AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

This paper introduces a real-world cohort research model for community-acquired pneumonia （CAP） based on the Jiangsu Traditional Chinese Medicine （TCM） Dominant Diseases Diagnosis and Treatment Data Platform. Firstly， data cleaning is performed by standardizing diagnosis， symptoms， treatment and imaging， intelligently extracting unstructured information， and cleaning and constructing a standardized database. Secondly， for cohort establishment， CAP patients across the province are screened in accordance with CAP diagnostic criteria to build a high-quality disease-specific cohort. Lastly， in terms of protocol design， the characteristics of TCM research and the CAP disease profile are considered to determine appropriate inclusion and exclusion criteria， estimate sample size， define interventions， outcomes and economic evaluations， providing a reference for real-world TCM research on CAP.

This paper introduces a real-world cohort research model for community-acquired pneumonia （CAP） based on the Jiangsu Traditional Chinese Medicine （TCM） Dominant Diseases Diagnosis and Treatment Data Platform. Firstly， data cleaning is performed by standardizing diagnosis， symptoms， treatment and imaging， intelligently extracting unstructured information， and cleaning and constructing a standardized database. Secondly， for cohort establishment， CAP patients across the province are screened in accordance with CAP diagnostic criteria to build a high-quality disease-specific cohort. Lastly， in terms of protocol design， the characteristics of TCM research and the CAP disease profile are considered to determine appropriate inclusion and exclusion criteria， estimate sample size， define interventions， outcomes and economic evaluations， providing a reference for real-world TCM research on CAP.

OBJECTIVE: To investigate the protective effects of stir-fried Semen Armeniacae Amarum (SAA) against aristolochic acid I (AAI)-induced nephrotoxicity and DNA adducts and elucidate the underlying mechanism involved for ensuring the safe use of Asari Radix et Rhizoma. METHODS: In vitro, HEK293T cells overexpressing Flag-tagged multidrug resistance-associated protein 3 (MRP3) were constructed by Lentiviral transduction, and inhibitory effect of top 10 common pairs of medicinal herbs with Asari Radix et Rhizoma in clinic on MRP3 activity was verified using a self-constructed fluorescence screening system. The mRNA, protein expressions, and enzyme activity levels of NAD(P)H quinone dehydrogenase 1 (NQO1) and cytochrome P450 1A2 (CYP1A2) were measured in differentiated HepaRG cells. Hepatocyte toxicity after inhibition of AAI metabolite transport was detected using cell counting kit-8 assay. In vivo, C57BL/6 mice were randomly divided into 5 groups according to a random number table, including: control (1% sodium bicarbonate), AAI (10 mg/kg), stir-fried SAA (1.75 g/kg) and AAI + stir-fried SAA (1.75 and 8.75 g/kg) groups, 6 mice in each group. After 7 days of continuous gavage administration, liver and kidney damages were assessed, and the protein expressions and enzyme activity of liver metabolic enzymes NQO1 and CYP1A2 were determined simultaneously. RESULTS: In vivo, combination of 1.75 g/kg SAA and 10 mg/kg AAI suppressed AAI-induced nephrotoxicity and reduced dA-ALI formation by 26.7%, and these detoxification effects in a dose-dependent manner (P<0.01). Mechanistically, SAA inhibited MRP3 transport in vitro, downregulated NQO1 expression in vivo, increased CYP1A2 expression and enzymatic activity in vitro and in vivo, respectively (P<0.05 or P<0.01). Notably, SAA also reduced AAI-induced hepatotoxicity throughout the detoxification process, as indicated by a 41.3% reduction in the number of liver adducts (P<0.01). CONCLUSIONS Stir-fried SAA is a novel drug candidate for the suppression of AAI-induced liver and kidney damages. The protective mechanism may be closely related to the regulation of transporters and metabolic enzymes.
Aristolochic Acids/toxicity* ; Animals ; Humans ; NAD(P)H Dehydrogenase (Quinone)/genetics* ; HEK293 Cells ; Kidney/pathology* ; Cytochrome P-450 CYP1A2/genetics* ; Mice, Inbred C57BL ; DNA Adducts/drug effects* ; Male ; Kidney Diseases/drug therapy* ; Drugs, Chinese Herbal/therapeutic use* ; Mice ; Prunus armeniaca ; Plant Extracts

B lymphocytes (B cells) play a complex and paradoxical role in tumorigenesis. They can recognize tumor-associated antigens, present these antigens to T cells, and produce antibodies that directly target and eliminate tumor cells. This makes B cells a potentially powerful ally in combating cancer. However, B cells also exhibit immunosuppressive functions, secreting cytokines like IL-10 or generating tumor-promoting antibodies that dampen the anti-tumor immune response, and some tumor cells have even been shown to exploit B cells to promote their growth and metastasis. This dual nature of B cells presents both opportunities and challenges for tumor immunotherapy. In this review, we summarize the mechanisms underlying the multifaceted functions of B cells and their current applications in cancer immunotherapy. Furthermore, we also explore the key issues and future directions in this field, emphasizing the need for further research to fully harness the anti-tumor potential of B cells in the fight against cancer.
Humans ; B-Lymphocytes/immunology* ; Neoplasms/therapy* ; Carcinogenesis/immunology* ; Immunotherapy/methods* ; Animals

OBJECTIVE: This study examines utilizes the advantages of machine learning algorithms to discern key determinants in prognosticate postoperative circulatory complications (PCCs) for older patients. METHODS: This secondary analysis of data from a randomized controlled trial involved 1,720 elderly participants in five tertiary hospitals in Beijing, China. Participants aged 60-90 years undergoing major non-cardiac surgery under general anesthesia. The primary outcome metric of the study was the occurrence of PCCs, according to the European Society of Cardiology and the European Society of Anaesthesiology diagnostic criteria. The analysis metrics contained 67 candidate variables, including baseline characteristics, laboratory tests, and scale assessments. RESULTS: Our feature selection process identified key variables that significantly impact patient outcomes, including the duration of ICU stay, surgery, and anesthesia; APACHE-II score; intraoperative average heart rate and blood loss; cumulative opioid use during surgery; patient age; VAS-Move-Median score on the 1st to 3rd day; Charlson comorbidity score; volumes of intraoperative plasma, crystalloid, and colloid fluids; cumulative red blood cell transfusion during surgery; and endotracheal intubation duration. Notably, our Random Forest model demonstrated exceptional performance with an accuracy of 0.9872. CONCLUSION We have developed and validated an algorithm for predicting PCCs in elderly patients by identifying key risk factors.
Aged ; Aged, 80 and over ; Female ; Humans ; Male ; Middle Aged ; Cardiovascular Diseases/etiology* ; Machine Learning ; Postoperative Complications/etiology* ; Risk Factors ; Randomized Controlled Trials as Topic ; Secondary Data Analysis

Gastric contrast-enhanced ultrasound includes oral contrast-enhanced ultrasound (OCUS) and double contrast-enhanced ultrasound (DCEUS),which can provide valuable clinical information about tumor morphology,vascular characteristics,and treatment responses.OCUS can clearly identify the gastric wall structure and the extent and depth of lesions by applying oral contrast agents.DCEUS,based on OCUS combined with venography,can display the anatomical and perfusion characteristics of lesions.In recent years,gastric contrast agents and imaging techniques have developed rapidly.However,the clinical application of gastric contrast-enhanced ultrasound is still in the developmental stage.This article reviews the clinical status of OCUS and DCEUS in the screening,diagnosis,staging,pathological typing,and treatment evaluation of gastric cancer.Studies have shown that gastric contrast-enhanced ultrasound has high sensitivity and specificity in the assessment of diagnosis and T-staging of gastric cancer.Furthermore,gastric contrast-enhanced ultrasound has the advantages of being cost-effective,convenient,non-invasive,free from radiation exposure,real-time,and easy to repeat.In the diagnosis and treatment of gastric cancer,it is expected to become one of the important imaging assessment tools.
Humans ; Stomach Neoplasms/diagnostic imaging* ; Contrast Media ; Ultrasonography/methods*

Arsenic is a semi-metal,and lipid-soluble arsenic compounds are one of the widespread forms in the environment and food chain,but there is a lack of standards for lipid-soluble arsenic compounds,which is one of the bottlenecks in the current analytical detection and toxicological studies of organic arsenic.In this study,four saturated arsenic-containing hydrocarbons,AsHC 318,AsHC 332,AsHC 346,and AsHC 374(The number is relative molecular mass),were successfully synthesized in three steps by using dimethylarsinic acid,potassium iodide,sodium hydroxide,and four brominated alkanes(1-Bromotetradecane,1-bromopentadecane,1-bromohexadecane,and 1-bromooctadecane)as raw materials.The structures of these four saturated arsenic-containing hydrocarbons were characterized by proton nuclear magnetic resonance(1H NMR)spectroscopy,13C nuclear magnetic resonance(13C NMR)spectroscopy,and high-resolution mass spectrometry(HR-MS).The yields of the method were 8%-10%,and the synthesized compounds could be used in subsequent toxicity evaluation experiments to assess the toxic effects and mechanisms of action of arsenic-containing hydrocarbons.This study provided an effective method for synthesis of arsenic-containing hydrocarbons,enriching the synthesis methods of arsenic-containing hydrocarbons,and provided raw materials for the subsequent toxicological studies of arsenic-containing hydrocarbons.

Based on the ultra performance liquid chromatography-quadrupole Exactive Orbitrap mass spectrometry(UPLC-Q-Exactive Orbitrap-MS) technology, combined with related literature, databases, and reference material information, this study qualitatively analyzed the components of Dayuanyin in the tissue of rats after gavage and employed molecular docking technology to predict the rationality of the mechanism behind the antipyretic effect of the in vivo components in Dayuanyin. A total of 21, 26, 20, 21, 14, and 31 prototype components and 3, 16, 3, 7, 5, and 24 metabolites were identified from the heart, liver, spleen, lung, kidney, and hypothalamus of the rats, respectively, and the binding ability of key components and targets was further verified by molecular docking. The results showed that all components had good binding ability with targets. The established UPLC-Q-Exactive Orbitrap-MS could effectively and quickly identify the Dayuanyin components distributed in tissue and preliminarily identify their metabolites. Many components were identified in the hypothalamus, which suggested that the components delivered to the brain should be focused on in the study on Dayuanyin in the treatment of febrile diseases. The molecular docking technology was used to predict the rationality of the mechanism behind its antipyretic effect, which lays the foundation for the clarification of the material basis and action mechanism of Dayuanyin, the development of new preparations, and the prediction of quality markers.
Animals ; Drugs, Chinese Herbal/administration & dosage* ; Rats ; Molecular Docking Simulation ; Male ; Antipyretics/metabolism* ; Rats, Sprague-Dawley ; Tissue Distribution ; Mass Spectrometry ; Chromatography, High Pressure Liquid ; Hypothalamus/metabolism*

The study investigated the intrinsic changes in material basis of Angelicae Sinensis Radix during wine processing by headspace-gas chromatography-ion mobility spectrometry(HS-GC-IMS), headspace-solid phase microextraction-gas chromatography-mass spectrometry(HS-SPME-GC-MS), and ultra-high performance liquid chromatography-quadrupole-orbitrap mass spectrometry(UPLC-Q-Orbitrap-MS) combined with chemometrics. HS-GC-IMS fingerprints of Angelicae Sinensis Radix before and after wine processing were established to analyze the variation trends of volatile components and characterize volatile small-molecule substances before and after processing. Principal component analysis(PCA) and orthogonal partial least squares-discriminant analysis(OPLS-DA) were employed for differentiation and difference analysis. A total of 89 volatile components in Angelicae Sinensis Radix were identified by HS-GC-IMS, including 14 unsaturated hydrocarbons, 16 aldehydes, 13 ketones, 9 alcohols, 16 esters, 6 organic acids, and 15 other compounds. HS-SPME-GC-MS detected 118 volatile components, comprising 42 unsaturated hydrocarbons, 11 aromatic compounds, 30 alcohols, 8 alkanes, 6 organic acids, 4 ketones, 7 aldehydes, 5 esters, and 5 other volatile compounds. UPLC-Q-Orbitrap-MS identified 76 non-volatile compounds. PCA revealed distinct clusters of raw and wine-processed Angelicae Sinensis Radix samples across the three detection methods. Both PCA and OPLS-DA effectively discriminated between the two groups, and 145 compounds(VIP>1) were identified as critical markers for evaluating processing quality, including 4-methyl-3-penten-2-one, ethyl 2-methylpentanoate, and 2,4-dimethyl-1,3-dioxolane detected by HS-GC-IMS, angelic acid, β-pinene, and germacrene B detected by HS-SPME-GC-MS, and L-tryptophan, licoricone, and angenomalin detected by UPLC-Q-Orbitrap-MS. In conclusion, the integration of the three detection methods with chemometrics elucidates the differences in the chemical material basis between raw and wine-processed Angelicae Sinensis Radix, providing a scientific foundation for understanding the processing mechanisms and clinical applications of wine-processed Angelicae Sinensis Radix.
Wine/analysis* ; Gas Chromatography-Mass Spectrometry/methods* ; Chromatography, High Pressure Liquid/methods* ; Angelica sinensis/chemistry* ; Solid Phase Microextraction/methods* ; Drugs, Chinese Herbal/isolation & purification* ; Chemometrics ; Volatile Organic Compounds/chemistry* ; Principal Component Analysis ; Ion Mobility Spectrometry/methods*