AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

ObjectiveThis paper aims to investigate and evaluate the staged efficacy and safety of the representative empirical prescription of the “Zhu Ke Jiao” theory， Qijia Rougan prescription， combined with entecavir in the treatment of hepatic fibrosis in chronic hepatitis B. MethodsA multicenter randomized controlled clinical study was conducted， and 101 patients diagnosed with chronic hepatitis B-related hepatic fibrosis （CHB-HF） who met the diagnosis and inclusion criteria were randomly assigned to an observation group （Qijia Rougan prescription + entecavir） and a control group （entecavir）. The treatment duration was 24 weeks. Liver stiffness measurement （LSM）， fibrosis-4 index （FIB-4）， portal vein diameter， hepatitis B serology， biochemical indicators， hepatic fibrosis markers in serum ［hyaluronic acid （HA）， laminin （LN）， procollagen Ⅲ peptide （PⅢP）， and type Ⅳ collagen （Ⅳ-C）］， and traditional Chinese medicine syndrome scores were used as efficacy evaluation indicators. Efficacy assessments and explorations of different staged subgroups of Qijia Rougan prescription were conducted according to LSM values based on the Metavir pathological staging standard. ResultsA total of 98 cases were included for statistical analysis， with 49 cases in the observation group and 49 in the control group. The general data of the patients in both groups were comparable. Compared with the same group before treatment， the observation group showed a significant reduction in LSM and FIB-4 （P<0.01）， as well as notable improvements in LN， Ⅳ-C， and various TCM syndrome scores （P<0.05， P<0.01）. When compared to the control group after treatment， the observation group demonstrated significant improvements in LSM， FIB-4， and various TCM syndrome score indicators （P<0.05， P<0.01）， indicating that the observation group performed better than the control group. Subgroup analysis of the regression of hepatic fibrosis stages showed that compared to the same group before treatment， the observation group had better improvement in regression of stages F2 and F3 （P<0.05）. When compared to the control group after treatment， the observation group exhibited superior improvement in regression of stage F3 （P<0.05）. No adverse events occurred in either group during the treatment period. ConclusionCompared with entecavir alone， the combination of Qijia Rougan prescription and entecavir significantly improves the degree of hepatic fibrosis and clinical TCM symptoms in patients. The optimal intervention period is primarily during stage F3， which is a potential “interception” point of the “Zhu Ke Jiao” theory.

Since its emergence in the 1980s, the human immunodeficiency virus (HIV) has caused a global pandemic, posing a severe threat to human life and health as well as social development. Although pre-exposure prophylaxis (PrEP) effectively curbs HIV transmission and antiretroviral therapy (ART) significantly extends the lifespan of patients, vaccines remain a pivotal tool for blocking transmission and ending the pandemic. The high genetic variability of HIV-1, the glycan shield of its envelope glycoproteins, and the long-term persistence of latent reservoirs have repeatedly led to bottlenecks in traditional vaccine strategies. In recent years, mRNA technology has offered a novel approach to addressing these challenges, leveraging advantages such as sequence programmability, short production cycles, native conformational expression of antigens, and self-adjuvant effects. In recent years, mRNA vaccine technology has emerged as a transformative solution to longstanding vaccinology challenges, characterized by its sequence programmability, rapid production cycles, native conformational antigen expression, and intrinsic self-adjuvanting properties. Unlike traditional platforms reliant on pathogen culture or recombinant proteins, mRNA vaccines can be expeditiously designed and updated based solely on viral genomic sequences. Lipid nanoparticle (LNP)-encapsulated mRNA facilitates endogenous antigen expression and presentation, simultaneously eliciting potent humoral and cellular immune responses. Within this landscape, self-amplifying mRNA (saRNA) further extends in vivo antigen expression to enhance the persistence of immune responses. Moreover, the LNP delivery system not only protects mRNA from degradation and mediates endosomal escape but also synergizes with mRNA to optimize immune activation via self-adjuvant effects. Importantly, mRNA platforms circumvent the pre-existing immunity associated with viral vectors and the genomic integration risks of DNA vaccines, positioning them as a cornerstone for global pandemic preparedness. This review systematically delineates recent advances in mRNA technology for HIV-1 vaccine development, focusing on four pivotal research frontiers. First, mRNA innovations building upon the RV144 trial optimize antigens through codon modification and multivalent designs to induce more durable and broad-spectrum immunity. Second, particulate mRNA vaccine strategies, utilizing virus-like particles (VLPs) and ferritin nanoparticles, achieve in situ antigen self-assembly, significantly enhancing B cell activation and reducing infection risks in non-human primate models. Third, germline-targeting mRNA vaccines address the low-affinity barrier of broadly neutralizing antibody (bNAp) precursors, efficiently activating rare precursor B cells and promoting affinity maturation. Fourth, therapeutic mRNA vaccines offer unique advantages for an HIV functional cure; combining immunogens with mRNA-encoded adjuvants potentiates cellular immunity, while LNP-mediated “shock-and-kill” strategies specifically activate latent reservoirs to guide immune clearance. Comparative analyses with traditional platforms reveal that mRNA technology redefines antigen production and presentation, simulating chronic infection through sustained expression and enabling dual-pathway presentation via endogenous synthesis. Furthermore, we explore the mechanistic innovations of mRNA vaccines in inducing bNAps: sustained in vivo production prolongs the activation window for precursor B cells and maintains germinal center (GC) reactions; endogenously expressed antigens adopt native conformations to expose conserved epitopes; and self-adjuvanting effects modulate the functions of antigen-presenting cells (APCs) and follicular helper T cells (Tfh), driving somatic hypermutation and affinity maturation. We also address critical clinical translation challenges, including immune durability, adaptability to special populations, and large-scale LNP manufacturing, while proposing targeted optimization strategies. In conclusion, this review establishes a theoretical framework for utilizing mRNA technology to overcome HIV-1 immune escape, transitioning from a descriptive paradigm to a problem-solving-based synthesis of evidence. By integrating preclinical and early clinical data, we bridge the gap between basic design and translational verification. mRNA technology is poised to become a central pillar inHIV-1 prevention and therapy, providing a robust toolset to achieve the global goal of ending the AIDS pandemic and offering a blueprint for vaccine development against other recalcitrant infectious diseases.

ObjectiveThe malaria parasites remodel the host erythrocyte structure by exporting parasite proteins that interact with the membrane skeleton proteins of red blood cells (RBCs), facilitating their intracellular survival and pathogenicity. Skeleton-binding protein 1 (SBP1) is a conserved exported protein across Plasmodium species. In Plasmodium falciparum, SBP1 has been reported to interact with erythrocyte membrane skeleton proteins 4.1R and spectrin, while its contribution to erythrocyte remodeling and parasite virulence in Plasmodium berghei (Pb) remains unclear. This study aims to determine whether PbSBP1 associates with the host cytoskeletal protein 4.1R and to investigate its role in the remodeling of host RBCs and the pathogenicity of Plasmodium berghei. MethodsIn Plasmodium berghei, the relationship between PbSBP1 and the erythrocyte cytoskeletal protein 4.1R was examined using co-immunoprecipitation. A Pbsbp1 gene knockout mutant of Plasmodium berghei (Pbsbp1∆) was generated based on the principle of double crossover homologous recombination. The deformability of erythrocytes infected with Pbsbp1∆ parasites was assessed using microfluidic methods. Microchannels with an array of cylindrical pillars were used to detect modifications in infected RBC deformability. The infected RBCs were squashed between the rows and recovered between the columns and the transit velocity (μm/s) of infected RBCs travelling through the microchannel was recorded. The component of the erythrocyte membrane skeleton junctional complex, tropomodulin (TMOD), was fluorescently labeled, and the cytoskeletal network of infected erythrocytes was imaged using super-resolution stochastic optical reconstruction microscopy (STORM) to analyze ultrastructural changes in the cytoskeleton of wild-type (WT) and Pbsbp1∆-infected erythrocytes. Actin-based junctional complexes were displayed as individual clusters by the labeled TMOD in the STORM images, and the cluster densities and distances between adjacent clusters of infected RBCs were calculated. Additionally, rodent malaria models (BALB/c mice) and experimental cerebral malaria models (C57BL/6 mice) were employed to monitor the growth of Pbsbp1∆ and WT parasites during the intraerythrocytic stage and their capacity to induce cerebral malaria in mice. ResultsPbSBP1 may participate in the remodeling of infected erythrocytes through direct or indirect interaction with the erythrocyte cytoskeletal protein 4.1R. Microfluidic assays revealed that the deformability of erythrocytes infected with Pbsbp1∆ parasites was significantly enhanced compared to those infected with WT parasites. STORM imaging further demonstrated that the ultrastructure of the erythrocyte cytoskeleton in Pbsbp1∆-infected cells was altered relative to that in WT-infected erythrocytes. The distances between nearest neighbors of clusters had a tendency to increase while the cluster densities were decreased in Pbsbp1∆-infected RBCs compared to WT-infected RBCs. Subsequent phenotypic analysis indicated that the growth rate of Pbsbp1∆ parasites during the intraerythrocytic stage was significantly slower than that of WT parasites, and their ability to induce cerebral malaria in mice was also attenuated. These findings suggest that PbSBP1 is involved in the remodeling of the erythrocyte membrane skeleton, likely through its direct or indirect interaction with protein 4.1R, thereby regulating the deformability of infected erythrocytes and influencing the pathogenicity of the blood-stage parasites. ConclusionThis study establishes a role for PbSBP1 in host erythrocyte remodeling and parasite virulence, providing new research strategies for the prevention and treatment of malaria.

ObjectiveThis paper aims to investigate the differential mechanisms underlying the staged therapeutic effects of Qijia Rougan formula on liver fibrosis using proteomic technology. MethodsThe staged rat model of liver fibrosis was established by subcutaneous injection of carbon tetrachloride （CCl₄） and olive oil. One hundred and four SD rats were randomized into thirteen groups：a normal group，a two-week model group，a four-week model group，a six-week model group，an eight-week model group，a two-week Qijia Rougan formula group，a four-week Qijia Rougan formula group，a six-week Qijia Rougan formula group，an eight-week Qijia Rougan formula group，a two-week compound Biejia Ruangan tablet group，a four-week Compound Biejia Ruangan Tablet group，a six-week Compound Biejia Ruangan Tablet group，and an eight-week compound Biejia Ruangan tablet group. After two weeks of drug intervention，liver tissue and abdominal aortic blood samples were collected from the rats for testing. Hematoxylin-eosin （HE） staining，Masson staining，and Picro Sirius red staining were used to observe pathological damage and collagen fiber deposition in liver tissues. Immunohistochemistry （IHC） was employed to detect the contents of fibrosis markers in liver tissues. The contents of liver function indicators in the serum were measured using a fully automated biochemical analyzer，and the levels of liver fibrosis indicators in the serum were assessed by enzyme-linked immunosorbent assay （ELISA）. Liver tissues from the normal group，each model group，and each Qijia Rougan formula group were subjected to label-free quantitative proteomic analysis to identify differential proteins among the groups，with key proteins validated by Western blot. Finally，bioinformatics analysis was performed on the differential proteins. Results（1） The staged rat model of liver fibrosis constructed with CCl₄ and olive oil showed pathological results at the 2^nd，4^th，6^th，and 8^th weeks of modeling that were consistent with the Metavir standards for the F1，F2，F3，and F4 stages. Compared with those in the normal control group，the protein expressions of α-smooth muscle actin （α-SMA） and Collagen Ⅰ were significantly increased in each stage （P<0.05）. The levels of liver function indicators in the serum，including alanine aminotransferase （ALT），aspartate aminotransferase （AST），alkaline phosphatase （ALP），direct bilirubin （DBIL），and total bilirubin （TBil） in each model group，were significantly elevated in each stage （P<0.01）. The levels of liver fibrosis indicators in the serum，including procollagen Ⅲ peptide （PⅢP），type Ⅳ collagen（Ⅳ-C），hyaluronic acid （HA），and laminin （LN） in each model group，were significantly increased in each stage （P<0.05，P<0.01）. This study successfully established a staged rat model of liver fibrosis. （2） Compared with the model groups at each stage，the administration groups showed a reduction in hepatocyte ballooning degeneration，a more orderly arrangement of hepatocytes，and a decrease of inflammatory cell infiltration. The blue-stained collagen fibers became significantly thinner and finer，with reduced and narrowed fibrous septa. The areas of collagen fibers and Picro Sirius red staining were reduced （P<0.05）. The positive areas of α-SMA and Collagen Ⅰ expression were significantly decreased （P<0.05）. The levels of ALT，AST，ALP，DBIL，and TBil in the rats of the model groups at each stage were significantly reduced （P<0.05，P<0.01）. The levels of PⅢP，Ⅳ-C，HA，and LN in the rats of the model groups at each stage were significantly decreased （P<0.05）. Among these，the improvements in all indicators were most significant in the F3 stage （P<0.01）.（3） The proteomic results show that a total of 165 differential proteins exhibit a callback trend when comparing the model groups at four stages with the normal group，and when comparing the Qijia Rougan formula group with the model group. Western blot analysis reveals that the levels of NAD（P）H：quinone oxidoreductase 1 （NQO1），mitogen-activated protein kinase 1 （MAPK1），arginase 1 （Arg1），and glutathione S-transferase α1 （GSTA1） were consistent with the proteomic results. Bioinformatics results reveal that 165 differentially expressed proteins are enriched in multiple signaling pathways. Notably，signaling pathways such as drug metabolism-cytochrome P450，arginine biosynthesis，and the peroxisome proliferator-activated receptor （PPAR） signaling pathway were found to be closely associated with liver fibrosis，suggesting that the Qijia Rougan formula may exert its staged regulatory effects on liver fibrosis by regulating these pathways. ConclusionThe Qijia Rougan formula may achieve staged regulation of liver fibrosis by regulating drug metabolism-cytochrome P450，arginine biosynthesis，and the PPAR signaling pathway.

To investigate the effect of mesenchymal stromal cells (MSCs) on the fibrosis progression and endometrial regeneration in mouse models of endometrial injury, a mouse endometrial injury model was established by physical scraping combined with lipopolysaccharide (LPS) chemical induction, and the endometrium morphology and collagen deposition were evaluated by HE and Masson staining after unilateral administration of MSCs. RT-qPCR and immunofluorescence were used to detect the expression of epithelial markers Epcam and collagen I (Col1). Primary endometrial epithelial cells were isolated to assess p21 expression. Fibrosis-related genes and signaling pathways were validated using transcriptome sequencing and RT-qPCR. The experimental results showed that MSCs increased endometrial thickness and number of glands (P<0.05), up-regulated the expression of Epcam (P<0.01), while significantly reducing uterine collagen fiber deposition (P<0.05) and the expression of p21 in primary epithelial cells (P<0.0001). Transcriptomic analysis revealed that MSCs attenuated collagen deposition by modulating genes involved in the TGF-β signaling pathway. This study elucidates that MSCs facilitate uterine repair by reversing endometrial fibrosis and promoting epithelial regeneration, and their role is related to the regulation of the TGF-β/SMAD pathway and suppression of aberrant collagen accumulation.

AIM To investigate the mechanism of Jiedu Yizhi Formula on cognitive function and neuroinflammation in a mouse model of Alzheimer's disease(AD).METHODS 50 APP/PS1 double transgenic mice were randomly divided into the model group,the donepezil group,and the low-dose,moderate-dose,and high-dose Jiedu Yizhi Formula group(1.78,3.56 and 7.12 g/kg),with 10 mice in each group,in contrast to the 10 WT mice of the blank group.Following anesthesia administration and 8-week oral gavage regimen with respective drugs,all mice underwent final tissue sample collection.The mice had their learning and memory ability assessed by Morris water maze and nesting behavior scores;their pathology of brain tissue and Aβ expression observed using HE,Nissl and IHC staining;their polarization of microglia and the expression of inflammatory factors in hippocampal tissue detected by IF and ELISA;their hippocampal expression of PI3K/Akt/mTOR signaling pathway detected by RT-qPCR and Western blot.RESULTS Compared with the blank group,the model group had lower scores in total swimming distance,frequency in crossing the platform,residence time in the target quadrant,and nesting behavior scores(P＜0.05,P＜0.01);prolonged evasion latency(P＜0.01);more disorganized arrangement of pyramidal cells,solidification and deep staining,unclear demarcation,irregular cell shapes,reduction of Nyctinidia,and increased Aβ deposition in the brain tissue(P＜0.01);elevated expression of hippocampal microglia M1-type markers CD16/32 and lba-1(P＜0.01);decreased levels of M2-type marker CD206(P＜0.05);elevated levels of TNF-α and IL-1β(P＜0.01);decreased expressions of IL-13 and IL-4(P＜0.01);and decreased levels of PI3K,Akt and mTOR mRNA,and reduced p-PI3K,p-Akt and p-mTOR protein expressions(P＜0.01).Compared to the model group,the donepezil group and the Jiedu Yizhi Formula groups showed statistically significant improvements in the aforementioned indexes(P＜0.05,P＜0.01),with the magnitude of improvement being higher in the high-dose Jiedu Yizhi Formula group.CONCLUSION Jiedu Yizhi Formula suppresses microglia Ml-type polarization while enhancing M2-type polarization via activation the PI3K/Akt/mTOR signaling pathway,which subsequently reduces inflammatory cytokine secretion.This mechanism attenuates Aβ deposition in brain tissues and ameliorates cognitive dysfunction in AD mouse models.

AIM:To elucidate the pharmacody-namic and network pharmacological mechanisms of total flavonoids of Carthamus tinctorius L.,to ex-plore their key targets and related pathways,and to clarify their mechanism of action against hepatic fibrosis.METHODS:The total flavonoids of Cartha-mus tinctorius L.were determined by LC-MS/MS and analysed for their compositions;the active in-gredients were screened by TCMSP database,SWISS ADME database and literature search;the targets related to total flavonoids of Carthamus tinctorius L.were screened by Swiss Target Predic-tion database;and the targets related to hepatic fi-brosis were screened by GeneCards database;the anti-hepatic fibrosis targets of total flavonoids of Carthamus tinctorius L.were obtained by taking the intersection of Venny.2.1.0;the protein interac-tions were analysed by STRING database;the visu-alization analysis was carried out by Cytoscape soft-ware;the GO function and KEGG pathway analysis was carried out by Metascape platform;and molec-ular docking was verified by using AutoDock soft-ware for the core targets and active ingredients.The mechanism of anti-hepatic fibrosis of total fla-vonoids of Carthamus tinctorius L.was verified by animal model and in vitro cell experiments.RE-SULTS:A total of 41 flavonoid components were identified in Carthamus tinctorius L.Through the network pharmacological analysis,149 anti-hepatic fibrosis targets of total flavonoids of Carthamus tinctorius L.were obtained,including 23 core tar-gets.The GO enrichment analyses involved a total of three aspects,namely,biological process(BP),cellular component(CC),and molecular function(MF).KEGG enrichment results showed that PI3K/Akt and MAPK are pathways involved in the devel-opment of hepatic fibrosis.Molecular docking veri-fied that the active ingredients Quercetin,Acacetin and Glabridin were tightly bound to Akt1 and HI-FIA,respectively.In animal model experiments,it was observed by HE and Masson staining that fibro-plasia was reduced,collagen deposition was re-duced,inflammatory cell infiltration was reduced,and fibrotic liver tissues were improved in total fla-vonoids of Carthamus tinctorius L.administration group.In isolated cell experiments:Western blot-ting results suggested that total flavonoids of Car-thamus tinctorius L.could decrease the hepatic fi-brosis marker factor α-SMA,Collagen1(P＜0.01)and PI3K,Akt protein expression(P＜0.01).CONCLU-SION:Total flavonoids of Carthamus tinctorius L.ex-erted anti-hepatic fibrosis effects through multi-components,multi-targets and multi-pathways,and their mechanism of action may be achieved by regulating the PI3K/Akt signalling pathway.

Objective:To evaluate the effectiveness of a workshop-driven interactive teaching model in clinical alarm training for undergraduate nursing interns in the intensive care unit (ICU).Methods:A total of 120 undergraduate nursing students who interned in the ICU from November 2023 to April 2024 were enrolled and randomly assigned using a random number table into a control group ( n=60, traditional teaching) and an intervention group ( n=60, workshop-driven interactive teaching). Clinical alarm knowledge, attitudes, and practices (KAP); perception of patient safety culture; and training satisfaction were assessed before and after the training using validated questionnaires. Differences between groups were analyzed using independent sample t-test, paired sample t-test, chi-square test, and the Mann-Whitney U test with SPSS 22.0. Results:There were no significant differences between the two groups in clinical alarm KAP scores or patient safety culture perception scores before the training ( P>0.05). After the training, the intervention group showed significantly higher scores in clinical alarm KAP [(127.58±6.45) vs. (123.48±7.61), t=3.17, P=0.002] and patient safety culture perception [(99.44±9.17) vs. (95.45±12.03), t=-2.04, P=0.044] compared with the control group. Satisfaction with training content, teaching quality, and overall instructional design was significantly higher in the intervention group than in the control group ( P<0.05). Within-group comparisons showed that the intervention group had significant improvements in clinical alarm KAP [(127.58±6.45) vs. (120.10±10.25), t=-5.10, P<0.001] and patient safety culture perception [(99.44±9.17) vs. (94.46±12.12), t=-2.65, P=0.010] after training. No significant changes were observed in the control group after training ( P>0.05). Conclusions:The workshop-driven interactive teaching model can effectively enhance the clinical alarm KAP levels and patient safety culture perception among undergraduate nursing interns in the ICU. This teaching approach provides a scientific basis for optimizing clinical alarm education and cultivating high-quality nursing professionals.

The scientific research and innovation capabilities of medical students are intrinsically linked to the sustained and high-quality development of national healthcare initiatives.Cultivating outstanding medi-cal students with independent scientific capabilities and innovative consciousness is a critical component in the education and training of high-level medical professionals.Our investigation revealed that within the imperfections of the cultivating model,some faculty and students at medical schools have an insufficient understanding of scientific research and innovation and lack motivation for engaging in such activities,which hinder the progression of scientific research activities.Consequently,we initiated a teaching practice and exploratory study on the"tutorial system"aimed at fostering medical students'scientific research and innovation abilities.Based on the principle of"research informing teaching,teaching and research advan-cing together,"this study implements a"tutorial system"coordinated by tutors,supplemented by graduate and undergraduate student mentors,to cultivate innovative thinking,stimulate interest in scientific re-search,and enhance practical and research skills among medical students.Through collaborative efforts within"scientific research innovation teams,"various educational methods—including preliminary re-search,in-class and extracurricular activities,intra-group and inter-group interactions,and theoretical and practical applications—are employed to improve and strengthen the cultivation of medical students'scientif-ic research and innovation abilities.This study aims to provide valuable references for optimizing medical education management systems and enhancing the quality of medical student training.