AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

This paper introduces a real-world cohort research model for community-acquired pneumonia （CAP） based on the Jiangsu Traditional Chinese Medicine （TCM） Dominant Diseases Diagnosis and Treatment Data Platform. Firstly， data cleaning is performed by standardizing diagnosis， symptoms， treatment and imaging， intelligently extracting unstructured information， and cleaning and constructing a standardized database. Secondly， for cohort establishment， CAP patients across the province are screened in accordance with CAP diagnostic criteria to build a high-quality disease-specific cohort. Lastly， in terms of protocol design， the characteristics of TCM research and the CAP disease profile are considered to determine appropriate inclusion and exclusion criteria， estimate sample size， define interventions， outcomes and economic evaluations， providing a reference for real-world TCM research on CAP.

This paper introduces a real-world cohort research model for community-acquired pneumonia （CAP） based on the Jiangsu Traditional Chinese Medicine （TCM） Dominant Diseases Diagnosis and Treatment Data Platform. Firstly， data cleaning is performed by standardizing diagnosis， symptoms， treatment and imaging， intelligently extracting unstructured information， and cleaning and constructing a standardized database. Secondly， for cohort establishment， CAP patients across the province are screened in accordance with CAP diagnostic criteria to build a high-quality disease-specific cohort. Lastly， in terms of protocol design， the characteristics of TCM research and the CAP disease profile are considered to determine appropriate inclusion and exclusion criteria， estimate sample size， define interventions， outcomes and economic evaluations， providing a reference for real-world TCM research on CAP.

Background: Visual impairment is increasingly prevalent, underscoring the need for effective prevention strategies. This study investigated the association between cardiovascular health and visual impairment using three progressively developed metrics: Life’s Simple 7 (LS7), a cardiovascular health score developed by the American Heart Association based on 7 components, including physical activity, smoking status, body mass index (BMI), diet, blood glucose, blood pressure, and total cholesterol; Life’s Essential 8(LE8), which adds sleep health as an additional component; and Life’s Crucial 9 (LC9), which further incorporates mental health. We aimed to evaluate whether these expanded metrics provide additional explanatory value and to inform future public health strategies. Objective: To investigate the associations among LS7, LE8, and LC9 cardiovascular health scores and visual impairment in National Health and Nutrition Examination Survey 2013 to 2018, assess the added value of sleep and mental health components, and identify key contributing subcomponents using regression and machine learning methods. Methods: We analyzed data from 9891 participants in the 2013 to 2018 National Health and Nutrition Examination Survey. Multivariable logistic regression, restricted cubic spline modeling, and subgroup analyses were conducted to evaluate the association between cardiovascular health and visual impairment. Machine learning methods, including Random Forest and SHapley Additive exPlanations, a model interpretation approach used to assess feature importance, were applied. The Boruta algorithm, a feature selection method, was used to identify key subcomponents of cardiovascular health. Results: Participants with visual impairment were older, had lower poverty-to-income ratios, and exhibited lower cardiovascular health scores (LS7, LE8, and LC9). Higher cardiovascular health scores were negatively associated with visual impairment. Each one standard deviation increase in LS7, LE8, and LC9 was associated with approximately 8%, 2%, and 3% lower odds of visual impairment, respectively. LS7 showed the strongest negative association, whereas LE8 and LC9 emerged as the most important predictors in the machine learning models. Key subcomponents such as blood glucose, blood pressure, and BMI, as well as mental health status, were strongly associated with visual impairment. Conclusion: Higher cardiovascular health scores were negatively associated with visual impairment. LS7 demonstrated the strongest statistical association, whereas LE8 and LC9 were the most influential features in the machine learning models. Blood glucose, blood pressure, BMI, and mental health status were important correlates of visual impairment. From the perspective of the “prevention and treatment of diseases” in traditional Chinese medicine and the holistic concept, the aforementioned research findings confirm that severe visual impairment is indeed an external manifestation of overall health imbalance (such as organ dysfunction and Qi deficiency and blood stasis). The prevention strategy lies in comprehensively adjusting lifestyle, emotional factors, and metabolic indicators (corresponding to the key factors in the study) to restore the body’s internal balance and achieve prevention before disease arises.

[Objective] To analyze the loss rate of platelet donors and evaluate the strategies for establishing a platelet donor bank. [Methods] A total of 1 443 donors who joined the HLA and HPA gene donor bank for platelets in Henan Province from 2018 to 2020 were included in this study. Data on the total number of apheresis platelet donations, annual donation frequency, age at enrollment, donation habits (including the number of platelets donated per session and whether they had previously donated whole blood), and enrollment location were collected from the platelet donor information management system. Donor loss was determined based on the date of their last donation. The loss rates of different groups under various conditions were compared to assess the enrollment strategies. [Results] By the time the platelet bank was officially operational in 2022, 421 donors had been lost, resulting in an loss rate of 29% (421/1 443). By the end of 2023, the overall cumulative loss rate reached 52% (746/1 443). The loss rate was lower than the overall level in groups meeting any of the following conditions: total apheresis platelet donations exceeding 50, annual donation frequency of 10 or more, age at enrollment of 40 years or older, donation of more than a single therapeutic dose per session, or a history of whole blood donation two or more times. Additionally, loss rates varied across different enrollment locations, with higher enrollment numbers generally associated with higher loss rates. [Conclusion] Through a comprehensive analysis of donor loss, our center has adjusted its strategies for establishing the donor pool. These findings also provide valuable insights for other blood collection and supply institutions in building platelet donor banks.

Based on the pharmacokinetics theory, this study investigated the pharmacokinetic characteristics of albiflorin, paeoniflorin, wogonoside, and wogonin in normal and febrile rats and summarized absorption and elimination rules of Dayuanyin in them to provide reference for further development and clinical application of Dayuanyin. Blood samples were taken from the fundus venous plexus of normal and model rats after intragastric administration of Dayuanyin at different time points. The concentration of each substance in blood was determined by ultra performance liquid chromatography-triple quadrupole mass spectrometry(UPLC-MS/MS) technique at different time points. DAS 2.0, a piece of pharmacokinetics software, was used to calculate the pharmacokinetic parameters of each component. The results show that the 4 components had good linear relationship in their respective ranges, and the results of methodological investigation met the requirements. The pharmacokinetic parameters of C_(max), T_(max), t_(1/2), AUC_(0-t), AUC_(0-∞), and MRT_(0-t) were calculated by the DAS 2.0 non-compartmental model. Compared with those in the normal group, C_(max) and AUC_(0-t) of the 4 components in the model group were significantly increased. There were significant differences in the pharmacokinetic characteristics between the normal and model groups, suggesting that the absorption and elimination of Dayuanyin may be affected by the changes of internal environment of the body in different physiological states.
Animals ; Rats ; Drugs, Chinese Herbal/administration & dosage* ; Male ; Rats, Sprague-Dawley ; Fever/metabolism* ; Tandem Mass Spectrometry ; Chromatography, High Pressure Liquid ; Glucosides/pharmacokinetics* ; Monoterpenes

Objective To investigate the effect and mechnism of betaine(BET)in reversing chemotherapy resistance in prostate cancer(PCa)by inhibiting ATP-binding cassette subfamily B member 1(ABCB1).Methods The PCa chemotherapy-sensitive C4-2B cells were cultured,and the TaxR cells resistant to docetaxel(DTX)were established by gradient increase the concentration of DTX.The drug resistance of C4-2B and TaxR cells against DTX was assessed using CCK-8 and the colony formation experiment.Western blotting and qRT-PCR were used to detect ABCB1 expression.The TaxR cells were divided into:(1)Control group,negative control group(NC),siABCB1-1 group(transfected with siABCB1-1),and siABCB1-2 group(transfected with siABCB1-2).Western blotting was used to detect the effect of small interfering RNA on silencing ABCB1,and CCK-8 was used to detect the differences in DTX resistance between each group.(2)Different concentrations of BET(0,100,200,400,600,800 mmol/L)groups.These groups were subjected to CCK-8 to detect cell viability,and Western blotting was used to detect the protein expression of ABCB1.(3)Control group,DTX group(20 nmol/L DTX),BET group(200 mmol/L BET),and DTX+BET group(20 nmol/L DTX+200 mmol/L BET),flow cytometry was used to detect apoptosis rate and cell cycle,and Western blotting to detect the protein expression of apoptosis-related proteins(Bcl2,BAX,c-caspase-3).(4)Control group,BET group(200 mmol/L BET),wortmannin(WM)group(100 μmol/L WM),and BET+WM group(200 mmol/L BET+100 μmol/L WM).Western blotting was used to detect the protein expression of PI3K,Akt,and ABCB1.(5)Control group,BET group(200 mmol/L BET),and BAY group(10 μmol/L BAY),BAY+BET group(200 mmol/L BET+10 μmol/L BAY).Western blotting was used to detect the protein expression of NF-κB p65,p-ikBα and ABCB1.Network pharmacology combined with transcriptome sequencing was used to predict the possible pathways for BET to reverse chemotherapy resistance.Results Compared with C4-2B cells,TaxR cells showed significantly increased resistance to DTX(P<0.01),and high expression of ABCB1(P<0.01).After silencing ABCB1 with siRNA,TaxR cells'resistance to DTX was significantly inhibited(P<0.01).The inhibition rate of TaxR cells treated with 200 mmol/L BET was less than 20%,and it significantly decreased the expression of ABCB1 protein in TaxR cells(P<0.05).Compared with control group,the combination of 200 mmol/L BET and 20 nmol/L DTX resulted in higher apoptosis rate and higher S stage cell ratio,lower expression of Bcl-2 protein and higher expression of BAX and c-caspase-3 proteins than the two drugs used alone(P<0.05).Compared with control group,the combination of 200 mmol/L BET and 100 μmol/L WM significantly down-regulated the protein expression of PI3K,Akt and ABCB1(P<0.01).The combination of 200 mmol/L BET and 10 μmol/L BAY significantly down-regulated the protein expression of NF-κB p65,p-ikBα and ABCB1(P<0.01).Conclusion BET may reverse TaxR cells'chemotherapy resistance by down-regulating ABCB1 expression through the PI3K/Akt/NF-κB signaling pathway.

Objective To investigate the clinical and pathological characteristics of adrenal cortical carcinoma(ACC),compare differences between hypercortisolism and non-functional ACC,and assess the diagnostic value of indicators such as Ki-67 index.Methods The clinical data of 57 ACC patients admitted to the First Medical Center of Chinese PLA General Hospital from January 2015 to March 2025 were retrospectively analyzed.According to the results of endocrine function assessment,47 of these patients were divided into hypercortisolism group(n=19)and non-functional group(n=28).The differences in clinical and pathological characteristics between the two groups were compared,and non-parametric tests and Spearman correlation analysis were used to explore the relationship between Ki-67 index and tumor stage as well as imaging features.Results Among the 57 patients,there were 20 males and 37 females,with a male-to-female ratio of 1:1.85.The age ranged from 16 to 76 years,and the age at diagnosis was(48.7±13.3)years.The tumor diameter was(10.53±4.14)cm.The tumors were located on the right side in 12 cases(21.1%),on the left side in 34 cases(59.6%),and bilaterally in 11 cases(19.3%).Among them,16 cases(28.1%)were complicated with glucose metabolism disorders,31 cases(54.3%)had hypertension,and 20 cases(35.1%)had hypokalemia.According to ENSAT staging,there were 0 cases in stage Ⅰ,15 cases(26.3%)in stage Ⅱ,24 cases(42.1%)in stage Ⅲ,and 18 cases(31.6%)in stage Ⅳ.Endocrine function assessment was completed in 47 of the 57 patients,including 28 cases(59.6%)of non-functional ACC and 19 cases(40.4%)of hypercortisolism(including 1 case of hypercortisolism combined with increased sex hormone secretion).Compared with non-functional group,hypercortisolism group had a significantly higher prevalence of hypertension(P=0.014),later ENSAT stage(P=0.010),and a higher proportion of hypervascularization(P=0.048).The median Ki-67 index was 20%(10%-40%),showing no significant correlation with either the maximum tumor diameter or SUVmax value,but it was related to ENSAT staging,with Ki-67 index in stageⅣ patients being significantly higher than that in stage Ⅱ(P=0.032).Immunohistochemistry results showed that the positive rate of Inhibin-α was 84.8%,and the positive rate of Melan-A was 40.9%.Conclusions ACC is a rare malignant endocrine tumor.ACC patients with hypercortisolism are more likely to be complicated with hypertension,have later staging,and more common hypervascular manifestations.Clinically,their endocrine function should be prioritized for assessment,and more active treatment strategies should be adopted.Diagnosis should be combined with imaging characteristics(such as hypervascularization)and immunohistochemical indicators(Ki-67,Inhibin-α,Melan-A).The significant increase in Ki-67 is in the advanced stage can serve as an important prognostic indicator to guide individualized treatment.

Objective To investigate the clinical characteristics of patients with clinical and subclinical Cushing's syndrome caused by primary bilateral macronodular adrenal hyperplasia(PBMAH).Methods A retrospective analysis was performed on the clinical data of 198 patients with Cushing's syndrome caused by PBMAH diagnosed in the First Medical Center of Chinese PLA General Hospital from January 2004 to October 2024.According to clinical manifestations,the patients were classified into clinical type Cushing's syndrome(n=61)and subclinical type Cushing's syndrome(n=137),and the clinical characteristics of the two types were compared.Results The mean age at diagnosis of patients with PBMAH-induced Cushing's syndrome was(53.5±10.4)years,including 118 males and 80 females,with a male-to-female ratio of 1.475:1.Compared with the subclinical type,the clinical type had a higher proportion of females,higher levels of serum cortisol,24-hour urine free cortisol(24 h UFC),and inhibited serum cortisol after low-dose dexamethasone suppression.Additionally,the clinical type had lower plasma ACTH,larger adrenal nodules and a higher risk of surgery(P<0.05)compared with those in subclinical type.The incidences of hypertension,dyslipidemia,obesity,diabetes mellitus,hypokalemia,vitamin D deficiency,osteoporosis,coronary heart disease,and cerebrovascular disease in patients with Cushing's syndrome caused by PBMAH were 87.9%,50.5%,37.1%,36.9%,27.8%,25.9%,18.7%,18.7%and 12.1%,respectively.Among them,compared with subclinical type patients,clinical type patients had higher incidence of hypokalaemia,vitamin D deficiency and osteoporosis(P<0.05),while there were no statistically significant differences in the incidences of other comorbidities between the two types(P>0.05).The results of postoperative follow-up for PBMAH patients showed that the short-term biochemical remission rate of unilateral total adrenalectomy was 41.5%(22/53)and the long-term biochemical remission rate was 32.0%(8/25).The short-term biochemical remission rate of unilateral partial(or nodular)adrenalectomy was 52.9%(9/17),and the long-term biochemical remission rate was 14.3%(1/7).All patients who underwent unilateral total adrenalectomy plus contralateral partial resection developed adrenal insufficiency(3/3),and 1 patient(1/3)relapsed 3.4 years after surgery.Conclusion Clinical and subclinical types of Cushing's syndrome caused by PBMAH have their distinct clinical characteristics.Surgery is an effective treatment for PBMAH,but a certain proportion of patients fail to achieve biochemical remission after non-bilateral total adrenalectomy.

Objective To summarize the clinical characteristics of primary pigmented nodular adrenocortical disease(PPNAD)and provide a reference for its clinical diagnosis and treatment.Methods A retrospective analysis was conducted on the clinical characteristics,laboratory tests,imaging examinations,treatment plans,and follow-up data of 10 PPNAD patients diagnosed and treated at the First Medical Center of Chinese PLA General Hospital from January 2008 to October 2024.Databases including CNKI,Wanfang Data Knowledge Service Platform,and PubMed were searched,and the clinical characteristics of 120 PPNAD patients reported in the literature were summarized in combination with literature reviews.Results The age at diagnosis of the 10 PPNAD patients ranged from 15 to 55 years,with a median age of onset of 21.5 years.Seven patients had the protein kinase A regulatory subunit 1 alpha(PRKAR1A)gene mutations,meeting the diagnosis criteria for Carney syndrome.One patient presented with hypertension only,while the remaining 9 patients showed typical Cushing's syndrome manifestations such as thin skin and moon face,among whom 5 experienced stagnation of height growth.In 7 patients,the adrenocorticotropic hormone(ACTH)levels were<2.2 pmol/L,with the disrupted circadian rhythm of cortisol,and the cortisol levels at midnight ranged from 243.24 to 679.83 pmol/L.None of the patients showed suppression in the low-dose dexamethasone suppression test,and 8 patients had an increase in urinary free cortisol(UFC)after dexamethasone suppression.Adrenal CT showed that 9 patients presented with unilateral adrenal nodules accompanied by contralateral thickening or bilateral adrenal nodular thickening.All 10 patients underwent initial unilateral adrenalectomy,and during follow-up,4 patients experienced symptom recurrence and underwent contralateral adrenalectomy.Most of the 120 patients reported domestically and internationally showed typical Cushing's syndrome manifestations.Surgical resection of the adrenal gland was the main treatment modality.Gene mutations were predominantly in PRKAR1A,with a few in PDE11A and PRKACA.Conclusions PPNAD is more likely to occur in adolescents.Patients with typical Cushing's syndrome manifestations should undergo screening.Imaging manifestations are atypical,and a definitive diagnosis depends on pathological and genetic diagnoses.Bilateral adrenalectomy combined with long-term postoperative hormone replacement therapy is the standard treatment protocol.Patients who undergo early unilateral adrenalectomy require long-term follow-up,with contralateral adrenalectomy performed when necessary.