1.Analysis of clinical characteristics and etiologies of hospitalized patients with spike-and-wave activation in sleep
Yanyan GAO ; Xinna JI ; Shuo FENG ; Wanting LIU ; Jinxiao CHEN ; Shupin LI ; Huanhuan WU ; Qian CHEN
Chinese Journal of Applied Clinical Pediatrics 2025;40(6):426-433
Objective:To investigate the clinical features and etiologies of hospitalized patients with spike-and-wave activation in sleep(SWAS).Methods:Case-series study.The clinical features and etiologies of patients diagnosed with SWAS in the Department of Neurology, Capital Center for Children′s Health, Capital Medical University from September 2016 to March 2023 were retrospectively analyzed.The measurement data were analyzed by normality testing, and those conforming to the normal distribution were characterized by Mean± SD deviation.After the homogeneity test of variance, either the independent sample t test or the completely random analysis of variance (ANOVA) was employed for data comparison between groups.If the results of ANOVA were statistically significant, the LSD test was utilized for pairwise comparison. Results:(1)Basic data: a total of 140 patients with SWAS were included, with the onset age of (7.4±2.1) years.There were 134 cases (134/140, 95.7%) complicated by epilepsy, and the age of epilepsy onset was (5.3±2.2) years.Seventy-four cases (74/137, 54.0%) had self-limited epilepsy and centrotemporal spikes.Twenty-one cases (21/137, 15.3%) had epileptic encephalopathy and SWAS.Eight cases (8/137, 5.8%) had developmental and epileptic encephalopathy and SWAS.Pulse Methylprednisolone therapy, Clonazepam or Clobazam, callosotomy, and left temporo-parietal-occipital craniotomy for epileptogenic lesion resection were effective in 20 cases (20/32, 62.5%), 3 cases (3/13, 23.1%), 1 case (1/2, 50.0%) and 1 case, respectively.One patient achieved development improvement and a decrease in discharge index after vagus nerve stimulation.(2) Etiologies: ①Genetic etiology: 6 patients carried pathogenic or suspected pathogenic mutations, including GRIN2A (c.87_106dupGGGTCCCCCCGCGCTAAATA/p.I36Rfs*6), GRIN2A (c.2069C>T/p.T690M), CREBBP (c.4844A>G/p.N1615S), KAT6A(c.2203C>T/p.R735X), GRIN1 (c.2326_2327insACCTCT-GGAAGCAGAACGTCTCCCTGTCCA/p.S775_I776insNLWKQNVSLS) and MECP2 (c.916C>T/p.R306C).Among them, there were no reports on the association of CREBBP and KAT6A with SWAS.②Structural etiology: there were 7 cases with perinatal brain injury and 1 case with bilateral temporo-parietal gyrus.③Metabolic etiology: 1 patient with cerebrotendinous xanthomatosis carried the pathogenic gene CYP27A1 (c.379C>T/p.R127W, c.1415G>C/p.G472A), which was not related to SWAS.④Infectious etiology: 1 case had congenital cytomegalovirus infection.⑤ Immune etiology: 1 case had autoimmune encephalitis.⑥ There were 123 cases with unknown etiologies.(3) Etiologies and clinical characteristics: SWAS occurred earlier in patients with structural etiology than that in patients with unknown etiologies ( F=4.478, P<0.05).The proportions of discharge index ≥85% ( χ2=10.079, P<0.05) and encephalopathy ( χ2=9.385, P<0.05) were higher in patients with genetic etiology than those in patients with unknown etiologies.(4) Discharge index: the patients were divided into a group with a discharge index ≥85% and a group with a discharge index < 85%.Compared with the latter group, the former group had a higher proportion of developmental retardation ( χ2=15.976, P<0.001), suffered epilepsy ( t=-3.498, P<0.05) and SWAS at a younger age ( t=-2.044, P<0.05), and used more types of antiepileptic drugs ( t=2.079, P<0.05).(5) Neurodevelopmental outcomes: 21 patients had neurodevelopmental disorders and 75 had normal neurodevelopment. Conclusions:There are various etiologies for encephalopathy or epilepsy complicated by SWAS.The patients with structural etiology may develop SWAS at a younger age, whereas those with a clearly identified pathogenic gene may exhibit a higher discharge index and a higher rate of encephalopathy.When patients present with encephalopathy or refractory epilepsy, surgical treatment should be considered if structural lesions are found.The proportion of developing encephalopathy in patients with a discharge index ≥85% is the same as that in patients with a discharge index <85%.However, the patients with a higher discharge index develop epilepsy and SWAS at a younger age, and are more difficult to treat.
2.Two cases of developmental and epileptic encephalopathy related to the EEF1A2 gene and a literature review
Yanyan GAO ; Xinna JI ; Shuo FENG ; Wanting LIU ; Jinxiao CHEN ; Shupin LI ; Huanhuan WU ; Qian CHEN
Chinese Journal of Neurology 2025;58(4):404-413
Objective:To investigate the clinical and genetic characteristics of developmental and epileptic encephalopathy related to the EEF1A2 gene. Methods:The clinical data and whole exome sequencing results of 2 patients who were diagnosed as developmental and epileptic encephalopathy related to the EEF1A2 gene in the Children′s Hospital, Capital Institute of Pediatrics in June 2016 and August 2018 were retrospectively analyzed. Relevant literatures were retrieved using " EEF1A2" and "epileptic encephalopathy" or "epilepsy" as key words in Online Mendelian Inheritance in Man, PubMed, CNKI and Wanfang databases (literatures searching from establishment of these databases to June 2024). The clinical and genetic characteristics of developmental and epileptic encephalopathy related to the EEF1A2 gene were summarized based on literature reports and the data of these 2 patients. Results:Patient 1 was a 9 months old male infant. He presented with global developmental delay. He developed myoclonic seizures at 4 months old. Valproic acid, clonazepam, topiramate and vagus nerve stimulation were all ineffective. Both of his hands had transverse palmar crease. The de novo c.364G>A variant in the EEF1A2 gene (NM_001958.3) was identified and he was diagnosed with developmental and epileptic encephalopathy related to the EEF1A2 gene. Patient 2 was a 2 years and 2 months old boy. He presented with global developmental delay. Myoclonic seizures occurred when he was 2 years and 3 months old, and various anti-epileptic drugs were ineffective. He had left eye esotropia and low muscle tone in the extremities. He died at the age of 4. The de novo c.208G>A variant in the EEF1A2 gene (NM_001958.3) was identified and he was diagnosed with developmental and epileptic encephalopathy related to the EEF1A2 gene. Eight literatures on developmental and epileptic encephalopathy related to the EEF1A2 gene (all in English) were retrieved, reporting 28 cases (totally 30 patients, including 2 cases in this study). The main clinical manifestations were psychomotor developmental delay (30/30, 100.0%), facial dysmorphism (15/30, 50.0%), refractory epilepsy (14/26, 53.8%), myoclonic seizures (19/26, 73.1%), and movement disorders (8/16). A total of 15 mutation sites in the EEF1A2 gene were reported, all of which were missense mutations. Conclusions:Developmental and epileptic encephalopathy related to the EEF1A2 gene is primarily characterized by delayed psychomotor development, distinctive facial features, drug-resistant epilepsy, myoclonic seizures, and movement disorders. Variants in the EEF1A2 gene are predominantly missense mutations, and identifying these variants plays a crucial role in accurate diagnosis of the disease.
3.Analysis of clinical characteristics and etiologies of hospitalized patients with spike-and-wave activation in sleep
Yanyan GAO ; Xinna JI ; Shuo FENG ; Wanting LIU ; Jinxiao CHEN ; Shupin LI ; Huanhuan WU ; Qian CHEN
Chinese Journal of Applied Clinical Pediatrics 2025;40(6):426-433
Objective:To investigate the clinical features and etiologies of hospitalized patients with spike-and-wave activation in sleep(SWAS).Methods:Case-series study.The clinical features and etiologies of patients diagnosed with SWAS in the Department of Neurology, Capital Center for Children′s Health, Capital Medical University from September 2016 to March 2023 were retrospectively analyzed.The measurement data were analyzed by normality testing, and those conforming to the normal distribution were characterized by Mean± SD deviation.After the homogeneity test of variance, either the independent sample t test or the completely random analysis of variance (ANOVA) was employed for data comparison between groups.If the results of ANOVA were statistically significant, the LSD test was utilized for pairwise comparison. Results:(1)Basic data: a total of 140 patients with SWAS were included, with the onset age of (7.4±2.1) years.There were 134 cases (134/140, 95.7%) complicated by epilepsy, and the age of epilepsy onset was (5.3±2.2) years.Seventy-four cases (74/137, 54.0%) had self-limited epilepsy and centrotemporal spikes.Twenty-one cases (21/137, 15.3%) had epileptic encephalopathy and SWAS.Eight cases (8/137, 5.8%) had developmental and epileptic encephalopathy and SWAS.Pulse Methylprednisolone therapy, Clonazepam or Clobazam, callosotomy, and left temporo-parietal-occipital craniotomy for epileptogenic lesion resection were effective in 20 cases (20/32, 62.5%), 3 cases (3/13, 23.1%), 1 case (1/2, 50.0%) and 1 case, respectively.One patient achieved development improvement and a decrease in discharge index after vagus nerve stimulation.(2) Etiologies: ①Genetic etiology: 6 patients carried pathogenic or suspected pathogenic mutations, including GRIN2A (c.87_106dupGGGTCCCCCCGCGCTAAATA/p.I36Rfs*6), GRIN2A (c.2069C>T/p.T690M), CREBBP (c.4844A>G/p.N1615S), KAT6A(c.2203C>T/p.R735X), GRIN1 (c.2326_2327insACCTCT-GGAAGCAGAACGTCTCCCTGTCCA/p.S775_I776insNLWKQNVSLS) and MECP2 (c.916C>T/p.R306C).Among them, there were no reports on the association of CREBBP and KAT6A with SWAS.②Structural etiology: there were 7 cases with perinatal brain injury and 1 case with bilateral temporo-parietal gyrus.③Metabolic etiology: 1 patient with cerebrotendinous xanthomatosis carried the pathogenic gene CYP27A1 (c.379C>T/p.R127W, c.1415G>C/p.G472A), which was not related to SWAS.④Infectious etiology: 1 case had congenital cytomegalovirus infection.⑤ Immune etiology: 1 case had autoimmune encephalitis.⑥ There were 123 cases with unknown etiologies.(3) Etiologies and clinical characteristics: SWAS occurred earlier in patients with structural etiology than that in patients with unknown etiologies ( F=4.478, P<0.05).The proportions of discharge index ≥85% ( χ2=10.079, P<0.05) and encephalopathy ( χ2=9.385, P<0.05) were higher in patients with genetic etiology than those in patients with unknown etiologies.(4) Discharge index: the patients were divided into a group with a discharge index ≥85% and a group with a discharge index < 85%.Compared with the latter group, the former group had a higher proportion of developmental retardation ( χ2=15.976, P<0.001), suffered epilepsy ( t=-3.498, P<0.05) and SWAS at a younger age ( t=-2.044, P<0.05), and used more types of antiepileptic drugs ( t=2.079, P<0.05).(5) Neurodevelopmental outcomes: 21 patients had neurodevelopmental disorders and 75 had normal neurodevelopment. Conclusions:There are various etiologies for encephalopathy or epilepsy complicated by SWAS.The patients with structural etiology may develop SWAS at a younger age, whereas those with a clearly identified pathogenic gene may exhibit a higher discharge index and a higher rate of encephalopathy.When patients present with encephalopathy or refractory epilepsy, surgical treatment should be considered if structural lesions are found.The proportion of developing encephalopathy in patients with a discharge index ≥85% is the same as that in patients with a discharge index <85%.However, the patients with a higher discharge index develop epilepsy and SWAS at a younger age, and are more difficult to treat.
4.Two cases of developmental and epileptic encephalopathy related to the EEF1A2 gene and a literature review
Yanyan GAO ; Xinna JI ; Shuo FENG ; Wanting LIU ; Jinxiao CHEN ; Shupin LI ; Huanhuan WU ; Qian CHEN
Chinese Journal of Neurology 2025;58(4):404-413
Objective:To investigate the clinical and genetic characteristics of developmental and epileptic encephalopathy related to the EEF1A2 gene. Methods:The clinical data and whole exome sequencing results of 2 patients who were diagnosed as developmental and epileptic encephalopathy related to the EEF1A2 gene in the Children′s Hospital, Capital Institute of Pediatrics in June 2016 and August 2018 were retrospectively analyzed. Relevant literatures were retrieved using " EEF1A2" and "epileptic encephalopathy" or "epilepsy" as key words in Online Mendelian Inheritance in Man, PubMed, CNKI and Wanfang databases (literatures searching from establishment of these databases to June 2024). The clinical and genetic characteristics of developmental and epileptic encephalopathy related to the EEF1A2 gene were summarized based on literature reports and the data of these 2 patients. Results:Patient 1 was a 9 months old male infant. He presented with global developmental delay. He developed myoclonic seizures at 4 months old. Valproic acid, clonazepam, topiramate and vagus nerve stimulation were all ineffective. Both of his hands had transverse palmar crease. The de novo c.364G>A variant in the EEF1A2 gene (NM_001958.3) was identified and he was diagnosed with developmental and epileptic encephalopathy related to the EEF1A2 gene. Patient 2 was a 2 years and 2 months old boy. He presented with global developmental delay. Myoclonic seizures occurred when he was 2 years and 3 months old, and various anti-epileptic drugs were ineffective. He had left eye esotropia and low muscle tone in the extremities. He died at the age of 4. The de novo c.208G>A variant in the EEF1A2 gene (NM_001958.3) was identified and he was diagnosed with developmental and epileptic encephalopathy related to the EEF1A2 gene. Eight literatures on developmental and epileptic encephalopathy related to the EEF1A2 gene (all in English) were retrieved, reporting 28 cases (totally 30 patients, including 2 cases in this study). The main clinical manifestations were psychomotor developmental delay (30/30, 100.0%), facial dysmorphism (15/30, 50.0%), refractory epilepsy (14/26, 53.8%), myoclonic seizures (19/26, 73.1%), and movement disorders (8/16). A total of 15 mutation sites in the EEF1A2 gene were reported, all of which were missense mutations. Conclusions:Developmental and epileptic encephalopathy related to the EEF1A2 gene is primarily characterized by delayed psychomotor development, distinctive facial features, drug-resistant epilepsy, myoclonic seizures, and movement disorders. Variants in the EEF1A2 gene are predominantly missense mutations, and identifying these variants plays a crucial role in accurate diagnosis of the disease.
5.Feasibility of evaluating coronary artery calcium score on virtual non-contrast scan in dual-layer spectral detector CT
Panpan Yang ; Lu Lu ; Mao Sheng ; Ruomei Li ; Ji Zhang ; Yuqi Jiang ; Xinna Zhang ; Wei Deng ; Yuguo Li ; Shutian An ; Ren Zhao ; Yongqiang Yu ; Xiaohu Li
Acta Universitatis Medicinalis Anhui 2023;58(4):692-697
Objective:
To evaluate the accuracy and feasibility of coronary artery calcium score ( CACS) on virtual non-contrast scan ( VNC) images obtained from coronary artery CT angiography ( CCTA) scan with dual -layer spectral detector CT (SDCT) .
Methods :
The data of 197 patients who underwent CCTA scan in hospital were analyzed retrospectively,and 88 patients with CACS >0 were further analyzed. Linear regression analysis of CACS and coronary artery calcium volume ( CACV) of true non-contrast (TNC) images and VNC images ( CACS-TNC, CACS-VNC,CACV-TNC,CACV-VNC) was performed to obtain linear regression equation and correction coefficients λ 1AVG and λ2AVG .CACS-VNC and CACV-VNC were corrected by the corresponding regression equation and recorded as CCACS-VNC and CCACV-VNC,respectively.Spearman correlation coefficient was used for correlation analysis and Bland-Altman plot was used for consistency test.Mann-Whitney U test was used to compare the difference between the two groups.
Results :
For the total coronary artery,there was a strong correlation between CACS- TNC and CACS-VNC (rs = 0. 952,P <0. 001 ,λ 1AVG = 2. 19 ) ,CACV-TNC and CACV-VNC ( rs = 0. 954,P < 0. 001,λ2AVG = 1. 93) .The results of Mann-Whitney U test showed that there was no significant difference between CACS-TNC and CCACS-VNC or between CACV-TNC and CCACV-VNC,and the Bland-Altman plot showed good consistency between CACS-TNC and CCACS-VNC ,CACV-TNC and CCACV-VNC.
Conclusion
VNC images based on SDCT can accurately measure CACS and be used for cardiovascular risk classification,which is expected to replace TNC scan and reduce the radiation dose of patients.
6.Clinical characteristics and analysis of diagnosis and treatment of 16 patients with GATOR1 complex-related epilepsy
Yanyan GAO ; Ying CHAI ; Xinna JI ; Xingzhou LIU ; Shupin LI ; Pingping ZHANG ; Qian CHEN ; Wei ZHANG
Chinese Journal of Neurology 2023;56(2):133-142
Objective:To analyze the clinical manifestations, gene mutation characteristics and treatment effects of patients with GATOR1 complex-related epilepsy, and to explore the diagnosis and treatment of this disease.Methods:The medical history, electroencephalogram, brain imaging, genetic test results, treatment and follow-up data of patients with GATOR1 complex-related epilepsy who attended the Children′s Hospital Affiliated to Capital Institute of Pediatrics, Beijing Tsinghua Changgung Hospital, and Shanghai Deji Hospital from May 2017 to July 2022 were retrospectively analyzed.Results:A total of 16 patients with GATOR1 complex-related epilepsy were collected, including 7 males and 9 females. The age of onset of epilepsy was from 2 months to 14 years. Ten cases had focal seizures only, 2 cases had generalized seizures only, and 4 cases had coexistence of focal seizures and generalized seizures, of which generalized seizures included generalized tonic-clonic seizure, spastic seizure, and myoclonic seizure. Among the 16 patients, 2 had infantile spasms, 3 had familial focal epilepsy with variable focus, and 1 had sleep related hyperkinetic epilepsy. Electroencephalogram intervals suggested multiple brain areas discharge or diffuse discharge. A total of 13 DEPDC5 gene mutation sites, 1 NPRL2 gene mutation site, and 2 NPRL3 gene mutation sites were found; 4 sites of DEPDC5 gene were reported sites, the rest were unreported; all mutations had pathogenic significance; 8 cases had nonsense mutation, 1 case had large fragment deletion, 4 cases had frameshift mutation, 1 case had integer mutation, 2 cases had splicing mutation; 13 cases′ mutation was inherited from parents, 2 cases had new mutation, and 1 case had unverified mutation. Magnetic resonance imaging (MRI) showed 5 of the 16 patients were normal, and 11 had abnormal cerebral cortex structure, manifested as bottom-of-sulcus focal cortical dysplasia (FCD), abnormal formation of sulci and (or) gyri with or without ill-defined gray-white matter and malformation of cortical dysplasia of the bilateral brain. Seven patients underwent stereotactic electroencephalogram (SEEG) monitoring, and the SEEG showed low-amplitude fast rhythm at the beginning in 6 patients, of whom 5 cases started from the frontal lobe, and 1 case started from the parietal lobe. Eight patients were only treated with drugs, 1 with single-drug therapy and the rest with multi-drug combination therapy. Eight patients underwent surgery. Among them, 5 patients with DEPDC5 gene mutation underwent epileptogenic cortex excising after SEEG monitoring, and postoperative pathological examinations showed FCDⅡ, FCDⅢ or non-specific changes; 1 patient was waiting for surgery. One patient with NPRL3 gene mutation underwent epileptogenic foci resection and postoperative pathological examinations showed FCDⅡa; the other patient with NPRL3 gene mutation underwent radiofrequency thermocoagulation after SEEG monitoring. Follow-up showed that 3 patients were seizure-free with drug treatment, and 4 patients had fewer seizures after drug treatment. Six cases underwent epileptic foci resection. Five of them were assisted by SEEG to locate the epileptic foci before surgery and were seizure-free after the operation, but the range of surgical resection was wider than the abnormal range shown by MRI; whereas 1 case who was not assisted by SEEG showed no improvement. There was still 1 case who underwent SEEG-guided radiofrequency thermocoagulation and had no improvement after operation. Conclusions:GATOR1 complex-related epilepsy mostly manifests as focal seizures. SEEG shows that seizures originate from the frontal lobe more often, and cortical developmental abnormalities are often found. DEPDC5 gene mutations are the most common ones, mostly inherited from parents, with high incomplete penetrance rate. Therefore, genetic testing is recommended for non-acquired brain structural abnormalities. For those who are refractory to drugs, a radical cure can be obtained by resection of the epileptogenic foci after preoperative evaluation.
7.Clinical and basic research progress of adrenocorticotropic hormone in treatment of infantile spasm
Yan ZHANG ; Xinna JI ; Qian CHEN
Chinese Journal of Neuromedicine 2022;21(4):420-424
Infantile spasm (IS) is a common epileptic encephalopathy in infancy, characterized by typical epileptic spasm, developmental delay and hypsarrhythmia on interictal electroencephalogram (EEG). Adrenocorticotropic hormone (ACTH) is the first-line treatment medicine for IS. Although ACTH has shown good response to IS and has been widely used, the regime is not identical and the mechanism is still unclear. This paper focuses on the clinical application of ACTH for IS and the anticonvulsant mechanisms of ACTH, in order to provide clinical and theoretical basis for ACTH application.
8.Analysis of clinical phenotypes and genotypes in 13 patients with KCNQ2-associated epilepsy
Pingping ZHANG ; Xinna JI ; Zhijie GAO ; Yingying MAO ; Qian CHEN
Chinese Journal of Neurology 2021;54(6):553-559
Objective:To report the clinical features of KCNQ2-associated epilepsy and the novel mutations and unreported clinical phenotype of KCNQ2 gene, so as to provide help for treatment selection and prognosis evaluation.Methods:Among 979 patients with epilepsy and developmental delay who were admitted to the Department of Neurology,Children′s Hospital Affiliated to Capital Institute of Pediatrics from July 2015 to October 2019, a total of 13 patients were selected from 12 families with KCNQ2 gene mutation by whole exome sequencing technology. Suspected mutations were verified by Sanger sequencing on the probands and their parents to identify the source. The clinical phenotype and genotype were analyzed according to these results.Results:Among the 13 patients with epilepsy, the onset age of four cases were older than six months [two cases in infancy (epilepsy encephalopathy), one case in early childhood (epilepsy encephalopathy) and one case in adolescence (benign epilepsy)]. Eight cases were treated with oxcarbazepine, of whom five cases were seizure free, and two cases showed partial response (>50%). Two cases treated with topiramate were seizure free. Five novel mutations were found in this research, including c.379T>G(p.Y127D), c.1A>C(initial codon mutation), c.708G>C(p.W236C), c.1027G>T(p.A343S) and c.1649T>G(p.V550G).Conclusions:Although it was rare in clinical work, the variation of KCNQ2 gene existed in patients with childhood-onset epilepsy and adolescent-onset epilepsy. Meanwhile, five novel mutations of KCNQ2 gene were reported, which further expanded its gene spectrum. This research supported that oxcarbazepine was the efficient medicine for the KCNQ2-associated epilepsy. Genetic testing showed great help to the treatment of epilepsy.
9.Clinical and genetic characteristics of children with STXBP1 encephalopathy
Jiajie CAO ; Xinna JI ; Yingying MAO ; Pingping ZHANG ; Wanting LIU ; Hanzi ZHANG ; Ning DING ; Qian CHEN
Chinese Journal of Pediatrics 2020;58(6):493-498
Objective:To investigate the clinical and genetic characteristics of developmental and epileptic encephalopathy (DEE) caused by syntaxin-binding protein 1 (STXBP1) gene mutation.Methods:The clinical data, gene variation and treatment outcome of 15 children with STXBP1 encephalopathy admitted to Children′s Hospital Affiliated to Capital Institute of Pediatrics from January 2014 to June 2019 were analyzed retrospectively.Results:Among 15 patients, 11 were male and 4 were female, age ranged from 2 months to 69 months. The clinical manifestations of 14 children were epilepsy and developmental delay (DD) and the remaining one showed developmental delay without seizure. The onset age of epilepsy ranged from two days to 19 months and 11 of them experienced the first attack before 1 year of age. The common seizure types were epileptic spasms and tonic seizures. Seven patients were diagnosed with Ohtahara syndrome or West syndrome. Epileptic form discharges were observed in the interictal electroencephalograms (EEG) of 11 patients, including multifocal discharges, suppression-burst and hypsarrhythmia. The brain magnetic resonance imaging of 7 children were abnormal, including myelin dysplasia, less white matter, lack of corpus callosum or hypoplasia. The follow-up time ranged from 2 months to 57 months, after the last follow-up, 3 cases were seizure free, 6 children showed partial response and the other 5 patients had no response on multitherapy. Six of 8 patients showed good responses to levetiracetam (LEV) monotherapy or in combination with other antiepileptic drugs (AEDs). Vigabatrin (VGB) was applied to 5 patients with epileptic spasms and 4 of them showed response. All patients showed different degrees of developmental delay while four of them showed autistic features. STXBP1 gene mutations were identified in all cases and there were 15 types of gene variations, including 8 missense mutations, 1 nonsense mutation, 5 frame shift mutations and 1 complex mutation. Five novel mutations were unreported before, including c.1193A>G, c.172delG, c.1769C>T, c.1038_1039delCC, c.348_351dupTGAA.Conclusions:Development delay and epilepsy are the major and independent clinical phenotypes in children with STXBP1 encephalopathy. The variation of STXBP1 gene is mainly de novo. Levetiracetam and vigabatrin may be more effective in epilepsy control than other AEDs.
10. A phenotypic and genetic study on β-propeller protein-associated neurodegeneration
Wenhui LI ; Qian CHEN ; Hua WANG ; Yuanfeng ZHANG ; Ying YANG ; Aijie LIU ; Wanting LIU ; Xinna JI ; Ziteng TENG ; Yucai CHEN ; Bingbing WU ; Haowei YANG ; Yi WANG ; Yuehua ZHANG ; Shuizhen ZHOU
Chinese Journal of Pediatrics 2019;57(11):830-836
Objective:
To summarize the clinical and genetic features of β-propeller protein-associated neurodegeneration (BPAN).
Methods:
The clinical data of 17 patients with BPAN with WDR45 gene variants were retrospectively collected at Children’s Hospital of Fudan University, Peking University First Hospital, Capital Institute of Pediatrics, Shengjing Hospital of China Medical University and Shanghai Children's Hospital from June 2016 to December 2018, and their clinical manifestations, electroencephalogram, neuroimaging and genetics were analyzed.
Results:
Seventeen cases (13 females, 4 males), aged 1.1-8.8 years, were included. The median age of seizure onset was 14.5 months, from 3 months to 24 months of age, manifested with epileptic spasm in 6 cases and focal seizures in 5 cases. Eight patients had only one seizure type and 8 patients had two or more seizure types. Nine patients had complete remission of seizures. All 16 patients with seizures had developmental delay before the seizure onset, of whom 13 patients had moderate to severe seizures. The brain magnetic resonance imaging (MRI) was abnormal in 13 patients, including cerebral atrophy (10 cases) and thinning of the corpus callosum (9 cases). The brain magnetic susceptibility weighted imaging (SWI) in preschool stage showed prominent T2 hypointense signals in bilateral globus pallidus and brainstem ventral in two cases. Five seizure types (spasm, focal, absence, myodonic and generalized tonic clonic seizures)were found on ictal electroencephalogram(EEG) recordings. Compared to female patients(17(6-24) months of ege), male cases had earlier seizure onset (3, 4, 5, 18 months of age) . All patients had de novo variations in WDR45(6 nonsense, 4 frameshift, 3 missense and 4 splicing variations), with hemizygous variants in 3 males, mosaic variants in a male and heterozygous variants in 13 females, within which 5 variations had not been reported (c.977-1C>T,c.976+1G>C,c.10C>T,c.806del and c.110T>C).
Conclusions
The patients with BPAN have profound developmental delay and are vulnerable to seizures. The male patients with BPAN tend to have more severer clinical phenotype than females. Early brain SWI could facilitate the timely diagnosis of this disease.


Result Analysis
Print
Save
E-mail