AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

This paper introduces a real-world cohort research model for community-acquired pneumonia （CAP） based on the Jiangsu Traditional Chinese Medicine （TCM） Dominant Diseases Diagnosis and Treatment Data Platform. Firstly， data cleaning is performed by standardizing diagnosis， symptoms， treatment and imaging， intelligently extracting unstructured information， and cleaning and constructing a standardized database. Secondly， for cohort establishment， CAP patients across the province are screened in accordance with CAP diagnostic criteria to build a high-quality disease-specific cohort. Lastly， in terms of protocol design， the characteristics of TCM research and the CAP disease profile are considered to determine appropriate inclusion and exclusion criteria， estimate sample size， define interventions， outcomes and economic evaluations， providing a reference for real-world TCM research on CAP.

This paper introduces a real-world cohort research model for community-acquired pneumonia （CAP） based on the Jiangsu Traditional Chinese Medicine （TCM） Dominant Diseases Diagnosis and Treatment Data Platform. Firstly， data cleaning is performed by standardizing diagnosis， symptoms， treatment and imaging， intelligently extracting unstructured information， and cleaning and constructing a standardized database. Secondly， for cohort establishment， CAP patients across the province are screened in accordance with CAP diagnostic criteria to build a high-quality disease-specific cohort. Lastly， in terms of protocol design， the characteristics of TCM research and the CAP disease profile are considered to determine appropriate inclusion and exclusion criteria， estimate sample size， define interventions， outcomes and economic evaluations， providing a reference for real-world TCM research on CAP.

[Objective] To analyze the loss rate of platelet donors and evaluate the strategies for establishing a platelet donor bank. [Methods] A total of 1 443 donors who joined the HLA and HPA gene donor bank for platelets in Henan Province from 2018 to 2020 were included in this study. Data on the total number of apheresis platelet donations, annual donation frequency, age at enrollment, donation habits (including the number of platelets donated per session and whether they had previously donated whole blood), and enrollment location were collected from the platelet donor information management system. Donor loss was determined based on the date of their last donation. The loss rates of different groups under various conditions were compared to assess the enrollment strategies. [Results] By the time the platelet bank was officially operational in 2022, 421 donors had been lost, resulting in an loss rate of 29% (421/1 443). By the end of 2023, the overall cumulative loss rate reached 52% (746/1 443). The loss rate was lower than the overall level in groups meeting any of the following conditions: total apheresis platelet donations exceeding 50, annual donation frequency of 10 or more, age at enrollment of 40 years or older, donation of more than a single therapeutic dose per session, or a history of whole blood donation two or more times. Additionally, loss rates varied across different enrollment locations, with higher enrollment numbers generally associated with higher loss rates. [Conclusion] Through a comprehensive analysis of donor loss, our center has adjusted its strategies for establishing the donor pool. These findings also provide valuable insights for other blood collection and supply institutions in building platelet donor banks.

Objective:To investigate exercise fear condition and its influencing factors in patients with coronary heart dis-ease(CHD)involving in phase Ⅱ cardiac rehabilitation after percutaneous coronary intervention(PCI).Methods:Conven-ience sampling was performed among cardiac rehabilitation patients from a Shanxi grade-A tertiary hospital between Janu-ary 2023 and June 2023.General data questionnaire,Tampa Scale for Kinesiophobia-Short Version for Heart patients(TSK-SV H),the Multidimensional Scale of Perceived Social Support(MSPSS)and the Post Percutaneous Coronary In-tervention Health Literacy Scale(PPCIHLS)were used for assessment.Pearson and Spearman rank correlation analyses were applied to investigate the relationships between social support factors and health literacy factors with patients'fear of exercise;multivariate linear regression models and quantile regression models were used to analyze the influencing factors of fear of exercise.Results:Among the 118 patients,average TSK-SV H score was(33.78±3.79)points;10.2％patients showed significant fear.The correlation analysis showed that PPCIHLS score was negatively correlated with TSK-SV H score(r=-0.423,P＜0.001).Results from multivariate regression analysis indicated that health literacy,cardiac func-tion class and drinking status affected the average score of exercise fear(P＜0.05 all).The quantile regression model pro-vided additional insights,showing that the impact of factors such as living situation,drinking status,cardiac function class and health literacy on exercise fear varied across different quantiles.Notably,cardiac function class had a consistently posi-tive effect on TSK-SV H score at various quantiles.Conclusion:Improving health literacy and tailored rehabilitation plans are vital to reduce exercise fear and improve cardiac rehabilitation effect.

Objective:To investigate the role of platelet-derived zyxin in promoting tumor migration by platelets.Methods:The gene expression profile of platelets was analyzed from cancer patients by using the GEO database.Isolated platelets from wild-type(WT)and Zyx-/-mice were co-cultured with B16F10 cells labeled with green fluorescence to investigate the influence of zyxin deficiency on tumor cell migration,invasion,and wound healing.Optical microscopy was employed to evaluate the impact of zyxin deficiency on epithelial-mesenchymal transition(EMT)in B16F10 cells induced by platelets.Employing specific markers to label platelets,fluorescence confocal microscopy was utilized to investigate the impact of platelet-derived zyxin on the binding between tumor cells and platelets.And an aggregometer was employed to observe the influence of zyxin deficiency on tumor cell-induced platelet aggregation.Results:Compared to platelets from healthy volunteers,zyxin was upregulated in platelets from cancer patients.Zyx-/-mouse platelets exhibited a significant reduction in tumor cell invasion and migration,impaired wound healing,and delayed tumor cell EMT compared to WT mouse platelets.Additionally,zyxin deficiency attenuated the interaction between platelets and tumor cells,and diminished the capacity for tumor cell-induced platelet aggregation.Conclusion:Platelet-derived zyxin deficiency diminishes platelet-tumor cell interactions and weakens the ability of tumor cell-induced platelet aggregation,ultimately suppressing tumor cell migration.

Objective:The greater tuberosity angle(GTA)and critical shoulder angle(CSA)are commonly referred to as radiographic markers which were used to described morphology of the greater tu-berosity and acromion respectively.At present,most international studies focus on the correlation be-tween the above two parameters and rotator cuff tears(RCTs),and their diagnostic value and risk assess-ment.This study attempts to find out the trend of GTA and CSA changes and risk threshold of RCTs,as well as the protective factors and risk factors.Methods:In this study,130 individuals from May 2019 to December 2020 were recruited.According to Southern California Orthopedic Institute(SCOI)classifica-tion,the individuals were divided into four groups retrospectively:Group A,negative control group;Group B,partial tears(articular side);Group C,partial tears(bursal side);Group D,full-thickness tears.GTA and CSA were measured respectively on true anteroposterior position X-ray of shoulder with arm in neutral rotation and performed by the same trained technician team in single-blind.The correla-tions between RCTs and relevant factors were analyzed.Results:According to the area under the receiver operating characteristic curve(AUC),GTA and CSA of RCTs(Groups B,C and D)were 0.736 and 0.673 with 95％confidence interval(CI),the cut-off value of GTA and CSA of RCTs were 70.5° and 39.5° respectively.Comparing with the control group,RCTs groups had significant statistical differences in age and body mass index(BMI)(P＜0.05),especially the full-thickness RCTs(Group D),which was older than Groups A,B and C(P＜0.05,cut-off value:56.5 years old)and shorter than Groups A and B(P＜0.05,cut-off value:1.58 m).Analyzed from scatter plot and regression analysis,there was no linear correlation between GTA and CSA.There were no significant differences in gender,dominant shoulders and smoking between the RCTs groups and the control group(P＞0.05).Conclusion:Larger GTA(＞70.5°)and CSA(＞39.5°)would be highly predictive in diagnosing RCTs without linear cor-relation,and GTA has a higher diagnostic value in contrast.Subacromial impingement and shoulder de-generation occurred before RCTs.Patients with age＞56.5 years and height＜1.58 m were more likely to develop disease of full-thickness RCTs and no statistic differences in weight and BMI.Gender,domi-nant shoulder and smoking were neither risk factors nor protective factors.

Objective:To evaluate the effect of multiple sevoflurane anesthesia on the metabolism of long-chain fatty acids in the hippocampus of newborn mice and the role of peroxisome proliferator-activated receptor-beta (PPARβ).Methods:Clean-grade healthy male C57BL/6 mice, aged 6 days, weighing 3-5 g, were divided into 2 groups ( n=8 each) by a random number table method: control group (group C) and multiple sevoflurane anesthesia group (group S). This study was performed in 2 parts. PartⅠ Sixteen newborn mice were divided into 2 groups ( n=8 each) using a random number table: control group (C group) and multiple sevoflurane anesthesia group (S group). Anesthesia was performed with sevoflurane on postnatal days 6, 7 and 8. The hippocampus was obtained at postnatal day 9 for determination of the content of long-chain fatty acids (by ultra-high performance liquid mass spectrometry), expression of PPARβ (by Western blot), and expression of stearoyl-CoA desaturase-2 (Scd2) and fatty acid desaturase 2 (Fads2) mRNA (using quantitative real-time polymerase chain reaction). Part Ⅱ Twenty-one newborn mice were divided into 3 groups ( n=7 each) using a random number table: control+ normal saline group (group C+ S), sevoflurane + normal saline group (group S+ S), and sevoflurane+ PPARβ specific agonist KD3010 group (group S+ K). Anesthesia was carried out with sevoflurane on postnatal days 6, 7 and 8. KD3010 25 mg/kg was intraperitoneally injected once a day from postnatal day 6 to 13 in S+ K group. The novel object recognition test was performed on postnatal day 37, and the Morris water maze test was performed on postnatal day 42. The hippocampal tissues were obtained on postnatal day 47 for detection of the expression of Scd2 mRNA and Fads2 mRNA by fluorescent quantitative real-time polymerase chain reaction. Anesthesia was carried out with sevoflurane as follows: Mice were exposed to 3% sevoflurane in 40% oxygen-60% nitrogen in an induction chamber for 2 h at a flow rate of 1 L/min. Results:PartⅠ Compared with group C, the total content of long-chain fatty acids, contents of saturated fatty acids, monounsaturated fatty acids and polyunsaturated fatty acids were significantly decreased, the percentage of saturated fatty acids was increased, the percentage of monounsaturated fatty acids and polyunsaturated fatty acids was decreased, the expression of Scd2 mRNA and Fads2 mRNA was down-regulated, and the expression of PPARβ was down-regulated in group S ( P<0.05). Part Ⅱ Compared with group C+ S, the discrimination index in the novel object recognition test and percentage of time spent in the target quadrant were significantly decreased, the number of crossing the original platform was reduced, and the expression of Scd2 and Fads2 mRNA was down-regulated in group S+ S ( P<0.05). Compared with group S+ S, the discrimination index in the novel object recognition test and percentage of time spent in the target quadrant were significantly increased, the number of crossing the original platform was increased, and the expression of Scd2 and Fads2 mRNA was up-regulated in group S+ K ( P<0.05). Conclusions:Multiple anesthesia with sevoflurane can lead to the disorder of long-chain fatty acid metabolism in the hippocampus of neonatal mice, resulting in long-term cognitive dysfunction. The mechanism may be related to inhibiting the activity of hippocampal PPARβ signaling pathway.

Turning to critical illness is a common stage of various diseases and injuries before death. Patients usually have complex health conditions, while the treatment process involves a wide range of content, along with high requirements for doctor′s professionalism and multi-specialty teamwork, as well as a great demand for time-sensitive treatments. However, this is not matched with critical care professionals and the current state of medical care in China. Telemedicine, which shortens the distance of medical professionals and the gap of disease diagnosis and treatments in various regions through electronic information, can effectively solve the current problem. Therefore, there is an urgent need to develop a standardized, high-quality visualization telemedicine round system .Therefore, experts have been organized to search domestic and foreign literature on telemedicine round for critically ill patients and to form this consensus based on clinical experiences so as to further improve the level of critical care treatments in regions.

AIM To investigate the effects of Yiqi Juanbi Formula on chondrocyte pyroptosis in rat models of collagen-induced arthritis(CIA).METHODS Fifty rats were subcutaneously injected at the tail base with an emulsion containing equal volumes of bovine type Ⅱ collagen and incomplete Freund's adjuvant(IFA)to establish the CIA models.These rats were then randomly assigned to the model group,the methotrexate group(0.35 mg/kg),and the low-dose,medium-dose,and high-dose Yiqi Juanbi Formula groups(9.4,18.7,37.4 g/kg),in contrast to the ten intact rats serving in the normal control group.Following four weeks of intragastric administration,the rats had their general conditions observed;their joint swelling and arthritis indices measured;their ankle joint pathology assessed by HE staining;their serum levels of IL-1β,IL-18 and TNF-ɑ detected by ELISA;their mRNA expressions of NLRP3,Caspase-1,GSDMD,IL-1β,IL-18 and TNF-ɑ in ankle cartilage quantified by RT-qPCR;their protein expressions of NF-κB,NLRP3 and Caspase-1 in ankle cartilage analyzed by Western blot;and their NLRP3 and GSDMD positive expressions in ankle cartilage examined by immunohistochemistry.RESULTS Compared to the control group,the model group showed significantly increased joint swelling and arthritis indices(P＜0.01);elevated serum levels of IL-1 β,IL-18 and TNF-ɑ(P＜0.01);pathological changes including cartilage surface defects,reduced cell count,altered cellular morphology,irregular cell arrangement,and significant inflammatory cell infiltration in synovial tissue;upregulated mRNA expressions of NF-κB,NLRP3,Caspase-1,GSDMD,IL-1β,IL-18 and TNF-ɑ(P＜0.01)and increased protein expressions of NF-κB,NLRP3 and Caspase-1(P＜0.01)in ankle cartilage;enhanced positive expressions of NLRP3 and GSDMD in ankle cartilage(P＜0.01).Compared to the model group,the groups intervened with methotrexate or medium-or high-dose Yiqi Juanbi Formula exhibited reduced joint swelling and arthritis indices(P＜0.01);alleviated pathological damage in ankle joints;decreased serum levels of IL-1β,IL-18 and TNF-ɑ(P＜0.01);downregulated mRNA expressions of NF-κB,NLRP3,Caspase-1,GSDMD,IL-1β,IL-18 and TNF-ɑ(P＜0.05,P＜0.01),and reduced protein expressions of NF-κB,NLRP3 and Caspase-1(P＜0.05,P＜0.01)in ankle cartilage;and diminished positive expressions of NLRP3 and GSDMD in ankle cartilage(P＜0.01).CONCLUSION Yiqi Juanbi Formula alleviates inflammation in CIA rats,potentially by inhibiting the activation of the NF-κB/NLRP3/Caspase-1 signaling pathway,thereby suppressing chondrocyte pyroptosis.