1.Construction of a core competency indicator system for prehospital emergency nursing staff in stroke
Guan HUANG ; Xingchao GENG ; Wenwen QIN ; Ziya XIAO
Chinese Journal of Modern Nursing 2024;30(10):1325-1329
Objective:To construct a core competency indicator system for prehospital emergency nursing staff in stroke.Methods:A preliminary draft of the core competency indicator system for prehospital emergency nursing staff in stroke was formulated through literature research and group discussions. From January to March 2023, 15 experts were selected, and after two rounds of Delphi expert consultations, the indicators at all levels were modified and improved to form the final version of the indicator system. The degree of expert enthusiasm was expressed as the effective response rate of the questionnaire, the degree of expert authority was expressed as the expert authority coefficient ( Cr), and the degree of expert opinion coordination was expressed as the Kendall harmony coefficient and coefficient of variation. Results:In two rounds of Delphi expert consultation, the effective response rates of the questionnaire were 100.00% and 93.33%, respectively, and the expert authority coefficients were 0.853 and 0.861. After the second round of expert consultation, the coefficient of variation for each item was from 0 to 0.23, and the Kendall's harmony coefficient was 0.185 ( P<0.01). The final constructed indicator system included four primary indicators, 14 secondary items, and 31 tertiary items. Conclusions:The constructed core competency indicator system for prehospital emergency nursing staff in stroke is scientific and reliable, and can provide reference for the training and assessment of prehospital emergency nursing staff.
2.Background data of SD rats in embryo-fetal development toxicity study
Manman ZHAO ; Zihe LIANG ; Xiaomeng LIU ; Ying YANG ; Chao WANG ; Tingting ZHAO ; Xingchao GENG ; Xiaobing ZHOU ; Sanlong WANG
Chinese Journal of Pharmacology and Toxicology 2024;38(7):526-532
OBJECTIVE To set up normal ranges for indexes in embryo-fetal development toxicity studies in Sprague-Dawley(SD)rats and to establish a background database to provide reference for the embryo-fetal development toxicity evaluation of drugs.METHODS The data on embryonic develop-ment and fetal growth from embryo-fetal development toxicity studies(11 items)conducted by our center between 2013 and 2022 was statistically analyzed,involving 205 pregnant rats and 3037 fetuses in total,with the mean and standard deviation,coefficient of variation and 95%confidence interval calculated.The indexes included body mass,body mass gain and food consumption during pregnancy,pregnancy outcomes(pregnancy rate,average corpora lutea,average Implant sites,average live conceptuses,live conceptuse rate,resorption rate and dead conceptuse rate),fetal growth and development(fetal mass,placental mass and sex ratio),appearance abnormality rate,visceral abnormality rate,and skeletal abnormality rate.RESULTS The mass of pregnant rats trended up during gestation,with significant increases in the late period.Food consumption increased along with gestation.Caesarean section was conducted on gestation day 20,and the pregnancy rate was 93.2%.The average corpora lutea,Implant sites and live conceptuses were 18.0±3.2,15.9±2.8 and 14.8±3.0,respectively.The live conceptuse rate was 93.4%while the total dead embryo rate was 6.6%.The average mass of fetuses and placenta were respectively 3.6±0.3 and(0.6±0.3)g,and the fetal sex ratio(male/female)was 0.94.The incidence of fetal appearance abnormalities was about 0.2%,and that of soft tissue abnormalities was approximately 0.8%.The rate of skeletal abnormalities was about 1.2%,with higher incidence of non-ossification and incomplete ossification mostly identified on sternum and hyoid bone.The numbers of ossifications of metacarpal bones,metatarsal bones and sacrococcygeal vertebrae were 7.0±0.7,8.0±0.1 and 7.4±0.5,respectively.The rate of ossification of sternumⅠtoⅣwas higher,with an average of about 98.6%-99.9%.The ossification rates of sternum Ⅴ and Ⅵ were(68.0±28.4)%and(82.8±23.9)%.CONCLUSION The background database of indexes in the embryo-fetal development toxicity study on SD rats is established for our GLP laboratory,which provides reference for reproductive toxicity studies.
3.Establishment of a multiplex real time quantitative PCR method for CMV promoter nucleic acid sequences detection
Yufa MIAO ; Sanlong WANG ; Xiaobing ZHOU ; Yan HUO ; Xingchao GENG ; Jianjun LYU ; Jufeng WANG ; Bo LI
Chinese Journal of Pharmacology and Toxicology 2014;(2):296-301
OBJECTIVE To establish and validate a multiplex real time quantitative PCR method for cyto megalovirus(CMV)pro moter nucleic acid sequence detection.METHODS Probes and primers were designed according to CMV pro moter sequence and mouse β-actin house-keeping gene,the a mpli-fication specificity was analyzed using SYBR Green I dissociation curve.The reaction syste m was opti-mized,the sensitivity,linearity and reproducibility of the method were validated.RESULTS Forward primer sequence for CMV pro moter sequence were 5′AGACTTGGAAATCCCCGTGAGT3′;reverse prim-er sequence were 5′CGTATTAGTCATCGCTATTACCATGGT3′;probe sequence were 5′AACCGC-TATCCACGCCCATTGATG3′. Forward primer sequence for β-actin gene were 5′CCTGAG-GCTCTTTTCCAGCC3′; reverse primer sequence were 5′TAGAGGTCTTTACGGATGTCAACGT3′;probe sequences were 5′TCCTTCTTGGGTATGGAATCCTGTGGC3′.Reaction efficiency of the CMV standard curve reached 100%, correlation coefficient reached 0.9978, quantification margin was between 1 .5 ×102 and 1 .5 ×107 copies,and sensitivity of the reaction reached 30 copies.CONCLUSION The multiplex method that could absolutely quantify the copies of CMV pro moter sequence is established.
4.Effects of echinacoside on protein expression from substantia nigra and striatal tissue in mouse MPTP model of Parkinsons disease by using 2-dimensional electrophoresis analysis
Xin ZHAO ; Xiaoping PU ; Xingchao GENG
Chinese Pharmacological Bulletin 1987;0(01):-
Aim To study the effect of echinacoside on behavior and proteins expression from substantia nigra and striatal tissue in MPTP mouse model of Parkinsons disease(PD)and discover the mechanism of its potential dopaminergic neuroprotective effect in the protein level.Methods The mouse model of PD was induced by 1-Methyl-4-phenyl-1,2,3,6-tetrahydropyridine(MPTP)and the behavioral analysis of C57BL/6 mice was performed by using spontaneous movement and rotarod test.A proteomic approach based on 2-dimensional electrophoresis(2-DE),mass spectrometry(MS)and figure analysis was used to evaluate the effect of echinacoside on the behavior and the protein expression in substantia nigra and striatal tissue in C57BL/6 mice after MPTP administration.Results ① Compared with control,MPTP lesion significantly reduced the number of spontaneous movement and latent period of mice on the rotating rod(both P

Result Analysis
Print
Save
E-mail