1.Related research on pathogenic candidate genes for familial blepharophimosis-ptosis-epicanthus inversus syndrome
Xin TAN ; Linan JIAO ; Xianfang PU ; Yunqin LI ; Yue ZOU ; Jianshu KANG
International Eye Science 2026;26(1):142-147
AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.
2.Umbrella decision-making model for diagnosis and treatment of elderly lung cancer patients: Construction and practice
Lunxu LIU ; Jian ZHOU ; Xiang DING ; Nan CHEN ; Jianxin XUE ; Xuelei MA ; Ye WANG ; Weiya WANG ; Liqing PENG ; Xin YOU ; Minggang SU ; Xu CHENG ; Jiao WANG ; Ning GE ; Deying KANG ; Yuchen HUANG ; Jinghan WANG ; Yu TONG ; Yaoxi ZHANG ; Jirong YUE ; Hu LIAO
Chinese Journal of Clinical Thoracic and Cardiovascular Surgery 2026;33(06):833-839
With the accelerating trend of population aging, the number of elderly patients with lung cancer continues to rise, and the disease burden is becoming increasingly heavy. The clinical management of these patients faces severe challenges due to their decreased physiological reserve, complex comorbidities, and significant individual heterogeneity. Consequently, under traditional diagnosis and treatment models, doctors often struggle to identify the individualized risks of elderly patients in a timely and comprehensive manner, which can easily lead to decision biases such as undertreatment or overtreatment. In view of this, this study advocates for the establishment of an umbrella decision-making model specifically tailored for elderly lung cancer patients. Grounded in a multidisciplinary team (MDT) platform, this model deeply integrates oncological indicators with the comprehensive geriatric assessment (CGA) system. By holistically considering multidimensional variables including tumor burden, organ function, frailty index, cognitive status, and social support, the model establishes an operational mechanism characterized by "single entry, precise stratification, and targeted selection". Accordingly, patients can be scientifically triaged into distinct intervention tiers, such as active surveillance, minimally invasive surgery, drug therapy, radiotherapy, and best supportive care, thereby achieving real-time alignment between treatment intensity and patient fitness. This article elaborates on the construction logic and key operational procedures of this novel decision-making framework, aiming to guide clinical practice beyond the limitations of a tumor-centric perspective toward a holistic, dynamic, whole-course management strategy. This transition seeks to ensure optimal quality of life and clinical net benefit for elderly patients alongside survival prolongation.
3.Characteristics, microbial composition, and mycotoxin profile of fermented traditional Chinese medicines.
Hui-Ru ZHANG ; Meng-Yue GUO ; Jian-Xin LYU ; Wan-Xuan ZHU ; Chuang WANG ; Xin-Xin KANG ; Jiao-Yang LUO ; Mei-Hua YANG
China Journal of Chinese Materia Medica 2025;50(1):48-57
Fermented traditional Chinese medicine(TCM) has a long history of medicinal use, such as Sojae Semen Praeparatum, Arisaema Cum Bile, Pinelliae Rhizoma Fermentata, red yeast rice, and Jianqu. Fermentation technology was recorded in the earliest TCM work, Shen Nong's Classic of the Materia Medica. Microorganisms are essential components of the fermentation process. However, the contamination of fermented TCM by toxigenic fungi and mycotoxins due to unstandardized fermentation processes seriously affects the quality of TCM and poses a threat to the life and health of consumers. In this paper, the characteristics, microbial composition, and mycotoxin profile of fermented TCM are systematically summarized to provide a theoretical basis for its quality and safety control.
Fermentation
;
Mycotoxins/analysis*
;
Drugs, Chinese Herbal/analysis*
;
Fungi/classification*
;
Bacteria/genetics*
;
Drug Contamination
;
Medicine, Chinese Traditional
4.Discriminating Tumor Deposits From Metastatic Lymph Nodes in Rectal Cancer: A Pilot Study Utilizing Dynamic Contrast-Enhanced MRI
Xue-han WU ; Yu-tao QUE ; Xin-yue YANG ; Zi-qiang WEN ; Yu-ru MA ; Zhi-wen ZHANG ; Quan-meng LIU ; Wen-jie FAN ; Li DING ; Yue-jiao LANG ; Yun-zhu WU ; Jian-peng YUAN ; Shen-ping YU ; Yi-yan LIU ; Yan CHEN
Korean Journal of Radiology 2025;26(5):400-410
Objective:
To evaluate the feasibility of dynamic contrast-enhanced MRI (DCE-MRI) in differentiating tumor deposits (TDs) from metastatic lymph nodes (MLNs) in rectal cancer.
Materials and Methods:
A retrospective analysis was conducted on 70 patients with rectal cancer, including 168 lesions (70 TDs and 98 MLNs confirmed by histopathology), who underwent pretreatment MRI and subsequent surgery between March 2019 and December 2022. The morphological characteristics of TDs and MLNs, along with quantitative parameters derived from DCE-MRI (K trans , kep, and v e) and DWI (ADCmin, ADCmax, and ADCmean), were analyzed and compared between the two groups.Multivariable binary logistic regression and receiver operating characteristic (ROC) curve analyses were performed to assess the diagnostic performance of significant individual quantitative parameters and combined parameters in distinguishing TDs from MLNs.
Results:
All morphological features, including size, shape, border, and signal intensity, as well as all DCE-MRI parameters showed significant differences between TDs and MLNs (all P < 0.05). However, ADC values did not demonstrate significant differences (all P > 0.05). Among the single quantitative parameters, v e had the highest diagnostic accuracy, with an area under the ROC curve (AUC) of 0.772 for distinguishing TDs from MLNs. A multivariable logistic regression model incorporating short axis, border, v e, and ADC mean improved diagnostic performance, achieving an AUC of 0.833 (P = 0.027).
Conclusion
The combination of morphological features, DCE-MRI parameters, and ADC values can effectively aid in the preoperative differentiation of TDs from MLNs in rectal cancer.
5.Exploring urban versus rural disparities in atrial fibrillation: prevalence and management trends among elderly Chinese in a screening study.
Wei ZHANG ; Yi CHEN ; Lei-Xiao HU ; Jia-Hui XIA ; Xiao-Fei YE ; Wen-Yuan-Yue WANG ; Xin-Yu WANG ; Quan-Yong XIANG ; Qin TAN ; Xiao-Long WANG ; Xiao-Min YANG ; De-Chao ZHAO ; Xin CHEN ; Yan LI ; Ji-Guang WANG ; FOR THE IMPRESSION INVESTIGATORS AND COORDINATORS
Journal of Geriatric Cardiology 2025;22(2):246-254
BACKGROUND:
Atrial fibrillation (AF) is a common cardiac arrhythmia in the elderly. This study aimed to evaluate urban-rural disparities in its prevalence and management in elderly Chinese.
METHODS:
Consecutive participants aged ≥ 65 years attending outpatient clinics were enrolled for AF screening using handheld single-lead electrocardiogram (ECG) from April 2017 to December 2022. Each ECG rhythm strip was reviewed from the research team. AF or uninterpretable single-lead ECGs were referred for 12-lead ECG. Primary study outcome comparison was between rural and urban areas for the prevalence of AF. The Student's t-test was used to compare mean values of clinical characteristics between rural and urban participants, while the Pearson's chi-square test was used to compare between-group proportions. Multivariate stepwise logistic regression analysis was performed to estimate the association between AF and various patient characteristics.
RESULTS:
The 29,166 study participants included 13,253 men (45.4%) and had a mean age of 72.2 years. The 7073 rural participants differed significantly (P ≤ 0.02) from the 22,093 urban participants in several major characteristics, such as older age, greater body mass index, and so on. The overall prevalence of AF was 4.6% (n = 1347). AF was more prevalent in 7073 rural participants than 22,093 urban participants (5.6% vs. 4.3%, P < 0.01), before and after adjustment for age, body mass index, blood pressure, pulse rate, cigarette smoking, alcohol consumption and prior medical history. Multivariate logistic regression analysis identified overweight/obesity (OR = 1.35, 95% CI: 1.17-1.54) in urban areas and cigarette smoking (OR = 1.62, 95% CI: 1.20-2.17) and alcohol consumption (OR = 1.42, 95% CI: 1.04-1.93) in rural areas as specific risk factors for prevalent AF. In patients with known AF in urban areas (n = 781) and rural areas (n = 338), 60.6% and 45.9%, respectively, received AF treatment (P < 0.01), and only 22.4% and 17.2%, respectively, received anticoagulation therapy (P = 0.05).
CONCLUSIONS
In China, there are urban-rural disparities in AF in the elderly, with a higher prevalence and worse management in rural areas than urban areas. Our study findings provide insight for health policymakers to consider urban-rural disparity in the prevention and treatment of AF.
6.Discriminating Tumor Deposits From Metastatic Lymph Nodes in Rectal Cancer: A Pilot Study Utilizing Dynamic Contrast-Enhanced MRI
Xue-han WU ; Yu-tao QUE ; Xin-yue YANG ; Zi-qiang WEN ; Yu-ru MA ; Zhi-wen ZHANG ; Quan-meng LIU ; Wen-jie FAN ; Li DING ; Yue-jiao LANG ; Yun-zhu WU ; Jian-peng YUAN ; Shen-ping YU ; Yi-yan LIU ; Yan CHEN
Korean Journal of Radiology 2025;26(5):400-410
Objective:
To evaluate the feasibility of dynamic contrast-enhanced MRI (DCE-MRI) in differentiating tumor deposits (TDs) from metastatic lymph nodes (MLNs) in rectal cancer.
Materials and Methods:
A retrospective analysis was conducted on 70 patients with rectal cancer, including 168 lesions (70 TDs and 98 MLNs confirmed by histopathology), who underwent pretreatment MRI and subsequent surgery between March 2019 and December 2022. The morphological characteristics of TDs and MLNs, along with quantitative parameters derived from DCE-MRI (K trans , kep, and v e) and DWI (ADCmin, ADCmax, and ADCmean), were analyzed and compared between the two groups.Multivariable binary logistic regression and receiver operating characteristic (ROC) curve analyses were performed to assess the diagnostic performance of significant individual quantitative parameters and combined parameters in distinguishing TDs from MLNs.
Results:
All morphological features, including size, shape, border, and signal intensity, as well as all DCE-MRI parameters showed significant differences between TDs and MLNs (all P < 0.05). However, ADC values did not demonstrate significant differences (all P > 0.05). Among the single quantitative parameters, v e had the highest diagnostic accuracy, with an area under the ROC curve (AUC) of 0.772 for distinguishing TDs from MLNs. A multivariable logistic regression model incorporating short axis, border, v e, and ADC mean improved diagnostic performance, achieving an AUC of 0.833 (P = 0.027).
Conclusion
The combination of morphological features, DCE-MRI parameters, and ADC values can effectively aid in the preoperative differentiation of TDs from MLNs in rectal cancer.
7.Discriminating Tumor Deposits From Metastatic Lymph Nodes in Rectal Cancer: A Pilot Study Utilizing Dynamic Contrast-Enhanced MRI
Xue-han WU ; Yu-tao QUE ; Xin-yue YANG ; Zi-qiang WEN ; Yu-ru MA ; Zhi-wen ZHANG ; Quan-meng LIU ; Wen-jie FAN ; Li DING ; Yue-jiao LANG ; Yun-zhu WU ; Jian-peng YUAN ; Shen-ping YU ; Yi-yan LIU ; Yan CHEN
Korean Journal of Radiology 2025;26(5):400-410
Objective:
To evaluate the feasibility of dynamic contrast-enhanced MRI (DCE-MRI) in differentiating tumor deposits (TDs) from metastatic lymph nodes (MLNs) in rectal cancer.
Materials and Methods:
A retrospective analysis was conducted on 70 patients with rectal cancer, including 168 lesions (70 TDs and 98 MLNs confirmed by histopathology), who underwent pretreatment MRI and subsequent surgery between March 2019 and December 2022. The morphological characteristics of TDs and MLNs, along with quantitative parameters derived from DCE-MRI (K trans , kep, and v e) and DWI (ADCmin, ADCmax, and ADCmean), were analyzed and compared between the two groups.Multivariable binary logistic regression and receiver operating characteristic (ROC) curve analyses were performed to assess the diagnostic performance of significant individual quantitative parameters and combined parameters in distinguishing TDs from MLNs.
Results:
All morphological features, including size, shape, border, and signal intensity, as well as all DCE-MRI parameters showed significant differences between TDs and MLNs (all P < 0.05). However, ADC values did not demonstrate significant differences (all P > 0.05). Among the single quantitative parameters, v e had the highest diagnostic accuracy, with an area under the ROC curve (AUC) of 0.772 for distinguishing TDs from MLNs. A multivariable logistic regression model incorporating short axis, border, v e, and ADC mean improved diagnostic performance, achieving an AUC of 0.833 (P = 0.027).
Conclusion
The combination of morphological features, DCE-MRI parameters, and ADC values can effectively aid in the preoperative differentiation of TDs from MLNs in rectal cancer.
8.Expert consensus on apical microsurgery.
Hanguo WANG ; Xin XU ; Zhuan BIAN ; Jingping LIANG ; Zhi CHEN ; Benxiang HOU ; Lihong QIU ; Wenxia CHEN ; Xi WEI ; Kaijin HU ; Qintao WANG ; Zuhua WANG ; Jiyao LI ; Dingming HUANG ; Xiaoyan WANG ; Zhengwei HUANG ; Liuyan MENG ; Chen ZHANG ; Fangfang XIE ; Di YANG ; Jinhua YU ; Jin ZHAO ; Yihuai PAN ; Shuang PAN ; Deqin YANG ; Weidong NIU ; Qi ZHANG ; Shuli DENG ; Jingzhi MA ; Xiuping MENG ; Jian YANG ; Jiayuan WU ; Yi DU ; Junqi LING ; Lin YUE ; Xuedong ZHOU ; Qing YU
International Journal of Oral Science 2025;17(1):2-2
Apical microsurgery is accurate and minimally invasive, produces few complications, and has a success rate of more than 90%. However, due to the lack of awareness and understanding of apical microsurgery by dental general practitioners and even endodontists, many clinical problems remain to be overcome. The consensus has gathered well-known domestic experts to hold a series of special discussions and reached the consensus. This document specifies the indications, contraindications, preoperative preparations, operational procedures, complication prevention measures, and efficacy evaluation of apical microsurgery and is applicable to dentists who perform apical microsurgery after systematic training.
Microsurgery/standards*
;
Humans
;
Apicoectomy
;
Contraindications, Procedure
;
Tooth Apex/diagnostic imaging*
;
Postoperative Complications/prevention & control*
;
Consensus
;
Treatment Outcome
9.Changing resistance profiles of Haemophilus influenzae and Moraxella catarrhalis isolates in hospitals across China:results from the CHINET Antimicrobial Resistance Surveillance Program,2015-2021
Hui FAN ; Chunhong SHAO ; Jia WANG ; Yang YANG ; Fupin HU ; Demei ZHU ; Yunsheng CHEN ; Qing MENG ; Hong ZHANG ; Chun WANG ; Fang DONG ; Wenqi SONG ; Kaizhen WEN ; Yirong ZHANG ; Chuanqing WANG ; Pan FU ; Chao ZHUO ; Danhong SU ; Jiangwei KE ; Shuping ZHOU ; Hua ZHANG ; Fangfang HU ; Mei KANG ; Chao HE ; Hua YU ; Xiangning HUANG ; Yingchun XU ; Xiaojiang ZHANG ; Wenen LIU ; Yanming LI ; Lei ZHU ; Jinhua MENG ; Shifu WANG ; Bin SHAN ; Yan DU ; Wei JIA ; Gang LI ; Jiao FENG ; Ping GONG ; Miao SONG ; Lianhua WEI ; Xin WANG ; Ruizhong WANG ; Hua FANG ; Sufang GUO ; Yanyan WANG ; Dawen GUO ; Jinying ZHAO ; Lixia ZHANG ; Juan MA ; Han SHEN ; Wanqing ZHOU ; Ruyi GUO ; Yan ZHU ; Jinsong WU ; Yuemei LU ; Yuxing NI ; Jingrong SUN ; Xiaobo MA ; Yanqing ZHENG ; Yunsong YU ; Jie LIN ; Ziyong SUN ; Zhongju CHEN ; Zhidong HU ; Jin LI ; Fengbo ZHANG ; Ping JI ; Yunjian HU ; Xiaoman AI ; Jinju DUAN ; Jianbang KANG ; Xuefei HU ; Xuesong XU ; Chao YAN ; Yi LI ; Shanmei WANG ; Hongqin GU ; Yuanhong XU ; Ying HUANG ; Yunzhuo CHU ; Sufei TIAN ; Jihong LI ; Bixia YU ; Cunshan KOU ; Jilu SHEN ; Wenhui HUANG ; Xiuli YANG ; Likang ZHU ; Lin JIANG ; Wen HE ; Chunlei YUE
Chinese Journal of Infection and Chemotherapy 2025;25(1):30-38
Objective To investigate the distribution and antimicrobial resistance profiles of clinically isolated Haemophilus influenzae and Moraxella catarrhalis in hospitals across China from 2015 to 2021,and provide evidence for rational use of antimicrobial agents.Methods Data of H.influenzae and M.catarrhalis strains isolated from 2015 to 2021 in CHINET program were collected for analysis,and antimicrobial susceptibility testing was performed by disc diffusion method or automated systems according to the uniform protocol of CHINET.The results were interpreted according to the CLSI breakpoints in 2022.Beta-lactamases was detected by using nitrocefin disk.Results From 2015 to 2021,a total of 43 642 strains of Haemophilus species were isolated,accounting for 2.91%of the total clinical isolates and 4.07%of Gram-negative bacteria in CHINET program.Among the 40 437 strains of H.influenzae,66.89%were isolated from children and 33.11%were isolated from adults.More than 90%of the H.influenzae strains were isolated from respiratory tract specimens.The prevalence of β-lactamase was 53.79%in H.influenzae strains.The H.influenzae strains isolated from children showed higher resistance rate than the strains isolated from adults.Overall,779 strains of H.influenzae did not produce β-lactamase but were resistant to ampicillin(BLNAR).Beta-lactamase-producing strains showed significantly higher resistance rates to these antimicrobial agents than the β-lactamase-nonproducing strains.Of the 16 191 M.catarrhalis strains,80.06%were isolated from children and 19.94%isolated from adults.M.catarrhalis strains were mostly susceptible to both amoxicillin-clavulanic acid and cefuroxime,evidenced by resistance rate lower than 2.0%.Conclusions The emergence of antibiotic-resistant H.influenzae due to β-lactamase production poses a challenge for clinical anti-infective treatment.Therefore,it is very important to implement antibiotic resistance surveillance for H.influenzae and guide rational antibiotic use.All local clinical microbiology laboratories should actively improve antibiotic susceptibility testing and strengthen antibiotic resistance surveillance for H.influenzae.
10.Discriminating Tumor Deposits From Metastatic Lymph Nodes in Rectal Cancer: A Pilot Study Utilizing Dynamic Contrast-Enhanced MRI
Xue-han WU ; Yu-tao QUE ; Xin-yue YANG ; Zi-qiang WEN ; Yu-ru MA ; Zhi-wen ZHANG ; Quan-meng LIU ; Wen-jie FAN ; Li DING ; Yue-jiao LANG ; Yun-zhu WU ; Jian-peng YUAN ; Shen-ping YU ; Yi-yan LIU ; Yan CHEN
Korean Journal of Radiology 2025;26(5):400-410
Objective:
To evaluate the feasibility of dynamic contrast-enhanced MRI (DCE-MRI) in differentiating tumor deposits (TDs) from metastatic lymph nodes (MLNs) in rectal cancer.
Materials and Methods:
A retrospective analysis was conducted on 70 patients with rectal cancer, including 168 lesions (70 TDs and 98 MLNs confirmed by histopathology), who underwent pretreatment MRI and subsequent surgery between March 2019 and December 2022. The morphological characteristics of TDs and MLNs, along with quantitative parameters derived from DCE-MRI (K trans , kep, and v e) and DWI (ADCmin, ADCmax, and ADCmean), were analyzed and compared between the two groups.Multivariable binary logistic regression and receiver operating characteristic (ROC) curve analyses were performed to assess the diagnostic performance of significant individual quantitative parameters and combined parameters in distinguishing TDs from MLNs.
Results:
All morphological features, including size, shape, border, and signal intensity, as well as all DCE-MRI parameters showed significant differences between TDs and MLNs (all P < 0.05). However, ADC values did not demonstrate significant differences (all P > 0.05). Among the single quantitative parameters, v e had the highest diagnostic accuracy, with an area under the ROC curve (AUC) of 0.772 for distinguishing TDs from MLNs. A multivariable logistic regression model incorporating short axis, border, v e, and ADC mean improved diagnostic performance, achieving an AUC of 0.833 (P = 0.027).
Conclusion
The combination of morphological features, DCE-MRI parameters, and ADC values can effectively aid in the preoperative differentiation of TDs from MLNs in rectal cancer.

Result Analysis
Print
Save
E-mail