ObjectiveTo investigate the effect of quercetin on acute gouty arthritis （GA） in rats by inhibiting the reactive oxygen species （ROS）/NOD-like receptor protein 3 （NLRP3）/interleukin-1β （IL-1β） signaling pathway. MethodsSixty SPF-grade male SD rats were randomized into normal， model， colchicine （0.3 mg·kg^-1）， and low-， medium-， and high-dose （25， 50， 100 mg·kg^-1， respectively） quercetin groups （n=10）. The rats in the dosing groups were administrated with the corresponding drugs （10 mL·kg^-1） by gavage once a day for one week. An equal volume of normal saline was given by gavage to rats in normal and model groups. One hour after drug administration on day 5， an acute GA model was established in other groups except the control group via intra-articular injection of monosodium urate （MSU） suspension into the right posterior ankle joint cavity. The joint swelling and gait were scored at the time points of 6， 12， 24， 48 h after modeling. Histopathological alterations in the ankle joint tissue from each group were assessed by hematoxylin-eosin （HE） staining. Malondialdehyde （MDA）， xanthine oxidase （XOD）， and total superoxide dismutase （T-SOD） assay kits were used to assess the levels of MDA， XOD， and T-SOD in the serum. The levels of tumor interleukin-6 （IL-6）， necrosis factor-α （TNF-α）， and IL-1β in the rat serum， as well as ROS in the ankle joint tissue， were measured by enzyme-linked immunosorbent assay （ELISA）. Western blot was performed to determine the protein levels of NLRP3， thioredoxin-interacting protein （TXNIP）， apoptosis-associated speck-like protein containing a CARD domain （ASC）， precursor cysteinyl aspartate-specific proteinase-1 （pro-Caspase-1）， cleaved Caspase-1 （Caspase-1 p20）， and IL-1β in the ankle joint tissue. Real-time PCR was employed to assess the mRNA levels of TXNIP， NLRP3， ASC， IL-1β， and TNF-α in the ankle joint tissue. ResultsCompared with the normal group， the model group exhibited decreased spontaneous activity， mental fatigue， increased ankle joint swelling and gait scores （P<0.01）， aggravated synovial tissue edema and inflammatory cell infiltration （P<0.01）， elevated levels of XOD， MDA， TNF-α， IL-1β， and IL-6 in the serum and ROS in the joint tissue （P<0.01）， a declined level of T-SOD （P<0.01）， up-regulated protein levels of NLRP3， TXNIP， ASC， pro-Caspase-1， Caspase-1 p20， and IL-1β in the ankle joint tissue （P<0.01）， and up-regulated mRNA levels of NLRP3， TXNIP， ASC， IL-1β， and TNF-α in the ankle joint tissue （P<0.01）. Compared with the model group， the medium- and high-dose quercetin groups showed improved general conditions， decreased gait scores （P<0.05， P<0.01）， reduced joint swelling （P<0.01）， alleviated synovial tissue edema and inflammatory cell infiltration （P<0.05， P<0.01）， lowered levels of XOD， MDA， TNF-α， IL-1β， and IL-6 in the serum and ROS in the joint tissue （P<0.01）， increased levels of T-SOD （P<0.01）， down-regulated protein levels of TXNIP， NLRP3， ASC， pro-Caspase-1， Caspase-1 p20， and IL-1β in the ankle joint tissue （P<0.05， P<0.01）， and down-regulated mRNA levels of TXNIP， NLRP3， ASC， IL-1β， and TNF-α in the ankle joint tissue （P<0.01）. Low-dose quercetin also ameliorated some of the above parameters （P<0.05， P<0.01）. ConclusionQuercetin exerts anti-GA effects by blocking the ROS/NLRP3/IL-1β signaling pathway， downregulating NLRP3 inflammasome activation， and inhibiting the production of pro-inflammatory cytokines including TNF-α， IL-1β， and IL-6.

AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

ObjectiveTo explore the effects of Yimei Baijiang formula （YMBJF） on colitis-associated colorectal cancer （CAC） and the nuclear factor kappaB （NF-κB） signaling pathway in mice. MethodsSixty male Balb/c mice of 4-6 weeks old were randomized into 6 groups： Normal， model， capecitabine （0.83 g·kg^-1）， and low-， medium-， and high-dose （4.63， 9.25， 18.50 g·kg^-1， respectively） YMBJF. The mouse model of CAC was established by combining azoxymethane （AOM， 10 mg·kg^-1） and dextran sulfate sodium （DSS， 2%）. At the 5^th week after the start of modeling， the capecitabine group and the YMBJF groups were respectively administrated with the corresponding doses of drugs by gavage once a day for a total of 6 weeks. The body weights and general conditions of mice were measured and observed， and the disease activity index （DAI） was scored. The tumors in the colorectal tissue were counted， and the colorectal length was measured. The histological features of the colorectal tissue in each group of mice were observed by hematoxylin-eosin （HE） staining. The levels of inflammatory cytokines including interleukin-6 （IL-6）， interleukin-1β （IL-1β）， and tumor necrosis factor-α （TNF-α） in the serum were determined by enzyme-linked immunosorbent assay （ELISA）. The expression and localization of proliferating cell nuclear antigen-67 （Ki67）， proliferating cell nuclear antigen （PCNA）， and phosphorylated nuclear transcription factor-κB p65 （p-NF-κB p65） proteins were observed by immunohistochemistry （IHC）. The apoptosis of tumor cells was observed by the TUNEL assay. The mRNA levels of IL-6，IL-1β， TNF-α， nuclear transcription factor-κB p65 （NF-κB p65）， NF-κB inhibitor alpha （IκBα）， B-cell lymphoma-2 （Bcl-2）， and Bcl-2-associated X protein （Bax） in the colorectal tissue were quantified by Real-time polymerase chain reaction（Real-time PCR）. The protein levels of NF-κB p65， phosphorylated （p）-NF-κB p65， IκBα， p-IκBα， Bcl-2， and Bax in the colorectal tissue were determined by Western blot. ResultsCompared with the model group， each YMBJF group showed decreases in DAI and tumor number （P0.01）， and the medium-dose and high-dose YMBJF groups showed increases in colorectal length （P0.05）. In addition， each YMBJF group showed alleviated colorectal mucosal pathological injury， declined levels of IL-6， IL-1β， and TNF-α in the serum （P0.05）， reduced expression of Ki67 and PCNA （P0.01）， and down-regulated expression of p-NF-κB p65 （P0.05）. The apoptosis in the medium-dose and high-dose YMBJF groups increased （P0.01）. Each YMBJF group and the capecitabine group showed down-regulated mRNA levels of IL-1β， TNF-α， IL-6， NF-κB p65， and Bcl-2 （P0.05） and up-regulated mRNA levels of IκBα and Bax （P0.05）. The mRNA level of IκBα was up-regulated， and that of Bcl-2 was down-regulated （P0.05） in the high-dose YMBJF group. The protein levels of p-IκBα and Bcl-2 were down-regulated （P0.05） in each YMBJF group. The protein levels of IκBα and Bax were up-regulated in the medium-dose and high-dose YMBJF groups （P0.01）， while those of NF-κB p65 and p-NF-κB p65 were down-regulated （P0.05）. ConclusionYMBJF can reduce the number of tumors， reduce the levels of inflammatory factors， promote tumor cell apoptosis， and inhibit tumor cell proliferation by regulating the direct effector molecules of the NF-κB signaling pathway in the mouse model of CRC.

Chronic obstructive pulmonary disease （COPD） is a chronic respiratory disease that poses a significant threat to global health， exhibiting high morbidity， disability and mortality rate， with its prevention and treatment situation becoming increasingly critical. The pathogenesis of COPD is complex， and the underlying cellular and molecular biological mechanisms remain incompletely elucidated. Programmed cell death （PCD） is the process wherein cells actively undergo demise to maintain internal environmental stability in response to certain signals or specific stimuli. Contemporary medical research indicates that the dysregulation of PCD patterns such as apoptosis， necroptosis， pyroptosis， autophagy， and ferroptosis is closely related to the onset and progression of COPD. Clarifying the molecular mechanisms of PCD in COPD may provide novel perspectives for in-depth understanding and prevention of the disease. Traditional Chinese medicine （TCM） is characterized by holistic regulation. In recent years， extensive research has been conducted in the TCM field focusing on modulating apoptosis， necroptosis， pyroptosis， autophagy， and ferroptosis for the treatment of COPD， yielding remarkable achievements. Therefore， this study systematically explored the molecular mechanism of PCD in COPD and reviewed the potential mechanisms and intervention status of TCM targeting PCD in COPD， aiming to provide insights and references for the clinical prevention， treatment and in-depth research of COPD.

ObjectiveTo explore the effects of Yimei Baijiang formula （YMBJF） on colitis-associated colorectal cancer （CAC） and the nuclear factor kappaB （NF-κB） signaling pathway in mice. MethodsSixty male Balb/c mice of 4-6 weeks old were randomized into 6 groups： Normal， model， capecitabine （0.83 g·kg^-1）， and low-， medium-， and high-dose （4.63， 9.25， 18.50 g·kg^-1， respectively） YMBJF. The mouse model of CAC was established by combining azoxymethane （AOM， 10 mg·kg^-1） and dextran sulfate sodium （DSS， 2%）. At the 5^th week after the start of modeling， the capecitabine group and the YMBJF groups were respectively administrated with the corresponding doses of drugs by gavage once a day for a total of 6 weeks. The body weights and general conditions of mice were measured and observed， and the disease activity index （DAI） was scored. The tumors in the colorectal tissue were counted， and the colorectal length was measured. The histological features of the colorectal tissue in each group of mice were observed by hematoxylin-eosin （HE） staining. The levels of inflammatory cytokines including interleukin-6 （IL-6）， interleukin-1β （IL-1β）， and tumor necrosis factor-α （TNF-α） in the serum were determined by enzyme-linked immunosorbent assay （ELISA）. The expression and localization of proliferating cell nuclear antigen-67 （Ki67）， proliferating cell nuclear antigen （PCNA）， and phosphorylated nuclear transcription factor-κB p65 （p-NF-κB p65） proteins were observed by immunohistochemistry （IHC）. The apoptosis of tumor cells was observed by the TUNEL assay. The mRNA levels of IL-6，IL-1β， TNF-α， nuclear transcription factor-κB p65 （NF-κB p65）， NF-κB inhibitor alpha （IκBα）， B-cell lymphoma-2 （Bcl-2）， and Bcl-2-associated X protein （Bax） in the colorectal tissue were quantified by Real-time polymerase chain reaction（Real-time PCR）. The protein levels of NF-κB p65， phosphorylated （p）-NF-κB p65， IκBα， p-IκBα， Bcl-2， and Bax in the colorectal tissue were determined by Western blot. ResultsCompared with the model group， each YMBJF group showed decreases in DAI and tumor number （P0.01）， and the medium-dose and high-dose YMBJF groups showed increases in colorectal length （P0.05）. In addition， each YMBJF group showed alleviated colorectal mucosal pathological injury， declined levels of IL-6， IL-1β， and TNF-α in the serum （P0.05）， reduced expression of Ki67 and PCNA （P0.01）， and down-regulated expression of p-NF-κB p65 （P0.05）. The apoptosis in the medium-dose and high-dose YMBJF groups increased （P0.01）. Each YMBJF group and the capecitabine group showed down-regulated mRNA levels of IL-1β， TNF-α， IL-6， NF-κB p65， and Bcl-2 （P0.05） and up-regulated mRNA levels of IκBα and Bax （P0.05）. The mRNA level of IκBα was up-regulated， and that of Bcl-2 was down-regulated （P0.05） in the high-dose YMBJF group. The protein levels of p-IκBα and Bcl-2 were down-regulated （P0.05） in each YMBJF group. The protein levels of IκBα and Bax were up-regulated in the medium-dose and high-dose YMBJF groups （P0.01）， while those of NF-κB p65 and p-NF-κB p65 were down-regulated （P0.05）. ConclusionYMBJF can reduce the number of tumors， reduce the levels of inflammatory factors， promote tumor cell apoptosis， and inhibit tumor cell proliferation by regulating the direct effector molecules of the NF-κB signaling pathway in the mouse model of CRC.

Chronic obstructive pulmonary disease （COPD） is a chronic respiratory disease that poses a significant threat to global health， exhibiting high morbidity， disability and mortality rate， with its prevention and treatment situation becoming increasingly critical. The pathogenesis of COPD is complex， and the underlying cellular and molecular biological mechanisms remain incompletely elucidated. Programmed cell death （PCD） is the process wherein cells actively undergo demise to maintain internal environmental stability in response to certain signals or specific stimuli. Contemporary medical research indicates that the dysregulation of PCD patterns such as apoptosis， necroptosis， pyroptosis， autophagy， and ferroptosis is closely related to the onset and progression of COPD. Clarifying the molecular mechanisms of PCD in COPD may provide novel perspectives for in-depth understanding and prevention of the disease. Traditional Chinese medicine （TCM） is characterized by holistic regulation. In recent years， extensive research has been conducted in the TCM field focusing on modulating apoptosis， necroptosis， pyroptosis， autophagy， and ferroptosis for the treatment of COPD， yielding remarkable achievements. Therefore， this study systematically explored the molecular mechanism of PCD in COPD and reviewed the potential mechanisms and intervention status of TCM targeting PCD in COPD， aiming to provide insights and references for the clinical prevention， treatment and in-depth research of COPD.

Objective To evaluate the predictive value of different machine learning models constructed in a multicenter environment for potential organ donors and verify their clinical application feasibility. Methods The study included 2 000 inpatients admitted to five domestic tertiary hospitals from January 2020 to December 2023, who met the criteria for potential organ donation assessment. They were randomly divided into a training set and an internal validation set (7∶3). Another 300 similar patients admitted to the First Affiliated Hospital of Harbin Medical University from January 2024 to April 2025 were included as an external validation set. The area under the curve (AUC), sensitivity, specificity, accuracy and F1-score of three models were compared, and the consistency of the potential organ donor determination process was tested. Multivariate logistic regression analysis was used to identify predictive factors of potential organ donors. Decision curve analysis (DCA) was employed to verify the resource efficiency of each model, and the threshold interval and intervention balance point were assessed. Results Apart from age, there were no significant differences in other basic characteristics among the centers (all P>0.05). The consistency of the potential organ donor determination process among researchers in each center was good [all 95% confidence interval (CI) lower limits >0]. In the internal validation set, the XGBoost model had the best predictive performance (AUC=0.92, 95% CI 0.89-0.94) and the best calibration (P=0.441, Brier score 0.099). In the external validation set, the XGBoost model also had the best predictive performance (AUC=0.91, 95% CI 0.88-0.94), outperforming logistic regression and random forest models. Multivariate logistic regression showed that mechanical ventilation had the greatest impact (odds ratio=2.06, 95% CI 1.54-2.76, P<0.001). DCA indicated that the XGBoost model had the highest net benefit in the threshold interval of 0.2-0.6. The “treat all” strategy only had a slight advantage at extremely low thresholds. The recommended threshold interval, which balances intervention costs and clinical benefits, considers ≥50% positive predictive value (PPV) and ≤50 referrals per 100 high-risk patients. Conclusions The XGBoost model established in a multicenter environment is accurate and well-calibrated in predicting potential organ donors. Combined with DCA, it may effectively guide the timing of clinical interventions and resource allocation, providing new ideas for the assessment and management of organ donation after brain death.

Obesity is a multi-factorial disease involving genetics, individual behavior, socio-economic status, and environmental factors, and has become a global public health issue. The food environment, as an external factor amenable to direct intervention, affects the development of obesity by shaping individual food acquisition and consumption behaviors. The food environment refers to the physical and social environment where food is accessible, and can be assessed from dimensions such as availability, accessibility, and affordability through geographic information system spatial analysis, field surveys, commercial databases, and questionnaires. Studies indicate that the food environment can influence obesity through the spatial shaping effects of dietary structure and sociobehavioral pathways. A healthy food environment is negatively correlated with the risk of obesity, whereas an unhealthy food environment is positively correlated with the risk of obesity. This paper reviews studies related to the correlation between the food environment and obesity, covering the prevalence of obesity, the definition and assessment methods of the food environment, and the mechanisms by which the food environment affects obesity. It summarizes food environment intervention strategies centered on urban planning, policies and regulations, and community education to provide a reference for obesity prevention and control.

ObjectiveBased on traditional quality evaluation of Gardeniae Fructus（GF） recorded in historical materia medica， this study systematically compared the quality differences between wild and cultivated GF from morphological characteristics， microscopic features， and contents of primary and secondary metabolites. MethodsVernier calipers and analytical balances were used to measure the length， diameter and individual fruit weight of wild and cultivated GF， and the aspect ratio was calculated. A colorimeter was used to determine the chromaticity value of wild and cultivated GF， and the paraffin sections of them were prepared by safranin-fast green staining and examined under an optical microscope to observe their microstructure. Subsequently， the contents of water-soluble and alcohol-soluble extracts of wild and cultivated GF were detected by hot immersion method under the general rule 2201 in volume Ⅳ of the 2020 edition of the Pharmacopoeia of the People's Republic of China， the starch content was measured by anthrone colorimetric method， the content of total polysaccharides was determined by phenol-sulfuric acid colorimetric method， the sucrose content was determined by high performance liquid chromatography coupled with evaporative light scattering detection（HPLC-ELSD）， and the contents of representative components in them were measured by ultra-performance liquid chromatography（UPLC）. Finally， correlation analysis was conducted between quality traits and phenotypic traits， combined with multivariate statistical analysis methods such as principal component analysis（PCA） and orthogonal partial least squares-discriminant analysis（OPLS-DA）， key differential components between wild and cultivated GF were screened. ResultsIn terms of traits， the wild GF fruits were smaller， exhibiting reddish yellow or brownish red hues with significant variation between batches. While the cultivated GF fruits are larger， displaying deeper orange-red or brownish red. The diameter and individual fruit weight of cultivated GF were significantly greater than those of wild GF， while the blue-yellow value（b^*） of wild GF was significantly higher than that of cultivated GF. In the microstructure， the mesocarp of wild GF contained numerous scattered calcium oxalate cluster crystals， while the endocarp contained stone cell class round， polygonal or tangential prolongation， undeveloped seeds were visible within the fruit. In contrast， the mesocarp of cultivated GF contained few calcium oxalate cluster crystals， or some batches exhibited extremely numerous cluster crystals. The stone cells in the endocarp were predominantly round-like， with the innermost layer arranged in a grid pattern. Seeds were basically mature， and only a few immature seeds existed in some batches. Regarding primary metabolite content， wild GF exhibited significantly higher total polysaccharide level than cultivated GF（P<0.01）. In category-specific component content， wild GF exhibited significantly higher levels of total flavonoids and total polyphenols compared to cultivated GF（P<0.01）. Analysis of 12 secondary metabolites revealed that wild GF exhibited significantly higher levels of Shanzhiside， deacetyl asperulosidic acid methyl ester， gardenoside and chlorogenic acid compared to cultivated GF（P<0.01）. Conversely， the contents of genipin 1-gentiobioside， geniposide and genipin were significantly lower in wild GF（P<0.01）. ConclusionThere are significant differences between wild and cultivated GF in terms of traits， microstructure， and contents of primary and secondary metabolites. At present， the quality evaluation system of cultivated GF remains incomplete， and this study provides a reference for guiding the production of high-quality GF medicinal materials.

OBJECTIVE To investigate the mechanism of Xihuang pill （XHP） against diffuse large B-cell lymphoma （DLBCL）. METHODS The active ingredients of XHP and potential therapeutic targets for DLBCL were identified using TCMSP， GeneCards and DisGeNET databases. Protein-protein interaction networks were constructed using the String database and Cytoscape software to screen core components and core targets. Gene ontology and Kyoto Encyclopedia of Genes and Genomes pathway enrichment analyses were then performed. The clinical relevance of core targets was analyzed using the GEPIA and PanCanSurvPlot databases. Molecular docking and molecular dynamics （MD） simulation were conducted to verify the interactions between core components and core targets， and the binding free energy was calculated using the molecular mechanics Poisson-Boltzmann surface area （MM-PBSA） method. The effects of XHP on DLBCL and the related molecular mechanisms were validated using CCK-8 assay， flow cytometry and Western blot. RESULTS Network pharmacology analysis identified 108 active ingredients of XHP and 410 potential therapeutic targets for DLBCL. Six core components （e.g.， 17 beta-estradiol， quercetin） and ten core targets [e.g.， tumor protein 53 （TP53）， proto-oncogene tyrosine-protein kinase Src （SRC）] were obtained. Enrichment analysis indicated that the anti-DLBCL effects of XHP were primarily associated with the apoptotic signaling pathway， the phosphoinositide 3-kinase （PI3K）/protein kinase B （Akt） signaling pathway and so on. Clinical correlation analysis revealed that TP53 and SRC expression were significantly up-regulated in DLBCL tissues and associated with poor patient prognosis （P＜0.05）. Molecular docking， MD simulations and MM-PBSA calculations confirmed that the SRC-quercetin complex had a mail：stronger and more stable binding affinity. In vitro experiments demonstrated that XHP concentration-dependently inhibited the proliferation of DLBCL cells； compared with control group， XHP medium- and high-dose groups could significantly induce the apoptosis of SU-DHL2 and SU-DHL4 cells， and significantly down- regulated the expressions of SRC protein， phosphorylated （p）-PI3K/PI3K and p-Akt/Akt in SU-DHL4 cells （P＜0.05）. CONCLUSIONS XHP may inhibit the proliferation and induce the apoptosis of DLBCL cells by regulating the SRC/PI3K/Akt signaling pathway.