ObjectiveThis paper aims to investigate and evaluate the staged efficacy and safety of the representative empirical prescription of the “Zhu Ke Jiao” theory， Qijia Rougan prescription， combined with entecavir in the treatment of hepatic fibrosis in chronic hepatitis B. MethodsA multicenter randomized controlled clinical study was conducted， and 101 patients diagnosed with chronic hepatitis B-related hepatic fibrosis （CHB-HF） who met the diagnosis and inclusion criteria were randomly assigned to an observation group （Qijia Rougan prescription + entecavir） and a control group （entecavir）. The treatment duration was 24 weeks. Liver stiffness measurement （LSM）， fibrosis-4 index （FIB-4）， portal vein diameter， hepatitis B serology， biochemical indicators， hepatic fibrosis markers in serum ［hyaluronic acid （HA）， laminin （LN）， procollagen Ⅲ peptide （PⅢP）， and type Ⅳ collagen （Ⅳ-C）］， and traditional Chinese medicine syndrome scores were used as efficacy evaluation indicators. Efficacy assessments and explorations of different staged subgroups of Qijia Rougan prescription were conducted according to LSM values based on the Metavir pathological staging standard. ResultsA total of 98 cases were included for statistical analysis， with 49 cases in the observation group and 49 in the control group. The general data of the patients in both groups were comparable. Compared with the same group before treatment， the observation group showed a significant reduction in LSM and FIB-4 （P<0.01）， as well as notable improvements in LN， Ⅳ-C， and various TCM syndrome scores （P<0.05， P<0.01）. When compared to the control group after treatment， the observation group demonstrated significant improvements in LSM， FIB-4， and various TCM syndrome score indicators （P<0.05， P<0.01）， indicating that the observation group performed better than the control group. Subgroup analysis of the regression of hepatic fibrosis stages showed that compared to the same group before treatment， the observation group had better improvement in regression of stages F2 and F3 （P<0.05）. When compared to the control group after treatment， the observation group exhibited superior improvement in regression of stage F3 （P<0.05）. No adverse events occurred in either group during the treatment period. ConclusionCompared with entecavir alone， the combination of Qijia Rougan prescription and entecavir significantly improves the degree of hepatic fibrosis and clinical TCM symptoms in patients. The optimal intervention period is primarily during stage F3， which is a potential “interception” point of the “Zhu Ke Jiao” theory.

AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

Since its emergence in the 1980s, the human immunodeficiency virus (HIV) has caused a global pandemic, posing a severe threat to human life and health as well as social development. Although pre-exposure prophylaxis (PrEP) effectively curbs HIV transmission and antiretroviral therapy (ART) significantly extends the lifespan of patients, vaccines remain a pivotal tool for blocking transmission and ending the pandemic. The high genetic variability of HIV-1, the glycan shield of its envelope glycoproteins, and the long-term persistence of latent reservoirs have repeatedly led to bottlenecks in traditional vaccine strategies. In recent years, mRNA technology has offered a novel approach to addressing these challenges, leveraging advantages such as sequence programmability, short production cycles, native conformational expression of antigens, and self-adjuvant effects. In recent years, mRNA vaccine technology has emerged as a transformative solution to longstanding vaccinology challenges, characterized by its sequence programmability, rapid production cycles, native conformational antigen expression, and intrinsic self-adjuvanting properties. Unlike traditional platforms reliant on pathogen culture or recombinant proteins, mRNA vaccines can be expeditiously designed and updated based solely on viral genomic sequences. Lipid nanoparticle (LNP)-encapsulated mRNA facilitates endogenous antigen expression and presentation, simultaneously eliciting potent humoral and cellular immune responses. Within this landscape, self-amplifying mRNA (saRNA) further extends in vivo antigen expression to enhance the persistence of immune responses. Moreover, the LNP delivery system not only protects mRNA from degradation and mediates endosomal escape but also synergizes with mRNA to optimize immune activation via self-adjuvant effects. Importantly, mRNA platforms circumvent the pre-existing immunity associated with viral vectors and the genomic integration risks of DNA vaccines, positioning them as a cornerstone for global pandemic preparedness. This review systematically delineates recent advances in mRNA technology for HIV-1 vaccine development, focusing on four pivotal research frontiers. First, mRNA innovations building upon the RV144 trial optimize antigens through codon modification and multivalent designs to induce more durable and broad-spectrum immunity. Second, particulate mRNA vaccine strategies, utilizing virus-like particles (VLPs) and ferritin nanoparticles, achieve in situ antigen self-assembly, significantly enhancing B cell activation and reducing infection risks in non-human primate models. Third, germline-targeting mRNA vaccines address the low-affinity barrier of broadly neutralizing antibody (bNAp) precursors, efficiently activating rare precursor B cells and promoting affinity maturation. Fourth, therapeutic mRNA vaccines offer unique advantages for an HIV functional cure; combining immunogens with mRNA-encoded adjuvants potentiates cellular immunity, while LNP-mediated “shock-and-kill” strategies specifically activate latent reservoirs to guide immune clearance. Comparative analyses with traditional platforms reveal that mRNA technology redefines antigen production and presentation, simulating chronic infection through sustained expression and enabling dual-pathway presentation via endogenous synthesis. Furthermore, we explore the mechanistic innovations of mRNA vaccines in inducing bNAps: sustained in vivo production prolongs the activation window for precursor B cells and maintains germinal center (GC) reactions; endogenously expressed antigens adopt native conformations to expose conserved epitopes; and self-adjuvanting effects modulate the functions of antigen-presenting cells (APCs) and follicular helper T cells (Tfh), driving somatic hypermutation and affinity maturation. We also address critical clinical translation challenges, including immune durability, adaptability to special populations, and large-scale LNP manufacturing, while proposing targeted optimization strategies. In conclusion, this review establishes a theoretical framework for utilizing mRNA technology to overcome HIV-1 immune escape, transitioning from a descriptive paradigm to a problem-solving-based synthesis of evidence. By integrating preclinical and early clinical data, we bridge the gap between basic design and translational verification. mRNA technology is poised to become a central pillar inHIV-1 prevention and therapy, providing a robust toolset to achieve the global goal of ending the AIDS pandemic and offering a blueprint for vaccine development against other recalcitrant infectious diseases.

ObjectiveThe malaria parasites remodel the host erythrocyte structure by exporting parasite proteins that interact with the membrane skeleton proteins of red blood cells (RBCs), facilitating their intracellular survival and pathogenicity. Skeleton-binding protein 1 (SBP1) is a conserved exported protein across Plasmodium species. In Plasmodium falciparum, SBP1 has been reported to interact with erythrocyte membrane skeleton proteins 4.1R and spectrin, while its contribution to erythrocyte remodeling and parasite virulence in Plasmodium berghei (Pb) remains unclear. This study aims to determine whether PbSBP1 associates with the host cytoskeletal protein 4.1R and to investigate its role in the remodeling of host RBCs and the pathogenicity of Plasmodium berghei. MethodsIn Plasmodium berghei, the relationship between PbSBP1 and the erythrocyte cytoskeletal protein 4.1R was examined using co-immunoprecipitation. A Pbsbp1 gene knockout mutant of Plasmodium berghei (Pbsbp1∆) was generated based on the principle of double crossover homologous recombination. The deformability of erythrocytes infected with Pbsbp1∆ parasites was assessed using microfluidic methods. Microchannels with an array of cylindrical pillars were used to detect modifications in infected RBC deformability. The infected RBCs were squashed between the rows and recovered between the columns and the transit velocity (μm/s) of infected RBCs travelling through the microchannel was recorded. The component of the erythrocyte membrane skeleton junctional complex, tropomodulin (TMOD), was fluorescently labeled, and the cytoskeletal network of infected erythrocytes was imaged using super-resolution stochastic optical reconstruction microscopy (STORM) to analyze ultrastructural changes in the cytoskeleton of wild-type (WT) and Pbsbp1∆-infected erythrocytes. Actin-based junctional complexes were displayed as individual clusters by the labeled TMOD in the STORM images, and the cluster densities and distances between adjacent clusters of infected RBCs were calculated. Additionally, rodent malaria models (BALB/c mice) and experimental cerebral malaria models (C57BL/6 mice) were employed to monitor the growth of Pbsbp1∆ and WT parasites during the intraerythrocytic stage and their capacity to induce cerebral malaria in mice. ResultsPbSBP1 may participate in the remodeling of infected erythrocytes through direct or indirect interaction with the erythrocyte cytoskeletal protein 4.1R. Microfluidic assays revealed that the deformability of erythrocytes infected with Pbsbp1∆ parasites was significantly enhanced compared to those infected with WT parasites. STORM imaging further demonstrated that the ultrastructure of the erythrocyte cytoskeleton in Pbsbp1∆-infected cells was altered relative to that in WT-infected erythrocytes. The distances between nearest neighbors of clusters had a tendency to increase while the cluster densities were decreased in Pbsbp1∆-infected RBCs compared to WT-infected RBCs. Subsequent phenotypic analysis indicated that the growth rate of Pbsbp1∆ parasites during the intraerythrocytic stage was significantly slower than that of WT parasites, and their ability to induce cerebral malaria in mice was also attenuated. These findings suggest that PbSBP1 is involved in the remodeling of the erythrocyte membrane skeleton, likely through its direct or indirect interaction with protein 4.1R, thereby regulating the deformability of infected erythrocytes and influencing the pathogenicity of the blood-stage parasites. ConclusionThis study establishes a role for PbSBP1 in host erythrocyte remodeling and parasite virulence, providing new research strategies for the prevention and treatment of malaria.

Objective: To evaluate the feasibility of dynamic contrast-enhanced MRI (DCE-MRI) in differentiating tumor deposits (TDs) from metastatic lymph nodes (MLNs) in rectal cancer. Materials and Methods: A retrospective analysis was conducted on 70 patients with rectal cancer, including 168 lesions (70 TDs and 98 MLNs confirmed by histopathology), who underwent pretreatment MRI and subsequent surgery between March 2019 and December 2022. The morphological characteristics of TDs and MLNs, along with quantitative parameters derived from DCE-MRI (K trans , kep, and v e) and DWI (ADCmin, ADCmax, and ADCmean), were analyzed and compared between the two groups.Multivariable binary logistic regression and receiver operating characteristic (ROC) curve analyses were performed to assess the diagnostic performance of significant individual quantitative parameters and combined parameters in distinguishing TDs from MLNs. Results: All morphological features, including size, shape, border, and signal intensity, as well as all DCE-MRI parameters showed significant differences between TDs and MLNs (all P < 0.05). However, ADC values did not demonstrate significant differences (all P > 0.05). Among the single quantitative parameters, v e had the highest diagnostic accuracy, with an area under the ROC curve (AUC) of 0.772 for distinguishing TDs from MLNs. A multivariable logistic regression model incorporating short axis, border, v e, and ADC mean improved diagnostic performance, achieving an AUC of 0.833 (P = 0.027). Conclusion The combination of morphological features, DCE-MRI parameters, and ADC values can effectively aid in the preoperative differentiation of TDs from MLNs in rectal cancer.

In order to compare the differences in growth and secondary metabolite accumulation of Panax quinquefolius between understory and field planting, growth indexes, photosynthetic characteristics, soil enzyme activities, secondary metabolite contents, and antioxidant activities of P. quinquefolius under different planting modes were examined and compared, and One-way analysis of variance(ANOVA) and correlation analyses were carried out by using the software SPSS 25.0 and GraphPad Prism 9.5. The Origin 2021 software was used for plotting. The results showed that compared with those under field planting, the plant height, leaf length, leaf width, photosynthetic rate, and chlorophyll content of P. quinquefolius under understory planting were significantly reduced, and arbuscular mycorrhizal fungi(AMF) infestation rate and infestation intensity, ginsenoside content, and antioxidant activity were significantly increased. The activities of inter-root soil urease, sucrase, and catalase increased, while the activities of non-inter-root soil urease and alkaline phosphatase increased. Correlation analyses showed that the plant height and leaf length of P. quinquefolius plant were significantly positively correlated with net photosynthetic rate, transpiration rate, chlorophyll content, and electron transfer rate(P<0.05), while ginsenoside content was significantly negatively correlated with net photosynthetic rate, chlorophyll content, and electron transfer rate(P<0.05) and significantly positively correlated with AMF infestation rate and infestation intensity(P<0.05). In addition, ginsenoside content was significantly positively correlated with the activities of inter-root soil sucrase, urease, and catalase(P<0.05). This study provides basic data for revealing the mechanism of secondary metabolite accumulation in P. quinquefolius under understory planting and for exploring and practicing the ecological mode of P. quinquefolius under understory planting.
Panax/microbiology* ; China ; Secondary Metabolism ; Soil/chemistry* ; Photosynthesis ; Plant Leaves/metabolism* ; Chlorophyll/metabolism* ; Mycorrhizae

This study aims to investigate the protective effects and mechanisms of polysaccharide extract PCP1 from Polygonatum cyrtonema in ameliorating cerebral ischemia-reperfusion(I/R) injury in rats through modulation of the Toll-like receptor 4(TLR4)/NOD-like receptor protein 3(NLRP3) signaling pathway. In vivo, SD rats were randomly divided into the sham group, model group, PCP1 group, nimodipine(NMDP) group, and TLR4 signaling inhibitor(TAK-242) group. A middle cerebral artery occlusion/reperfusion(MCAO/R) model was established, and neurological deficit scores and infarct size were evaluated 24 hours after reperfusion. Hematoxylin-eosin(HE) and Nissl staining were used to observe pathological changes in ischemic brain tissue. Transmission electron microscopy(TEM) assessed ultrastructural damage in cortical neurons. Enzyme-linked immunosorbent assay(ELISA) was used to measure the levels of interleukin-1β(IL-1β), interleukin-6(IL-6), interleukin-18(IL-18), tumor necrosis factor-α(TNF-α), interleukin-10(IL-10), and nitric oxide(NO) in serum. Immunofluorescence was used to analyze the expression of TLR4 and NLRP3 proteins. In vitro, a BV2 microglial cell oxygen-glucose deprivation/reperfusion(OGD/R) model was established, and cells were divided into the control, OGD/R, PCP1, TAK-242, and PCP1 + TLR4 activator lipopolysaccharide(LPS) groups. The CCK-8 assay evaluated BV2 cell viability, and ELISA determined NO release. Western blot was used to analyze the expression of TLR4, NLRP3, and downstream pathway-related proteins. The results indicated that, compared with the model group, PCP1 significantly reduced neurological deficit scores, infarct size, ischemic tissue pathology, cortical cell damage, and the levels of inflammatory factors IL-1β, IL-6, IL-18, TNF-α, and NO(P<0.01). It also elevated IL-10 levels(P<0.01) and decreased the expression of TLR4 and NLRP3 proteins(P<0.05, P<0.01). Moreover, in vitro results showed that, compared with the OGD/R group, PCP1 significantly improved BV2 cell viability(P<0.05, P<0.01), reduced cell NO levels induced by OGD/R(P<0.01), and inhibited the expression of TLR4-related inflammatory pathway proteins, including TLR4, myeloid differentiation factor 88(MyD88), tumor necrosis factor receptor-associated factor 6(TRAF6), phosphorylated nuclear factor-kappaB dimer RelA(p-p65)/nuclear factor-kappaB dimer RelA(p65), NLRP3, cleaved-caspase-1, apoptosis-associated speck-like protein(ASC), GSDMD-N, IL-1β, and IL-18(P<0.05, P<0.01). The protective effects of PCP1 were reversed by LPS stimulation. In conclusion, PCP1 ameliorates cerebral I/R injury by modulating the TLR4/NLRP3 signaling pathway, exerting anti-inflammatory and anti-pyroptotic effects.
Animals ; Toll-Like Receptor 4/genetics* ; NLR Family, Pyrin Domain-Containing 3 Protein/genetics* ; Rats, Sprague-Dawley ; Rats ; Reperfusion Injury/genetics* ; Male ; Signal Transduction/drug effects* ; Polysaccharides/isolation & purification* ; Polygonatum/chemistry* ; Brain Ischemia/genetics* ; Drugs, Chinese Herbal/administration & dosage* ; Mice ; Humans

The zebrafish model has attracted much attention due to its strong reproductive ability, short research cycle, and ease of maintenance. It has always been an important vertebrate model system, often used to carry out human disease research. Its motor behavior features have the advantages of being simpler, more intuitive, and quantifiable. In recent years, it has received widespread attention in the study of traditional Chinese medicine(TCM)for the treatment of sleep disorders, neurodegenerative diseases, fatigue, epilepsy, and other diseases. This paper reviews the characteristics of zebrafish motor behavior and its applications in the pharmacodynamic verification and mechanism research of TCM extracts, active ingredients, and TCM compounds, as well as in active ingredient screening and safety evaluation. The paper also analyzes its advantages and disadvantages, with the aim of improving the breadth and depth of zebrafish and its motor behavior applications in the field of TCM research.
Zebrafish/physiology* ; Medicine, Chinese Traditional ; Drugs, Chinese Herbal/therapeutic use* ; Disease Models, Animal ; Drug Evaluation, Preclinical/methods* ; Animals ; Sleep Wake Disorders/physiopathology* ; Epilepsy/physiopathology* ; Neurodegenerative Diseases/physiopathology* ; Fatigue/physiopathology* ; Behavior, Animal/physiology* ; Motor Activity/physiology*

OBJECTIVES: To report the development, validation, and findings of the Multi-dimensional Attention Rating Scale (MARS), a self-report tool crafted to evaluate six-dimension attention levels. METHODS: The MARS was developed based on Classical Test Theory (CTT). Totally 202 highly educated healthy adult participants were recruited for reliability and validity tests. Reliability was measured using Cronbach's alpha and test-retest reliability. Structural validity was explored using principal component analysis. Criterion validity was analyzed by correlating MARS scores with the Toronto Hospital Alertness Test (THAT), the Attentional Control Scale (ACS), and the Attention Network Test (ANT). RESULTS: The MARS comprises 12 items spanning six distinct dimensions of attention: focused attention, sustained attention, shifting attention, selective attention, divided attention, and response inhibition.As assessed by six experts, the content validation index (CVI) was 0.95, the Cronbach's alpha for the MARS was 0.78, and the test-retest reliability was 0.81. Four factors were identified (cumulative variance contribution rate 68.79%). The total score of MARS was correlated positively with THAT (r = 0.60, P < 0.01) and ACS (r = 0.78, P < 0.01) and negatively with ANT's reaction time for alerting (r = -0.31, P = 0.049). CONCLUSIONS The MARS can reliably and validly assess six-dimension attention levels in real-world settings and is expected to be a new tool for assessing multi-dimensional attention impairments in different mental disorders.
Humans ; Adult ; Male ; Attention/physiology* ; Female ; Middle Aged ; Reproducibility of Results ; Young Adult ; Psychometrics

Objective: To evaluate the feasibility of dynamic contrast-enhanced MRI (DCE-MRI) in differentiating tumor deposits (TDs) from metastatic lymph nodes (MLNs) in rectal cancer. Materials and Methods: A retrospective analysis was conducted on 70 patients with rectal cancer, including 168 lesions (70 TDs and 98 MLNs confirmed by histopathology), who underwent pretreatment MRI and subsequent surgery between March 2019 and December 2022. The morphological characteristics of TDs and MLNs, along with quantitative parameters derived from DCE-MRI (K trans , kep, and v e) and DWI (ADCmin, ADCmax, and ADCmean), were analyzed and compared between the two groups.Multivariable binary logistic regression and receiver operating characteristic (ROC) curve analyses were performed to assess the diagnostic performance of significant individual quantitative parameters and combined parameters in distinguishing TDs from MLNs. Results: All morphological features, including size, shape, border, and signal intensity, as well as all DCE-MRI parameters showed significant differences between TDs and MLNs (all P < 0.05). However, ADC values did not demonstrate significant differences (all P > 0.05). Among the single quantitative parameters, v e had the highest diagnostic accuracy, with an area under the ROC curve (AUC) of 0.772 for distinguishing TDs from MLNs. A multivariable logistic regression model incorporating short axis, border, v e, and ADC mean improved diagnostic performance, achieving an AUC of 0.833 (P = 0.027). Conclusion The combination of morphological features, DCE-MRI parameters, and ADC values can effectively aid in the preoperative differentiation of TDs from MLNs in rectal cancer.