1.Related research on pathogenic candidate genes for familial blepharophimosis-ptosis-epicanthus inversus syndrome
Xin TAN ; Linan JIAO ; Xianfang PU ; Yunqin LI ; Yue ZOU ; Jianshu KANG
International Eye Science 2026;26(1):142-147
AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.
2.Application of Recombinant Collagen in Biomedicine
Huan HU ; Hong ZHANG ; Jian WANG ; Li-Wen WANG ; Qian LIU ; Ning-Wen CHENG ; Xin-Yue ZHANG ; Yun-Lan LI
Progress in Biochemistry and Biophysics 2025;52(2):395-416
Collagen is a major structural protein in the matrix of animal cells and the most widely distributed and abundant functional protein in mammals. Collagen’s good biocompatibility, biodegradability and biological activity make it a very valuable biomaterial. According to the source of collagen, it can be broadly categorized into two types: one is animal collagen; the other is recombinant collagen. Animal collagen is mainly extracted and purified from animal connective tissues by chemical methods, such as acid, alkali and enzyme methods, etc. Recombinant collagen refers to collagen produced by gene splicing technology, where the amino acid sequence is first designed and improved according to one’s own needs, and the gene sequence of improved recombinant collagen is highly consistent with that of human beings, and then the designed gene sequence is cloned into the appropriate vector, and then transferred to the appropriate expression vector. The designed gene sequence is cloned into a suitable vector, and then transferred to a suitable expression system for full expression, and finally the target protein is obtained by extraction and purification technology. Recombinant collagen has excellent histocompatibility and water solubility, can be directly absorbed by the human body and participate in the construction of collagen, remodeling of the extracellular matrix, cell growth, wound healing and site filling, etc., which has demonstrated significant effects, and has become the focus of the development of modern biomedical materials. This paper firstly elaborates the structure, type, and tissue distribution of human collagen, as well as the associated genetic diseases of different types of collagen, then introduces the specific process of producing animal source collagen and recombinant collagen, explains the advantages of recombinant collagen production method, and then introduces the various systems of expressing recombinant collagen, as well as their advantages and disadvantages, and finally briefly introduces the application of animal collagen, focusing on the use of animal collagen in the development of biopharmaceutical materials. In terms of application, it focuses on the use of animal disease models exploring the application effects of recombinant collagen in wound hemostasis, wound repair, corneal therapy, female pelvic floor dysfunction (FPFD), vaginal atrophy (VA) and vaginal dryness, thin endometritis (TE), chronic endometritis (CE), bone tissue regeneration in vivo, cardiovascular diseases, breast cancer (BC) and anti-aging. The mechanism of action of recombinant collagen in the treatment of FPFD and CE was introduced, and the clinical application and curative effect of recombinant collagen in skin burn, skin wound, dermatitis, acne and menopausal urogenital syndrome (GSM) were summarized. From the exploratory studies and clinical applications, it is evident that recombinant collagen has demonstrated surprising effects in the treatment of all types of diseases, such as reducing inflammation, promoting cell proliferation, migration and adhesion, increasing collagen deposition, and remodeling the extracellular matrix. At the end of the review, the challenges faced by recombinant collagen are summarized: to develop new recombinant collagen types and dosage forms, to explore the mechanism of action of recombinant collagen, and to provide an outlook for the future development and application of recombinant collagen.
3.Discriminating Tumor Deposits From Metastatic Lymph Nodes in Rectal Cancer: A Pilot Study Utilizing Dynamic Contrast-Enhanced MRI
Xue-han WU ; Yu-tao QUE ; Xin-yue YANG ; Zi-qiang WEN ; Yu-ru MA ; Zhi-wen ZHANG ; Quan-meng LIU ; Wen-jie FAN ; Li DING ; Yue-jiao LANG ; Yun-zhu WU ; Jian-peng YUAN ; Shen-ping YU ; Yi-yan LIU ; Yan CHEN
Korean Journal of Radiology 2025;26(5):400-410
Objective:
To evaluate the feasibility of dynamic contrast-enhanced MRI (DCE-MRI) in differentiating tumor deposits (TDs) from metastatic lymph nodes (MLNs) in rectal cancer.
Materials and Methods:
A retrospective analysis was conducted on 70 patients with rectal cancer, including 168 lesions (70 TDs and 98 MLNs confirmed by histopathology), who underwent pretreatment MRI and subsequent surgery between March 2019 and December 2022. The morphological characteristics of TDs and MLNs, along with quantitative parameters derived from DCE-MRI (K trans , kep, and v e) and DWI (ADCmin, ADCmax, and ADCmean), were analyzed and compared between the two groups.Multivariable binary logistic regression and receiver operating characteristic (ROC) curve analyses were performed to assess the diagnostic performance of significant individual quantitative parameters and combined parameters in distinguishing TDs from MLNs.
Results:
All morphological features, including size, shape, border, and signal intensity, as well as all DCE-MRI parameters showed significant differences between TDs and MLNs (all P < 0.05). However, ADC values did not demonstrate significant differences (all P > 0.05). Among the single quantitative parameters, v e had the highest diagnostic accuracy, with an area under the ROC curve (AUC) of 0.772 for distinguishing TDs from MLNs. A multivariable logistic regression model incorporating short axis, border, v e, and ADC mean improved diagnostic performance, achieving an AUC of 0.833 (P = 0.027).
Conclusion
The combination of morphological features, DCE-MRI parameters, and ADC values can effectively aid in the preoperative differentiation of TDs from MLNs in rectal cancer.
4.Discriminating Tumor Deposits From Metastatic Lymph Nodes in Rectal Cancer: A Pilot Study Utilizing Dynamic Contrast-Enhanced MRI
Xue-han WU ; Yu-tao QUE ; Xin-yue YANG ; Zi-qiang WEN ; Yu-ru MA ; Zhi-wen ZHANG ; Quan-meng LIU ; Wen-jie FAN ; Li DING ; Yue-jiao LANG ; Yun-zhu WU ; Jian-peng YUAN ; Shen-ping YU ; Yi-yan LIU ; Yan CHEN
Korean Journal of Radiology 2025;26(5):400-410
Objective:
To evaluate the feasibility of dynamic contrast-enhanced MRI (DCE-MRI) in differentiating tumor deposits (TDs) from metastatic lymph nodes (MLNs) in rectal cancer.
Materials and Methods:
A retrospective analysis was conducted on 70 patients with rectal cancer, including 168 lesions (70 TDs and 98 MLNs confirmed by histopathology), who underwent pretreatment MRI and subsequent surgery between March 2019 and December 2022. The morphological characteristics of TDs and MLNs, along with quantitative parameters derived from DCE-MRI (K trans , kep, and v e) and DWI (ADCmin, ADCmax, and ADCmean), were analyzed and compared between the two groups.Multivariable binary logistic regression and receiver operating characteristic (ROC) curve analyses were performed to assess the diagnostic performance of significant individual quantitative parameters and combined parameters in distinguishing TDs from MLNs.
Results:
All morphological features, including size, shape, border, and signal intensity, as well as all DCE-MRI parameters showed significant differences between TDs and MLNs (all P < 0.05). However, ADC values did not demonstrate significant differences (all P > 0.05). Among the single quantitative parameters, v e had the highest diagnostic accuracy, with an area under the ROC curve (AUC) of 0.772 for distinguishing TDs from MLNs. A multivariable logistic regression model incorporating short axis, border, v e, and ADC mean improved diagnostic performance, achieving an AUC of 0.833 (P = 0.027).
Conclusion
The combination of morphological features, DCE-MRI parameters, and ADC values can effectively aid in the preoperative differentiation of TDs from MLNs in rectal cancer.
5.Heterogeneity of Adipose Tissue From a Single-cell Transcriptomics Perspective
Yong-Lang WANG ; Si-Si CHEN ; Qi-Long LI ; Yu GONG ; Xin-Yue DUAN ; Ye-Hui DUAN ; Qiu-Ping GUO ; Feng-Na LI
Progress in Biochemistry and Biophysics 2025;52(4):820-835
Adipose tissue is a critical energy reservoir in animals and humans, with multifaceted roles in endocrine regulation, immune response, and providing mechanical protection. Based on anatomical location and functional characteristics, adipose tissue can be categorized into distinct types, including white adipose tissue (WAT), brown adipose tissue (BAT), beige adipose tissue, and pink adipose tissue. Traditionally, adipose tissue research has centered on its morphological and functional properties as a whole. However, with the advent of single-cell transcriptomics, a new level of complexity in adipose tissue has been unveiled, showing that even under identical conditions, cells of the same type may exhibit significant variation in morphology, structure, function, and gene expression——phenomena collectively referred to as cellular heterogeneity. Single-cell transcriptomics, including techniques like single-cell RNA sequencing (scRNA-seq) and single-nucleus RNA sequencing (snRNA-seq), enables in-depth analysis of the diversity and heterogeneity of adipocytes at the single-cell level. This high-resolution approach has not only deepened our understanding of adipocyte functionality but also facilitated the discovery of previously unidentified cell types and gene expression patterns that may play key roles in adipose tissue function. This review delves into the latest advances in the application of single-cell transcriptomics in elucidating the heterogeneity and diversity within adipose tissue, highlighting how these findings have redefined the understanding of cell subpopulations within different adipose depots. Moreover, the review explores how single-cell transcriptomic technologies have enabled the study of cellular communication pathways and differentiation trajectories among adipose cell subgroups. By mapping these interactions and differentiation processes, researchers gain insights into how distinct cellular subpopulations coordinate within adipose tissues, which is crucial for maintaining tissue homeostasis and function. Understanding these mechanisms is essential, as dysregulation in adipose cell interactions and differentiation underlies a range of metabolic disorders, including obesity and diabetes mellitus type 2. Furthermore, single-cell transcriptomics holds promising implications for identifying therapeutic targets; by pinpointing specific cell types and gene pathways involved in adipose tissue dysfunction, these technologies pave the way for developing targeted interventions aimed at modulating specific adipose subpopulations. In summary, this review provides a comprehensive analysis of the role of single-cell transcriptomic technologies in uncovering the heterogeneity and functional diversity of adipose tissues.
6.Discriminating Tumor Deposits From Metastatic Lymph Nodes in Rectal Cancer: A Pilot Study Utilizing Dynamic Contrast-Enhanced MRI
Xue-han WU ; Yu-tao QUE ; Xin-yue YANG ; Zi-qiang WEN ; Yu-ru MA ; Zhi-wen ZHANG ; Quan-meng LIU ; Wen-jie FAN ; Li DING ; Yue-jiao LANG ; Yun-zhu WU ; Jian-peng YUAN ; Shen-ping YU ; Yi-yan LIU ; Yan CHEN
Korean Journal of Radiology 2025;26(5):400-410
Objective:
To evaluate the feasibility of dynamic contrast-enhanced MRI (DCE-MRI) in differentiating tumor deposits (TDs) from metastatic lymph nodes (MLNs) in rectal cancer.
Materials and Methods:
A retrospective analysis was conducted on 70 patients with rectal cancer, including 168 lesions (70 TDs and 98 MLNs confirmed by histopathology), who underwent pretreatment MRI and subsequent surgery between March 2019 and December 2022. The morphological characteristics of TDs and MLNs, along with quantitative parameters derived from DCE-MRI (K trans , kep, and v e) and DWI (ADCmin, ADCmax, and ADCmean), were analyzed and compared between the two groups.Multivariable binary logistic regression and receiver operating characteristic (ROC) curve analyses were performed to assess the diagnostic performance of significant individual quantitative parameters and combined parameters in distinguishing TDs from MLNs.
Results:
All morphological features, including size, shape, border, and signal intensity, as well as all DCE-MRI parameters showed significant differences between TDs and MLNs (all P < 0.05). However, ADC values did not demonstrate significant differences (all P > 0.05). Among the single quantitative parameters, v e had the highest diagnostic accuracy, with an area under the ROC curve (AUC) of 0.772 for distinguishing TDs from MLNs. A multivariable logistic regression model incorporating short axis, border, v e, and ADC mean improved diagnostic performance, achieving an AUC of 0.833 (P = 0.027).
Conclusion
The combination of morphological features, DCE-MRI parameters, and ADC values can effectively aid in the preoperative differentiation of TDs from MLNs in rectal cancer.
7.Discriminating Tumor Deposits From Metastatic Lymph Nodes in Rectal Cancer: A Pilot Study Utilizing Dynamic Contrast-Enhanced MRI
Xue-han WU ; Yu-tao QUE ; Xin-yue YANG ; Zi-qiang WEN ; Yu-ru MA ; Zhi-wen ZHANG ; Quan-meng LIU ; Wen-jie FAN ; Li DING ; Yue-jiao LANG ; Yun-zhu WU ; Jian-peng YUAN ; Shen-ping YU ; Yi-yan LIU ; Yan CHEN
Korean Journal of Radiology 2025;26(5):400-410
Objective:
To evaluate the feasibility of dynamic contrast-enhanced MRI (DCE-MRI) in differentiating tumor deposits (TDs) from metastatic lymph nodes (MLNs) in rectal cancer.
Materials and Methods:
A retrospective analysis was conducted on 70 patients with rectal cancer, including 168 lesions (70 TDs and 98 MLNs confirmed by histopathology), who underwent pretreatment MRI and subsequent surgery between March 2019 and December 2022. The morphological characteristics of TDs and MLNs, along with quantitative parameters derived from DCE-MRI (K trans , kep, and v e) and DWI (ADCmin, ADCmax, and ADCmean), were analyzed and compared between the two groups.Multivariable binary logistic regression and receiver operating characteristic (ROC) curve analyses were performed to assess the diagnostic performance of significant individual quantitative parameters and combined parameters in distinguishing TDs from MLNs.
Results:
All morphological features, including size, shape, border, and signal intensity, as well as all DCE-MRI parameters showed significant differences between TDs and MLNs (all P < 0.05). However, ADC values did not demonstrate significant differences (all P > 0.05). Among the single quantitative parameters, v e had the highest diagnostic accuracy, with an area under the ROC curve (AUC) of 0.772 for distinguishing TDs from MLNs. A multivariable logistic regression model incorporating short axis, border, v e, and ADC mean improved diagnostic performance, achieving an AUC of 0.833 (P = 0.027).
Conclusion
The combination of morphological features, DCE-MRI parameters, and ADC values can effectively aid in the preoperative differentiation of TDs from MLNs in rectal cancer.
8.Discriminating Tumor Deposits From Metastatic Lymph Nodes in Rectal Cancer: A Pilot Study Utilizing Dynamic Contrast-Enhanced MRI
Xue-han WU ; Yu-tao QUE ; Xin-yue YANG ; Zi-qiang WEN ; Yu-ru MA ; Zhi-wen ZHANG ; Quan-meng LIU ; Wen-jie FAN ; Li DING ; Yue-jiao LANG ; Yun-zhu WU ; Jian-peng YUAN ; Shen-ping YU ; Yi-yan LIU ; Yan CHEN
Korean Journal of Radiology 2025;26(5):400-410
Objective:
To evaluate the feasibility of dynamic contrast-enhanced MRI (DCE-MRI) in differentiating tumor deposits (TDs) from metastatic lymph nodes (MLNs) in rectal cancer.
Materials and Methods:
A retrospective analysis was conducted on 70 patients with rectal cancer, including 168 lesions (70 TDs and 98 MLNs confirmed by histopathology), who underwent pretreatment MRI and subsequent surgery between March 2019 and December 2022. The morphological characteristics of TDs and MLNs, along with quantitative parameters derived from DCE-MRI (K trans , kep, and v e) and DWI (ADCmin, ADCmax, and ADCmean), were analyzed and compared between the two groups.Multivariable binary logistic regression and receiver operating characteristic (ROC) curve analyses were performed to assess the diagnostic performance of significant individual quantitative parameters and combined parameters in distinguishing TDs from MLNs.
Results:
All morphological features, including size, shape, border, and signal intensity, as well as all DCE-MRI parameters showed significant differences between TDs and MLNs (all P < 0.05). However, ADC values did not demonstrate significant differences (all P > 0.05). Among the single quantitative parameters, v e had the highest diagnostic accuracy, with an area under the ROC curve (AUC) of 0.772 for distinguishing TDs from MLNs. A multivariable logistic regression model incorporating short axis, border, v e, and ADC mean improved diagnostic performance, achieving an AUC of 0.833 (P = 0.027).
Conclusion
The combination of morphological features, DCE-MRI parameters, and ADC values can effectively aid in the preoperative differentiation of TDs from MLNs in rectal cancer.
9.The constituent elements, experiences, and popularization significance of the palliative care model of integrated elderly care and medical services
Zehuan HUANG ; Mengdong XIN ; Lidan QI ; Long ZHAO ; Minyu WANG ; Lu QIN ; Zhenhua LU ; Zhao LI ; Yue HE ; Xi ZENG
Chinese Medical Ethics 2025;38(7):914-923
Under the trend of increasing aging, integrated elderly care and medical services is an important measure to optimize the supply of elderly care services and promote the good death of the elderly. Using the cooperative production theory and the classical grounded theory, a qualitative analysis was conducted on 38 cases of elderly palliative care and 25 cases of hospital-based palliative care under the integrated elderly care and medical services model from a hospital in Nanning City using Nvivo 20.0 software. This paper found that the integrated elderly care and medical services mode emphasized the deep integration of medical and elderly care services by integrating resources and improving service efficiency, to achieve the basic experience of comprehensive health care for the elderly. The promotion of these experiences has a positive significance for building a multi-agent cooperative production system, strengthening personnel training, perfecting the performance distribution mechanism, and further promoting the development of the national palliative care pilot.
10.Exploring Mechanism of Hei Xiaoyaosan Regulating PI3K/Akt Pathway to Improve Learning and Memory Ability of Insomnia Rats with Liver Depression Syndrome Based on Transcriptomics
Jiamin LIU ; Yale WANG ; Hai HUANG ; Yue LI ; Xin FAN ; Pengpeng LIANG ; Shizhao ZHANG ; Mei YAN ; Guiyun LI ; Hongyan WU
Chinese Journal of Experimental Traditional Medical Formulae 2025;31(16):114-125
ObjectiveBased on transcriptomics, to explore the mechanism of Hei Xiaoyaosan regulating the phosphatidylinositol 3-kinase/protein kinase B (PI3K/Akt) signaling pathway to improve the learning and memory ability of insomnia rats with liver depression syndrome. MethodsSixty 8-week-old male SD rats were randomly divided into the blank group, model group, eszopiclone group (0.09 mg·kg-1), and low, medium, and high dose groups of Hei Xiaoyaosan (3.82, 7.65, 15.30 g·kg-1), with ten rats in each group. Except for the blank group, the other groups were induced insomnia rat model with liver depression by chronic restraint, tail clamping stimulation and intraperitoneal injection of p-chlorophenylalanine (PCPA). Each treatment group received intragastric administration according to the specified dosage, once a day for 14 consecutive days. The pentobarbital sodium cooperative sleep test, open field test, and Morris water maze test were used to test the sleep quality, depressive-like behavior, and learning and memory abilities of rats. Additionally, enzyme-linked immunosorbent assay (ELISA) was used to detect the contents of 5-hydroxytryptamine (5-HT), γ-aminobutyric acid (GABA), brain-derived neurotrophic factor (BDNF), glial cell line-derived neurotrophic factor (GDNF) and nitric oxide (NO) in hippocampus. Hematoxylin-eosin (HE) staining was performed to observe pathological changes of the hippocampal tissue, while terminal deoxynucleotidyl transferase deoxyuridine triphosphate (dUTP) nick end labeling (TUNEL) was used to evaluate apoptosis of hippocampal neurons. Transcriptomic sequencing technology was employed to identify differentially expressed genes in hippocampus between the model group and the blank group, as well as between the medium-dose group of Hei Xiaoyaosan and the model group. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis were performed on the intersecting genes. Subsequently, the enriched key genes and signaling pathways were analyzed and verified. Real-time fluorescence quantitative polymerase chain reaction (Real-time PCR) was utilized to assess the mRNA expression levels of phosphatase and tensin homolog (PTEN), B-cell lymphoma-2 (Bcl-2)-like protein 11 (BCL2L11), and mitogen-activated protein kinase 1 (MAPK1) in hippocampus, and Western blot was employed to evaluate the protein expressions of PI3K, phosphorylation (p)-PI3K, Akt, p-Akt, Bcl-2, Bcl-2-associated X protein (Bax), and cleaved Caspase-3 in the same tissue. ResultsCompared with the blank group, the model group exhibited a reduction in body weight, an increase in sleep latency, and a decrease in sleep duration (P<0.01). Additionally, rats showed obvious depression-like behavior, and their learning and memory abilities decreased. Furthermore, the contents of 5-HT, GABA, NO, BDNF and GDNF in hippocampus decreased (P<0.01). Histological examination revealed a disorganized cell arrangement in the CA1 region of the hippocampus, characterized by irregular cell shapes, a reduced cell count, deeply stained and pyknotic nuclei, increased vacuolar degeneration, and an elevated apoptosis rate (P<0.01). Compared with the model group, the body weight of the high and medium dose groups of Hei Xiaoyaosan increased, the sleep latency shortened and the sleep time prolonged (P<0.05, P<0.01). Additionally, depression-like behavior and learning and memory abilities of rats were significantly improved, the levels of 5-HT, GABA, NO, BDNF and GDNF in the hippocampus increased (P<0.05, P<0.01). These interventions also ameliorated pathological damage in the hippocampal CA1 area and reduced the apoptosis of hippocampal neurons (P<0.01). Transcriptomic sequencing results indicated that Hei Xiaoyaosan might exert a therapeutic effect by regulating PI3K/Akt pathway through key mRNAs such as PTEN, BCL2L11, and MAPK1. The roles of these key mRNAs and proteins within PI3K/Akt pathway were further validated. In comparison to the blank group, the expression levels of PTEN, BCL2L11 and MAPK1 mRNA in the hippocampus of rats in the model group were increased (P<0.01), while the protein expression levels of p-PI3K, p-Akt and Bcl-2 were decreased (P<0.01), and the protein expression levels of PTEN, Bax and cleaved Caspase-3 were increased (P<0.01). Compared with the model group, the high-dose and medium-dose groups of Hei Xiaoyaosan could down-regulate the expressions of PTEN, BCL2L11 and MAPK1 mRNAs (P<0.01), up-regulate the expressions of p-PI3K, p-Akt and Bcl-2 proteins (P<0.01), and down-regulate the protein expressions of PTEN, Bax and cleaved Caspase-3 (P<0.05, P<0.01). ConclusionHei Xiaoyaosan may regulate PI3K/Akt signaling pathway by down-regulating expressions of key genes such as PTEN, BCL2L11 and MAPK1, and thus improve the learning and memory abilities of insomnia rats with liver depression syndrome.

Result Analysis
Print
Save
E-mail