AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

Adipose tissue is a critical energy reservoir in animals and humans, with multifaceted roles in endocrine regulation, immune response, and providing mechanical protection. Based on anatomical location and functional characteristics, adipose tissue can be categorized into distinct types, including white adipose tissue (WAT), brown adipose tissue (BAT), beige adipose tissue, and pink adipose tissue. Traditionally, adipose tissue research has centered on its morphological and functional properties as a whole. However, with the advent of single-cell transcriptomics, a new level of complexity in adipose tissue has been unveiled, showing that even under identical conditions, cells of the same type may exhibit significant variation in morphology, structure, function, and gene expression——phenomena collectively referred to as cellular heterogeneity. Single-cell transcriptomics, including techniques like single-cell RNA sequencing (scRNA-seq) and single-nucleus RNA sequencing (snRNA-seq), enables in-depth analysis of the diversity and heterogeneity of adipocytes at the single-cell level. This high-resolution approach has not only deepened our understanding of adipocyte functionality but also facilitated the discovery of previously unidentified cell types and gene expression patterns that may play key roles in adipose tissue function. This review delves into the latest advances in the application of single-cell transcriptomics in elucidating the heterogeneity and diversity within adipose tissue, highlighting how these findings have redefined the understanding of cell subpopulations within different adipose depots. Moreover, the review explores how single-cell transcriptomic technologies have enabled the study of cellular communication pathways and differentiation trajectories among adipose cell subgroups. By mapping these interactions and differentiation processes, researchers gain insights into how distinct cellular subpopulations coordinate within adipose tissues, which is crucial for maintaining tissue homeostasis and function. Understanding these mechanisms is essential, as dysregulation in adipose cell interactions and differentiation underlies a range of metabolic disorders, including obesity and diabetes mellitus type 2. Furthermore, single-cell transcriptomics holds promising implications for identifying therapeutic targets; by pinpointing specific cell types and gene pathways involved in adipose tissue dysfunction, these technologies pave the way for developing targeted interventions aimed at modulating specific adipose subpopulations. In summary, this review provides a comprehensive analysis of the role of single-cell transcriptomic technologies in uncovering the heterogeneity and functional diversity of adipose tissues.

Objective: To evaluate the feasibility of dynamic contrast-enhanced MRI (DCE-MRI) in differentiating tumor deposits (TDs) from metastatic lymph nodes (MLNs) in rectal cancer. Materials and Methods: A retrospective analysis was conducted on 70 patients with rectal cancer, including 168 lesions (70 TDs and 98 MLNs confirmed by histopathology), who underwent pretreatment MRI and subsequent surgery between March 2019 and December 2022. The morphological characteristics of TDs and MLNs, along with quantitative parameters derived from DCE-MRI (K trans , kep, and v e) and DWI (ADCmin, ADCmax, and ADCmean), were analyzed and compared between the two groups.Multivariable binary logistic regression and receiver operating characteristic (ROC) curve analyses were performed to assess the diagnostic performance of significant individual quantitative parameters and combined parameters in distinguishing TDs from MLNs. Results: All morphological features, including size, shape, border, and signal intensity, as well as all DCE-MRI parameters showed significant differences between TDs and MLNs (all P < 0.05). However, ADC values did not demonstrate significant differences (all P > 0.05). Among the single quantitative parameters, v e had the highest diagnostic accuracy, with an area under the ROC curve (AUC) of 0.772 for distinguishing TDs from MLNs. A multivariable logistic regression model incorporating short axis, border, v e, and ADC mean improved diagnostic performance, achieving an AUC of 0.833 (P = 0.027). Conclusion The combination of morphological features, DCE-MRI parameters, and ADC values can effectively aid in the preoperative differentiation of TDs from MLNs in rectal cancer.

Objective: To evaluate the feasibility of dynamic contrast-enhanced MRI (DCE-MRI) in differentiating tumor deposits (TDs) from metastatic lymph nodes (MLNs) in rectal cancer. Materials and Methods: A retrospective analysis was conducted on 70 patients with rectal cancer, including 168 lesions (70 TDs and 98 MLNs confirmed by histopathology), who underwent pretreatment MRI and subsequent surgery between March 2019 and December 2022. The morphological characteristics of TDs and MLNs, along with quantitative parameters derived from DCE-MRI (K trans , kep, and v e) and DWI (ADCmin, ADCmax, and ADCmean), were analyzed and compared between the two groups.Multivariable binary logistic regression and receiver operating characteristic (ROC) curve analyses were performed to assess the diagnostic performance of significant individual quantitative parameters and combined parameters in distinguishing TDs from MLNs. Results: All morphological features, including size, shape, border, and signal intensity, as well as all DCE-MRI parameters showed significant differences between TDs and MLNs (all P < 0.05). However, ADC values did not demonstrate significant differences (all P > 0.05). Among the single quantitative parameters, v e had the highest diagnostic accuracy, with an area under the ROC curve (AUC) of 0.772 for distinguishing TDs from MLNs. A multivariable logistic regression model incorporating short axis, border, v e, and ADC mean improved diagnostic performance, achieving an AUC of 0.833 (P = 0.027). Conclusion The combination of morphological features, DCE-MRI parameters, and ADC values can effectively aid in the preoperative differentiation of TDs from MLNs in rectal cancer.

Collagen is a major structural protein in the matrix of animal cells and the most widely distributed and abundant functional protein in mammals. Collagen’s good biocompatibility, biodegradability and biological activity make it a very valuable biomaterial. According to the source of collagen, it can be broadly categorized into two types: one is animal collagen; the other is recombinant collagen. Animal collagen is mainly extracted and purified from animal connective tissues by chemical methods, such as acid, alkali and enzyme methods, etc. Recombinant collagen refers to collagen produced by gene splicing technology, where the amino acid sequence is first designed and improved according to one’s own needs, and the gene sequence of improved recombinant collagen is highly consistent with that of human beings, and then the designed gene sequence is cloned into the appropriate vector, and then transferred to the appropriate expression vector. The designed gene sequence is cloned into a suitable vector, and then transferred to a suitable expression system for full expression, and finally the target protein is obtained by extraction and purification technology. Recombinant collagen has excellent histocompatibility and water solubility, can be directly absorbed by the human body and participate in the construction of collagen, remodeling of the extracellular matrix, cell growth, wound healing and site filling, etc., which has demonstrated significant effects, and has become the focus of the development of modern biomedical materials. This paper firstly elaborates the structure, type, and tissue distribution of human collagen, as well as the associated genetic diseases of different types of collagen, then introduces the specific process of producing animal source collagen and recombinant collagen, explains the advantages of recombinant collagen production method, and then introduces the various systems of expressing recombinant collagen, as well as their advantages and disadvantages, and finally briefly introduces the application of animal collagen, focusing on the use of animal collagen in the development of biopharmaceutical materials. In terms of application, it focuses on the use of animal disease models exploring the application effects of recombinant collagen in wound hemostasis, wound repair, corneal therapy, female pelvic floor dysfunction (FPFD), vaginal atrophy (VA) and vaginal dryness, thin endometritis (TE), chronic endometritis (CE), bone tissue regeneration in vivo, cardiovascular diseases, breast cancer (BC) and anti-aging. The mechanism of action of recombinant collagen in the treatment of FPFD and CE was introduced, and the clinical application and curative effect of recombinant collagen in skin burn, skin wound, dermatitis, acne and menopausal urogenital syndrome (GSM) were summarized. From the exploratory studies and clinical applications, it is evident that recombinant collagen has demonstrated surprising effects in the treatment of all types of diseases, such as reducing inflammation, promoting cell proliferation, migration and adhesion, increasing collagen deposition, and remodeling the extracellular matrix. At the end of the review, the challenges faced by recombinant collagen are summarized: to develop new recombinant collagen types and dosage forms, to explore the mechanism of action of recombinant collagen, and to provide an outlook for the future development and application of recombinant collagen.

Objective: To evaluate the feasibility of dynamic contrast-enhanced MRI (DCE-MRI) in differentiating tumor deposits (TDs) from metastatic lymph nodes (MLNs) in rectal cancer. Materials and Methods: A retrospective analysis was conducted on 70 patients with rectal cancer, including 168 lesions (70 TDs and 98 MLNs confirmed by histopathology), who underwent pretreatment MRI and subsequent surgery between March 2019 and December 2022. The morphological characteristics of TDs and MLNs, along with quantitative parameters derived from DCE-MRI (K trans , kep, and v e) and DWI (ADCmin, ADCmax, and ADCmean), were analyzed and compared between the two groups.Multivariable binary logistic regression and receiver operating characteristic (ROC) curve analyses were performed to assess the diagnostic performance of significant individual quantitative parameters and combined parameters in distinguishing TDs from MLNs. Results: All morphological features, including size, shape, border, and signal intensity, as well as all DCE-MRI parameters showed significant differences between TDs and MLNs (all P < 0.05). However, ADC values did not demonstrate significant differences (all P > 0.05). Among the single quantitative parameters, v e had the highest diagnostic accuracy, with an area under the ROC curve (AUC) of 0.772 for distinguishing TDs from MLNs. A multivariable logistic regression model incorporating short axis, border, v e, and ADC mean improved diagnostic performance, achieving an AUC of 0.833 (P = 0.027). Conclusion The combination of morphological features, DCE-MRI parameters, and ADC values can effectively aid in the preoperative differentiation of TDs from MLNs in rectal cancer.

Urticarial vasculitis is a skin disease with urticaria-like lesions and a histopathological pattern of leukocytoclastic vasculitis. It is considered a "hidden rash" in traditional Chinese medicine. Xuanfu is the portal that regulates qi, blood, fluid, and the ascending, descending, exiting, and entering of nutrition qi and defensive qi. Collaterals are the pathways for the circulation of qi and blood. The two accompany each other, connecting zang-fu organs, reaching the surfaces of the skin, hair, and external body, circulating qi and fluid, and moistening and protecting the skin. Based on the theory of Xuanfu-collateral, this study aimed to clarify the etiology, pathogenesis, and treatment method of urticarial vasculitis. External assault by wind and Xuanfu blockage are believed to be the initiating factors of this disease. The malnutrition of Xuanfu and collaterals and accumulated dampness-heat are important links in the occurrence and development of urticarial vasculitis. It spreads from Xuanfu to the collaterals, and blockage of the collaterals is the immanent trend of this disease. Clinically, by closely adhering to the core pathogenesis of blockage of Xuanfu-collateral, treatment method such as using wind medicinals to open Xuanfu with pungent and dispersing properties, using the method of supplement deficiency and removing the blockage, and using medicinals to promote blood circulation and remove blood stasis to unblock the blocked collaterals. The herbs are flexibly added or subtracted to unblock Xuanfu and collaterals, harmonize qi and blood, thus all symptoms can be relieved. We hope that this study will provide new ideas for the treatment of urticarial vasculitis with traditional Chinese medicine.

Mild cognitive impairment due to Alzheimer′s disease is an inevitable pathological stage in the early development of Alzheimer′s disease, which can be classified as "microlumps in the brain collaterals" in traditional Chinese medicine. Based on the theory of latent toxin blocking collaterals, this article discusses the etiology and pathogenesis, clinical sequelae, and traditional Chinese medicine intervention strategies for mild cognitive impairment due to Alzheimer′s disease. The onset of mild cognitive impairment due to Alzheimer′s disease is very similar to the latent pathogen theory, which states that "the latent pathogen is latent and then develops, the poison is deep and difficult to cure, and the development can be recognized but the latent pathogen cannot be detected." Combining clinical experience, our team believes that the basic nature of the disease is a slight deficiency and a slight excess of symptoms. A slight deficiency of the five zang viscera and six fu viscera as root and a latent toxin colling collaterals of qi, fire, phlegm, and blood stasis as manifestaion. These usually start from the qi depression and develop into phlegm coagulation and blood stasis, then end up in latent toxin and gradually become the healthy qi deficiency. Therefore, the deficiency of vital qi and incubation of evil, latent toxin blocking collaterals the pathogenesis of early intervention of this disease should be carried out, upholding the idea that "the upper workman treats the disease before it is diagnosed." The principle of strengthening vital qi to eliminate pathogenic factors, slowing down and promoting pathogenic factors elimination, establishing the method of supporting correctness and wisdom, simultaneously detoxifying and clearing the blood stasis, pattern differentiation as the main and the disease differentiation as the first, combining the disease and pattern, and adjusting the macroscopic and microscopic, focusing simultaneously on eliminating and replenishing, dispel phlegm and remove blood stasis, achieve a strong vital qi and the elimination of evil, and enhance intelligence, delay or even block the progression of mild cognitive impairment due to Alzheimer′s disease, improve patients′ quality of life, and provide a theoretical basis for the early clinical prevention and treatment of Alzheimer′s disease.

Objective: To evaluate the feasibility of dynamic contrast-enhanced MRI (DCE-MRI) in differentiating tumor deposits (TDs) from metastatic lymph nodes (MLNs) in rectal cancer. Materials and Methods: A retrospective analysis was conducted on 70 patients with rectal cancer, including 168 lesions (70 TDs and 98 MLNs confirmed by histopathology), who underwent pretreatment MRI and subsequent surgery between March 2019 and December 2022. The morphological characteristics of TDs and MLNs, along with quantitative parameters derived from DCE-MRI (K trans , kep, and v e) and DWI (ADCmin, ADCmax, and ADCmean), were analyzed and compared between the two groups.Multivariable binary logistic regression and receiver operating characteristic (ROC) curve analyses were performed to assess the diagnostic performance of significant individual quantitative parameters and combined parameters in distinguishing TDs from MLNs. Results: All morphological features, including size, shape, border, and signal intensity, as well as all DCE-MRI parameters showed significant differences between TDs and MLNs (all P < 0.05). However, ADC values did not demonstrate significant differences (all P > 0.05). Among the single quantitative parameters, v e had the highest diagnostic accuracy, with an area under the ROC curve (AUC) of 0.772 for distinguishing TDs from MLNs. A multivariable logistic regression model incorporating short axis, border, v e, and ADC mean improved diagnostic performance, achieving an AUC of 0.833 (P = 0.027). Conclusion The combination of morphological features, DCE-MRI parameters, and ADC values can effectively aid in the preoperative differentiation of TDs from MLNs in rectal cancer.

Objective: To evaluate the feasibility of dynamic contrast-enhanced MRI (DCE-MRI) in differentiating tumor deposits (TDs) from metastatic lymph nodes (MLNs) in rectal cancer. Materials and Methods: A retrospective analysis was conducted on 70 patients with rectal cancer, including 168 lesions (70 TDs and 98 MLNs confirmed by histopathology), who underwent pretreatment MRI and subsequent surgery between March 2019 and December 2022. The morphological characteristics of TDs and MLNs, along with quantitative parameters derived from DCE-MRI (K trans , kep, and v e) and DWI (ADCmin, ADCmax, and ADCmean), were analyzed and compared between the two groups.Multivariable binary logistic regression and receiver operating characteristic (ROC) curve analyses were performed to assess the diagnostic performance of significant individual quantitative parameters and combined parameters in distinguishing TDs from MLNs. Results: All morphological features, including size, shape, border, and signal intensity, as well as all DCE-MRI parameters showed significant differences between TDs and MLNs (all P < 0.05). However, ADC values did not demonstrate significant differences (all P > 0.05). Among the single quantitative parameters, v e had the highest diagnostic accuracy, with an area under the ROC curve (AUC) of 0.772 for distinguishing TDs from MLNs. A multivariable logistic regression model incorporating short axis, border, v e, and ADC mean improved diagnostic performance, achieving an AUC of 0.833 (P = 0.027). Conclusion The combination of morphological features, DCE-MRI parameters, and ADC values can effectively aid in the preoperative differentiation of TDs from MLNs in rectal cancer.