AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

This paper introduces a real-world cohort research model for community-acquired pneumonia （CAP） based on the Jiangsu Traditional Chinese Medicine （TCM） Dominant Diseases Diagnosis and Treatment Data Platform. Firstly， data cleaning is performed by standardizing diagnosis， symptoms， treatment and imaging， intelligently extracting unstructured information， and cleaning and constructing a standardized database. Secondly， for cohort establishment， CAP patients across the province are screened in accordance with CAP diagnostic criteria to build a high-quality disease-specific cohort. Lastly， in terms of protocol design， the characteristics of TCM research and the CAP disease profile are considered to determine appropriate inclusion and exclusion criteria， estimate sample size， define interventions， outcomes and economic evaluations， providing a reference for real-world TCM research on CAP.

This paper introduces a real-world cohort research model for community-acquired pneumonia （CAP） based on the Jiangsu Traditional Chinese Medicine （TCM） Dominant Diseases Diagnosis and Treatment Data Platform. Firstly， data cleaning is performed by standardizing diagnosis， symptoms， treatment and imaging， intelligently extracting unstructured information， and cleaning and constructing a standardized database. Secondly， for cohort establishment， CAP patients across the province are screened in accordance with CAP diagnostic criteria to build a high-quality disease-specific cohort. Lastly， in terms of protocol design， the characteristics of TCM research and the CAP disease profile are considered to determine appropriate inclusion and exclusion criteria， estimate sample size， define interventions， outcomes and economic evaluations， providing a reference for real-world TCM research on CAP.

[Objective] To analyze the loss rate of platelet donors and evaluate the strategies for establishing a platelet donor bank. [Methods] A total of 1 443 donors who joined the HLA and HPA gene donor bank for platelets in Henan Province from 2018 to 2020 were included in this study. Data on the total number of apheresis platelet donations, annual donation frequency, age at enrollment, donation habits (including the number of platelets donated per session and whether they had previously donated whole blood), and enrollment location were collected from the platelet donor information management system. Donor loss was determined based on the date of their last donation. The loss rates of different groups under various conditions were compared to assess the enrollment strategies. [Results] By the time the platelet bank was officially operational in 2022, 421 donors had been lost, resulting in an loss rate of 29% (421/1 443). By the end of 2023, the overall cumulative loss rate reached 52% (746/1 443). The loss rate was lower than the overall level in groups meeting any of the following conditions: total apheresis platelet donations exceeding 50, annual donation frequency of 10 or more, age at enrollment of 40 years or older, donation of more than a single therapeutic dose per session, or a history of whole blood donation two or more times. Additionally, loss rates varied across different enrollment locations, with higher enrollment numbers generally associated with higher loss rates. [Conclusion] Through a comprehensive analysis of donor loss, our center has adjusted its strategies for establishing the donor pool. These findings also provide valuable insights for other blood collection and supply institutions in building platelet donor banks.

OBJECTIVE: This study examines utilizes the advantages of machine learning algorithms to discern key determinants in prognosticate postoperative circulatory complications (PCCs) for older patients. METHODS: This secondary analysis of data from a randomized controlled trial involved 1,720 elderly participants in five tertiary hospitals in Beijing, China. Participants aged 60-90 years undergoing major non-cardiac surgery under general anesthesia. The primary outcome metric of the study was the occurrence of PCCs, according to the European Society of Cardiology and the European Society of Anaesthesiology diagnostic criteria. The analysis metrics contained 67 candidate variables, including baseline characteristics, laboratory tests, and scale assessments. RESULTS: Our feature selection process identified key variables that significantly impact patient outcomes, including the duration of ICU stay, surgery, and anesthesia; APACHE-II score; intraoperative average heart rate and blood loss; cumulative opioid use during surgery; patient age; VAS-Move-Median score on the 1st to 3rd day; Charlson comorbidity score; volumes of intraoperative plasma, crystalloid, and colloid fluids; cumulative red blood cell transfusion during surgery; and endotracheal intubation duration. Notably, our Random Forest model demonstrated exceptional performance with an accuracy of 0.9872. CONCLUSION We have developed and validated an algorithm for predicting PCCs in elderly patients by identifying key risk factors.
Aged ; Aged, 80 and over ; Female ; Humans ; Male ; Middle Aged ; Cardiovascular Diseases/etiology* ; Machine Learning ; Postoperative Complications/etiology* ; Risk Factors ; Randomized Controlled Trials as Topic ; Secondary Data Analysis

Gastric contrast-enhanced ultrasound includes oral contrast-enhanced ultrasound (OCUS) and double contrast-enhanced ultrasound (DCEUS),which can provide valuable clinical information about tumor morphology,vascular characteristics,and treatment responses.OCUS can clearly identify the gastric wall structure and the extent and depth of lesions by applying oral contrast agents.DCEUS,based on OCUS combined with venography,can display the anatomical and perfusion characteristics of lesions.In recent years,gastric contrast agents and imaging techniques have developed rapidly.However,the clinical application of gastric contrast-enhanced ultrasound is still in the developmental stage.This article reviews the clinical status of OCUS and DCEUS in the screening,diagnosis,staging,pathological typing,and treatment evaluation of gastric cancer.Studies have shown that gastric contrast-enhanced ultrasound has high sensitivity and specificity in the assessment of diagnosis and T-staging of gastric cancer.Furthermore,gastric contrast-enhanced ultrasound has the advantages of being cost-effective,convenient,non-invasive,free from radiation exposure,real-time,and easy to repeat.In the diagnosis and treatment of gastric cancer,it is expected to become one of the important imaging assessment tools.
Humans ; Stomach Neoplasms/diagnostic imaging* ; Contrast Media ; Ultrasonography/methods*

Objective To investigate the distribution and antimicrobial resistance profiles of clinically isolated Haemophilus influenzae and Moraxella catarrhalis in hospitals across China from 2015 to 2021,and provide evidence for rational use of antimicrobial agents.Methods Data of H.influenzae and M.catarrhalis strains isolated from 2015 to 2021 in CHINET program were collected for analysis,and antimicrobial susceptibility testing was performed by disc diffusion method or automated systems according to the uniform protocol of CHINET.The results were interpreted according to the CLSI breakpoints in 2022.Beta-lactamases was detected by using nitrocefin disk.Results From 2015 to 2021,a total of 43 642 strains of Haemophilus species were isolated,accounting for 2.91％of the total clinical isolates and 4.07％of Gram-negative bacteria in CHINET program.Among the 40 437 strains of H.influenzae,66.89％were isolated from children and 33.11％were isolated from adults.More than 90％of the H.influenzae strains were isolated from respiratory tract specimens.The prevalence of β-lactamase was 53.79％in H.influenzae strains.The H.influenzae strains isolated from children showed higher resistance rate than the strains isolated from adults.Overall,779 strains of H.influenzae did not produce β-lactamase but were resistant to ampicillin(BLNAR).Beta-lactamase-producing strains showed significantly higher resistance rates to these antimicrobial agents than the β-lactamase-nonproducing strains.Of the 16 191 M.catarrhalis strains,80.06％were isolated from children and 19.94％isolated from adults.M.catarrhalis strains were mostly susceptible to both amoxicillin-clavulanic acid and cefuroxime,evidenced by resistance rate lower than 2.0％.Conclusions The emergence of antibiotic-resistant H.influenzae due to β-lactamase production poses a challenge for clinical anti-infective treatment.Therefore,it is very important to implement antibiotic resistance surveillance for H.influenzae and guide rational antibiotic use.All local clinical microbiology laboratories should actively improve antibiotic susceptibility testing and strengthen antibiotic resistance surveillance for H.influenzae.

Objective:To evaluate the effect of multiple sevoflurane anesthesia on the metabolism of long-chain fatty acids in the hippocampus of newborn mice and the role of peroxisome proliferator-activated receptor-beta (PPARβ).Methods:Clean-grade healthy male C57BL/6 mice, aged 6 days, weighing 3-5 g, were divided into 2 groups ( n=8 each) by a random number table method: control group (group C) and multiple sevoflurane anesthesia group (group S). This study was performed in 2 parts. PartⅠ Sixteen newborn mice were divided into 2 groups ( n=8 each) using a random number table: control group (C group) and multiple sevoflurane anesthesia group (S group). Anesthesia was performed with sevoflurane on postnatal days 6, 7 and 8. The hippocampus was obtained at postnatal day 9 for determination of the content of long-chain fatty acids (by ultra-high performance liquid mass spectrometry), expression of PPARβ (by Western blot), and expression of stearoyl-CoA desaturase-2 (Scd2) and fatty acid desaturase 2 (Fads2) mRNA (using quantitative real-time polymerase chain reaction). Part Ⅱ Twenty-one newborn mice were divided into 3 groups ( n=7 each) using a random number table: control+ normal saline group (group C+ S), sevoflurane + normal saline group (group S+ S), and sevoflurane+ PPARβ specific agonist KD3010 group (group S+ K). Anesthesia was carried out with sevoflurane on postnatal days 6, 7 and 8. KD3010 25 mg/kg was intraperitoneally injected once a day from postnatal day 6 to 13 in S+ K group. The novel object recognition test was performed on postnatal day 37, and the Morris water maze test was performed on postnatal day 42. The hippocampal tissues were obtained on postnatal day 47 for detection of the expression of Scd2 mRNA and Fads2 mRNA by fluorescent quantitative real-time polymerase chain reaction. Anesthesia was carried out with sevoflurane as follows: Mice were exposed to 3% sevoflurane in 40% oxygen-60% nitrogen in an induction chamber for 2 h at a flow rate of 1 L/min. Results:PartⅠ Compared with group C, the total content of long-chain fatty acids, contents of saturated fatty acids, monounsaturated fatty acids and polyunsaturated fatty acids were significantly decreased, the percentage of saturated fatty acids was increased, the percentage of monounsaturated fatty acids and polyunsaturated fatty acids was decreased, the expression of Scd2 mRNA and Fads2 mRNA was down-regulated, and the expression of PPARβ was down-regulated in group S ( P<0.05). Part Ⅱ Compared with group C+ S, the discrimination index in the novel object recognition test and percentage of time spent in the target quadrant were significantly decreased, the number of crossing the original platform was reduced, and the expression of Scd2 and Fads2 mRNA was down-regulated in group S+ S ( P<0.05). Compared with group S+ S, the discrimination index in the novel object recognition test and percentage of time spent in the target quadrant were significantly increased, the number of crossing the original platform was increased, and the expression of Scd2 and Fads2 mRNA was up-regulated in group S+ K ( P<0.05). Conclusions:Multiple anesthesia with sevoflurane can lead to the disorder of long-chain fatty acid metabolism in the hippocampus of neonatal mice, resulting in long-term cognitive dysfunction. The mechanism may be related to inhibiting the activity of hippocampal PPARβ signaling pathway.

Objective:The greater tuberosity angle(GTA)and critical shoulder angle(CSA)are commonly referred to as radiographic markers which were used to described morphology of the greater tu-berosity and acromion respectively.At present,most international studies focus on the correlation be-tween the above two parameters and rotator cuff tears(RCTs),and their diagnostic value and risk assess-ment.This study attempts to find out the trend of GTA and CSA changes and risk threshold of RCTs,as well as the protective factors and risk factors.Methods:In this study,130 individuals from May 2019 to December 2020 were recruited.According to Southern California Orthopedic Institute(SCOI)classifica-tion,the individuals were divided into four groups retrospectively:Group A,negative control group;Group B,partial tears(articular side);Group C,partial tears(bursal side);Group D,full-thickness tears.GTA and CSA were measured respectively on true anteroposterior position X-ray of shoulder with arm in neutral rotation and performed by the same trained technician team in single-blind.The correla-tions between RCTs and relevant factors were analyzed.Results:According to the area under the receiver operating characteristic curve(AUC),GTA and CSA of RCTs(Groups B,C and D)were 0.736 and 0.673 with 95％confidence interval(CI),the cut-off value of GTA and CSA of RCTs were 70.5° and 39.5° respectively.Comparing with the control group,RCTs groups had significant statistical differences in age and body mass index(BMI)(P＜0.05),especially the full-thickness RCTs(Group D),which was older than Groups A,B and C(P＜0.05,cut-off value:56.5 years old)and shorter than Groups A and B(P＜0.05,cut-off value:1.58 m).Analyzed from scatter plot and regression analysis,there was no linear correlation between GTA and CSA.There were no significant differences in gender,dominant shoulders and smoking between the RCTs groups and the control group(P＞0.05).Conclusion:Larger GTA(＞70.5°)and CSA(＞39.5°)would be highly predictive in diagnosing RCTs without linear cor-relation,and GTA has a higher diagnostic value in contrast.Subacromial impingement and shoulder de-generation occurred before RCTs.Patients with age＞56.5 years and height＜1.58 m were more likely to develop disease of full-thickness RCTs and no statistic differences in weight and BMI.Gender,domi-nant shoulder and smoking were neither risk factors nor protective factors.

AIM To evaluate the quality of Gegen Formula Granules.METHODS Linear calibration with two reference substances(LCTRS)was adopted in the predicting of retention time with puerarin and daidzein as internal standards.UPLC characteristic chromatograms were established.The contents of 3'-hydroxy puerarin,puerarin(internal standard),3'-methoxy puerarin,puerarin 6"-O-xyloside,puerarin apioside and daidzin were determined by quantitative determination analysis multi-components by a single marker(QAMS),after which their transfer rates were calculated.RESULTS Compared with relative retention time method,LCTRS demonstrated higher positional accuracy for characteristic peaks and wider application range for columns.There were 9 characteristic peaks in the characteristic chromatograms for 14 batches of formula granules and 15 batches of standard decoctions with the similarities of more than 0.95.The contents and transfer rates of various constituents in formula granules and standard decoctions were basically consistent.CONCLUSION The chemical constituents in formula granules and their standard decoctions of Puerariae lobatae Radix display good consistency,reliable preparation process is observable in the former.