates: body marker application increased from 75.29%±21.54% to 97.00%±65.88% ( t=3.82, P=0.002). The qualification rates for nodule sections and blood flow section imaging both exceeded 94% ( P<0.001). In report writing: the qualification rates for items like nodule location, measurement, and echo increased by 10%-30%. The classification rate of the Breast Imaging Reporting and Data System (BI-RADS) classification rate rose from 68.82% to 98.24% ( t=3.68, P=0.002), and the classification correctness rate increased from 57.65% to 70.00% ( t=2.74, P=0.014). Conclusion:The implementation of special quality control management for thyroid and breast ultrasound is an effective method to improve the quality of ultrasound medical services in community hospitals.

To address the problem of data silos in dental specialties caused by equipment heterogeneity, this study developed an Intelligent Internet of Things (IoT)-enabled dental chair platform (hereinafter referred to as the intelligent platform) based on the concept of medical-engineering integration. The platform adopts a three-tier chair-domain interconnection architecture: the bottom tier integrates multi-source sensors and standardized interfaces for automated data acquisition and linkage with hospital information systems; the middle tier provides clinic-level management and remote teaching collaboration; and the top tier employs a blockchain-based secure cloud database for resource allocation and data management. Clinical validation at The Affiliated Stomatological Hospital of Nanjing Medical University demonstrated that, compared with a control group from the same period in 2023, the trial group achieved a 38.0% increase in average daily patient visits (80.6±6.8 vs. 58.4±5.2, t=15.16, P<0.001), a 24.6% reduction in average treatment time [(36.1±6.3) min vs. (47.9±8.5) min, t=7.72, P<0.001], a 39.2% reduction in waiting time [23.3 (16.5, 30.1) min vs. 38.3 (28.3, 48.3) min, U=32.00, P<0.001], a 30.4% reduction in equipment idle rate [8.7% (5.1%, 12.3%) vs. 12.5% (7.4%, 17.6%), U=251.00, P=0.003], and an increase in patient satisfaction from 88.2% (1 519/1 723) to 94.3% (2 186/2 318) ( t=7.26, P<0.001). User research confirmed that the functions most favored by clinicians and patients were "dental chair parameter updating and clinical data integration" [74.7% (80/107)] and "chairside display of diagnostic images" [76.8% (119/155)], respectively. Looking forward, the intelligent platform has the potential to integrate artificial intelligence-assisted diagnosis and 5G-enabled multicenter collaboration to further expand its clinical applications and accelerate the digital transformation of dental healthcare.

To investigate the mutations of NF1 and clinical phenotypes in patients with sporadic neurofibromatosis type 1 (NF1). This is aimed to evaluate the efficacy of high-throughput sequencing in diagnosing atypical cases, to expand the mutational spectrum of NF1, and to provide early diagnosis of NF1. Clinical data from 11 sporadic NF1 patients without family history treated at the Fifth Affiliated Hospital of Sun Yat-sen University (2019-2023) were collected. The mutations of NF1 gene were detected using whole-exome sequencing or chip-capture high-throughput sequencing, followed by bioinformatics analysis. Novel mutations were screened against normal population databases to exclude benign polymorphisms, and pathogenicity of the mutations was classified according to ACMG guidelines. The results showed that two novel frameshift mutations were identified: c.7904del (p.Asp2635Valfs*9) and c.5122_5123del (p.Phe1708Hisfs*9). The patient carrying c.7904del exhibited an undocumented phenotype of posterior medullary ischemic degeneration. Among the 11 NF1 patients, the types of mutations included frameshift (4/11), nonsense (3/11), intronic (2/11), splicing (1/11), and start codon variants (1/11). Common phenotypes were cafe-au-lait macules (8/11) and neurofibromas (6/11), yet significant phenotypic heterogeneity existed among patients sharing identical mutations. In conclusion, this study discovered two novel NF1 mutations and an unreported phenotype, expanding both the NF1 mutational spectra and highlights the need for attention to cerebrovascular status in patients carrying NF1 mutations. High-throughput sequencing significantly enhances molecular diagnostic efficacy for atypical NF1, providing a critical basis for clinical NF1 diagnosis.

Objective:To investigate the laboratory diagnostic value of 5 new blood routine indexes in chronic hepatitis B (CHB), liver cirrhosis and hepatocellular carcinoma (HCC).Methods:The retrospective study included 65 patients with chronic HBV infection, 72 patients with liver cirrhosis and 163 patients with HCC recruited at Liver Disease Center in First Affiliated Hospital of Fujian Medical University, as well as 52 healthy controls recruited from the Physical Examination Center of the First Affiliated Hospital of Fujian Medical University from October 2022 to April 2023. Five new parameters [early granulated cell percent (EGC%), early granulated cell absolute count (EGC#), microcytic anemia factor (MAF), leukocyte estimate(corrected)from the DIFF optical channel (WDOP) and leukocyte estimate(corrected)from the NRBC optical channel (WNOP)] were detected by UniCel DxH 900 blood cell analyzer. Univariate analysis of the expression levels of the 5 new parameterswere compared among CHB, liver cirrhosis and HCC groups. Pearson correlation analysis was used to explore the correlation between the 5 new parameters and HBV-related markers in CHB and Child-Pugh score in liver cirrhosis. Receiver operating characteristic (ROC) curve and AUC were used to estimate the diagnostic capacity of the 5 new blood routine indexes in CHB, liver cirrhosis and HCC.Results:In patients with CHB, the levels of EGC% ( Z=4.613, P<0.001) and EGC# ( Z=4.220, P<0.001) were higher than those of healthy controls; EGC# was positively correlated with HBsAg and HBeAg (both P<0.05). In patients with cirrhosis, the level of MAF ( Z=-4.928, P<0.001) was lower than that of healthy controls, and Child-Pugh score was found to be negatively correlated with MAF ( r=-0.349, P<0.05). In HCC patients, WDOP ( Z=2.45, P=0.017) and WNOP ( Z=2.90, P=0.017) levels were higher in patients with tumor volume>3 cm 3 than those in patients with volume ≤3 cm 3. The AUCs of combination of 5 new parameters to diagnose CHB, liver cirrhosis and HCC were 0.901 (95% CI 0.830-0.973, P<0.001), 0.946 (95% CI 0.909-0.984, P<0.001), and 0.904 (95% CI 0.858-0.950, P<0.001). Conclusions:The 5 new parameters based on peripheral blood cell analysis have good clinical value in the diagnosis of CHB, liver cirrhosis and HCC diseases.