AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

Objective: To investigate the awareness of knowledge about hepatitis C prevention and control among outpatients in Ningbo City, Zhejiang Province, and its influencing factors, so as to provide the evidence for strengthening health education on hepatitis C prevention and control. Methods: Based on sentinel surveillance of hepatitis C, the outpatients aged 15 to 65 years at seven hospitals in Yinzhou District, Cixi City and Xiangshan County of Ningbo City were selected using the convenient sampling method from April to June during 2020 and 2022. Demographic information, knowledge and behaviors related to hepatitis C prevention and control were collected through questionnaire surveys. The influencing factors for knowledge about hepatitis C prevention and control were analyzed using a multivariable logistic regression model. Results: A total of 2 792 participants were surveyed, including 1 157 males (41.44%) and 1 635 females (58.56%). The awareness rate of knowledge about hepatitis C prevention and control was 56.23%, and was lower in knowledge about hepatitis C vaccine and treatment. The awareness rates of knowledge about hepatitis C prevention and control among outpatients from 2020 to 2022 were 47.11%, 53.22% and 70.65%, respectively, showing an upward trend (P<0.05). Multivariable logistic regression analysis showed that participants aged 25 to <50 years (OR=1.358, 95%CI: 1.073-1.719), with an educational level of high school or junior college (OR=1.431, 95%CI: 1.134-1.806) or above junior college (OR=3.728, 95%CI: 2.958-4.699), with household monthly income per capita of 3 000 to <5 000 yuan (OR=1.828, 95%CI: 1.344-2.486) or ≥5 000 yuan (OR=1.858, 95%CI: 1.366-2.526), without a history of invasive treatments such as pedicure in public places (OR=1.287, 95%CI: 1.024-1.618), without a history of contact with family members' blood-contaminated items (OR=2.050, 95%CI: 1.552-2.707), and always using condoms during sexual contacts (OR=1.740, 95%CI: 1.273-2.378) had higher awareness of knowledge about hepatitis C prevention and control. Conclusions The awareness of knowledge about hepatitis C vaccine and treatment among outpatients in Ningbo City needs to be improved. Age, educational level, household monthly income per capita, history of invasive treatments such as pedicure in public places, history of contact with family members' blood-contaminated items and frequency of condom use during sexual contacts are associated with outpatients' awareness of knowledge about hepatitis C prevention and control.

BACKGROUND:With the continuous progress of science and technology,the introduction of new technologies and methods will bring more possibilities and new breakthroughs for the application of shape memory alloys in the fields of assistive and rehabilitation. OBJECTIVE:To review the application status of shape memory alloys in assistive and rehabilitation equipment,discuss their main methods,techniques and results,summarize and put forward suggestions,hoping that shape memory alloys can be continuously optimized and bring more new changes for the development of assistive and rehabilitation equipment. METHODS:WanFang,PubMed,and Web of Science databases were searched by computer."Shape memory alloys,application progress,orthodontics,orthopedic,prosthesis,rehabilitation,properties,implantation,mechanical properties,nickel-titanium memory alloys,actuation"were used as Chinese search terms."Shape memory alloys,application,orthodontics,orthopedic,prosthetics,rehabilitation,properties,implant,drive,progress,prostheses"were used as English search terms.Finally,91 articles were included for review. RESULTS AND CONCLUSION:(1)Shape memory alloy has the characteristics of corrosion resistance,wear resistance,biocompatibility,fatigue resistance,kink resistance and other properties.Compared with other traditional materials(stainless steel,titanium alloy,cobalt-chromium alloy,etc.),shape memory alloy has lower elastic modulus and no biological toxicity,which is suitable for long-term implantation as an implant prosthesis.Due to its shape memory effect and excellent mechanical properties,it is mainly used as a driving element or as a bridge connecting the device and the human body in artificial limbs,orthoses and rehabilitation equipment.(2)The use of shape memory alloy drive elements can reduce the weight of the device,eliminate noise,easy to operate,easy to carry,better assist joint movement;compared with the use of pneumatic,hydraulic,and electrical drive methods of the device,it has obvious advantages.(3)In addition,shape memory alloy can produce permanent and stable stress during deformation.Compared with stainless steel,titanium alloy and aluminum alloy,shape memory alloy has a higher material recovery rate and does not need to be replaced and adjusted frequently,so it is more practical in the correction of deformity.(4)At present,shape memory alloy is most commonly used in orthosis,and the best clinical application effect is in stapes prosthesis.However,due to the limitations of technology and cost,shape memory alloys are rarely used in artificial limbs and rehabilitation equipment,and there is a lack of large sample size studies on the application effect.(5)Although shape memory alloys have been developed in the field of auxiliary and rehabilitation,there are still many problems:it is difficult to accurately control the shape memory alloys;the cooling speed of shape memory alloy is slow;the deformation speed of shape memory alloy cannot be controlled;there is a lack of comparative research and expert consensus on shape memory alloys with different properties;shape memory alloys are costly and expensive.(6)In the future,attention should be paid to the development of new shape memory alloys,increase comparative research,and use new technologies and methods(such as 4D printing)to solve the existing problems,so as to develop high-performance assistive devices and rehabilitation equipment.

With Glycyrrhizae Radix et Rhizoma-Gypsum Fibrosum drug pair as the research object, supramolecular chemistry of traditional Chinese medicine(TCM) was used to study differences between the compatibility of herbal medicine Glycyrrhizae Radix et Rhizoma with mineral medicine Gypsum Fibrosum and its main component CaSO_4·2H_2O, so as to preliminarily discuss the scientific connotation of compatibility of Gypsum Fibrosum in clinical application. A Malvern particle sizer, a scanning electron microscope(SEM), and a conductivity meter were used to observe and determine the physical properties such as microscopic morphology, particle size, and conductivity of Gypsum Fibrosum, CaSO_4·2H_2O, and water decoctions of them with Glycyrrhizae Radix et Rhizoma. An inductively coupled plasma optical emission spectrometer(ICP-OES) was employed to detect the inorganic metal elements in Glycyrrhizae Radix et Rhizoma-Gypsum Fibrosum and Glycyrrhizae Radix et Rhizoma-CaSO_4·2H_2O. Isothermal titration calorimetry(ITC) was conducted to quantify the interactions of Gypsum Fibrosum and CaSO_4·2H_2O with Glycyrrhizae Radix et Rhizoma. A Fourier transform infrared spectrometer(FTIR) was used to analyze the characteristic absorption peak change of Glycyrrhizae Radix et Rhizoma-Gypsum Fibrosum and Glycyrrhizae Radix et Rhizoma-CaSO_4·2H_2O. X-ray diffraction(XRD) was performed to determine the crystal structure and phase composition of Glycyrrhizae Radix et Rhizoma-Gypsum Fibrosum and Glycyrrhizae Radix et Rhizoma-CaSO_4·2H_2O. Further, glycyrrhizic acid(GA) was substituted for Glycyrrhizae Radix et Rhizoma to co-decoct with Gypsum Fibrosum, CaSO_4·2H_2O, and freeze-dried powder of their respective water decoctions. The results of XRD were used for verification analysis. The results showed that although CaSO_4·2H_2O is the main component of Gypsum Fibrosum, there were significant differences between their decoctions and between the decoctions of them with Glycyrrhizae Radix et Rhizoma. Specifically,(1) Both CaSO_4·2H_2O and Gypsum Fibrosum were amorphous fibrous. However, the particle size and conductivity were significantly different between the decoctions of CaSO_4·2H_2O and Gypsum Fibrosum alone.(2) Under SEM, Glycyrrhizae Radix et Rhizoma-CaSO_4·2H_2O was a hybrid system with various morphologies, while Glycyrrhizae Radix et Rhizoma-Gypsum Fibrosum presented uniform nanoparticles.(3) The particle sizes and conductivities of Glycyrrhizae Radix et Rhizoma-CaSO_4·2H_2O and Glycyrrhizae Radix et Rhizoma-Gypsum Fibrosum were significantly different and did not follow the same tendency as those of the decoctions of CaSO_4·2H_2O and Gypsum Fibrosum alone.(4) Compared with Glycyrrhizae Radix et Rhizoma-CaSO_4·2H_2O, Glycyrrhizae Radix et Rhizoma-Gypsum Fibrosum had stronger molecular binding ability and functional group structure change.(5) The crystal form was largely different between the freeze-dried powder of CaSO_4·2H_2O decoction and Gypsum Fibrosum decoction, and their crystal forms were also significantly different from those of the freeze-dried powder of Glycyrrhizae Radix et Rhizoma-CaSO_4·2H_2O and Glycyrrhizae Radix et Rhizoma-Gypsum Fibrosum decoctions. The reason for the series of differences is that Gypsum Fibrosum is richer in trace elements than CaSO_4·2H_2O. The XRD results of GA-Gypsum Fibrosum and GA-CaSO_4·2H_2O decoctions further prove the importance of trace elements in Gypsum Fibrosum for supramolecule formation. This research preliminarily reveals the influence of compatibility of Gypsum Fibrosum or CaSO_4·2H_2O on decoction phase state, material form, and crystal form, providing a basis for the rational clinical application of Gypsum Fibrosum.
Drugs, Chinese Herbal/chemistry* ; Calcium Sulfate/chemistry* ; Glycyrrhiza/chemistry* ; Crystallization ; Particle Size ; Medicine, Chinese Traditional ; Rhizome/chemistry*

Flavoprotein monooxygenases(FPMOs) and cytochrome P450(CYP450) oxygenases are pivotal monooxygenases in nature, catalyzing crucial redox reactions in diverse biological processes and contributing to the synthesis of highly complex natural products. While CYP450 enzymes have been extensively reported and studied, numerous FPMOs have also been discovered in past research endeavors, yet their classification, catalytic reactions, and catalytic mechanisms remain to be systematically analyzed. This paper comprehensively reviews the latest advancements in FPMOs research, initiating with a classification based on sequence similarities and distinct structural features. It delves into the catalytic characteristics of three subfamilies(FMO, BVMO, and NMO) within Class B FPMOs of plants, which are integral to biosynthetic pathways of natural products. Class B FPMOs encompass two canonical Rossmann fold motifs(FAD-binding GxGxxG and NADPH-binding GxGxxA), along with a central FMO recognition motif FxGxxxHxxxF/Y/W. These enzymes play a key role in regulating various metabolic routes and precisely modulate plant growth and development. Furthermore, the review summarizes the applications of Class B FPMOs of plants, showcasing through concrete examples their potential in synthesizing natural products such as auxins, indigo, and cyanogenic glycosides. These insights will broaden and deepen our understanding of FPMOs, fostering their transition from fundamental research to practical applications. More optimized biosynthetic pathways can be devised by leveraging FPMOs, conducive to the development of novel strategies and tools for agriculture, plant protection, natural product biosynthesis, and synthetic biology.
Biological Products/metabolism* ; Mixed Function Oxygenases/chemistry* ; Flavoproteins/chemistry* ; Plants/metabolism* ; Plant Proteins/chemistry* ; Cytochrome P-450 Enzyme System/genetics*

Metal ion-promoted chemodynamic therapy(CDT) combined with photodynamic therapy(PDT) offers broad application prospects for enhancing anti-tumor effects. In this study, glycyrrhizic acid(GA), copper ions(Cu~(2+)), and norcantharidin(NCTD) were co-assembled to successfully prepare a natural small-molecule, carrier-free hydrogel(NCTD Gel) with excellent material properties. Under 808 nm laser irradiation, NCTD Gel responded to the tumor microenvironment(TME) and acted as an efficient Fenton reagent and photosensitizer, catalyzing the conversion of endogenous hydrogen peroxide(H_2O_2) within the tumor into oxygen(O_2), and hydroxyl radicals(·OH, type Ⅰ reactive oxygen species) and singlet oxygen(~1O_2, type Ⅱ reactive oxygen species), while depleting glutathione(GSH) to stabilize reactive oxygen species and alleviate tumor hypoxia. In vitro and in vivo experiments demonstrated that NCTD Gel exhibited significant CDT/PDT synergistic therapeutic effects. Further safety evaluation and metabolic testing confirmed its good biocompatibility and safety. This novel hydrogel is not only simple to prepare, safe, and cost-effective but also holds great potential for clinical transformation, providing insights and references for the research and development of metal ion-mediated hydrogel-based anti-tumor therapies.
Hydrogels/chemistry* ; Animals ; Photochemotherapy ; Humans ; Mice ; Antineoplastic Agents/administration & dosage* ; Photosensitizing Agents/chemistry* ; Neoplasms/metabolism* ; Female ; Copper/chemistry* ; Reactive Oxygen Species/metabolism* ; Tumor Microenvironment/drug effects* ; Cell Line, Tumor ; Male

The 95% ethanol extract from bulbs of Narcissus tazetta var. chinensis(BNTC) was eluted with 30%, 60%, and pure methanol on D-101 macroporous resin. The elution fractions were isolated and purified by silica gel column chromatography, thin layer chromatography, D-101 macroporous resin, semi-preparative high performance liquid chromatography(HPLC), and HPLC. The purified compounds were identified using one-dimensional and two-dimensional spectroscopy, high-resolution mass spectrometry, and other techniques. A total of 15 compounds were isolated and identified as 5-(4-hydroxy-3-methoxyphenyl)-3-(4-hydroxyphenyl)-N-methyl-3,6-dihydropyridine-2(1H)-one(1), 3,5-di(hydroxyphenyl)-N-methyl-3,6-dihydropyridine-2(1H)-one(2), protocatechualdehyde(3), protocatechuic acid(4), 3,4-dihydroxyacetophenone(5), syringic acid(6), vanillic acid(7), p-hydroxybenzoic acid(8),(2S)-4'-hydroxy-7-methoxyflavan(9), 2,4,6-trimethoxyacetophenone(10), N-trans-ferulic acid p-hydroxyphenylethylamine(11), N-cis-p-coumaroyltyramine(12), N-trans-p-coumaroyltyramine(13), piscidic acid(14), 5-hydroxymethylfurfural(15). Compounds 1 and 2 are new compounds with similar structure that have not been reported yet, named narcissus A and narcissus B. Compounds 8-13 were isolated and identified from the genus Narcissus for the first time, and compounds 14 and 15 were isolated from BNTC for the first time. Compounds 1 and 2 inhibited the release of NO from RAW264.7 cells induced by lipopolysaccharide(LPS)(P<0.001), with compound 1 having an IC_(50) value of(72.76±2.97) μmol·L~(-1) and compound 2 having an IC_(50) value of(63.59±0.96) μmol·L~(-1).
Mice ; Animals ; Narcissus/chemistry* ; Drugs, Chinese Herbal/isolation & purification* ; Plant Roots/chemistry* ; Chromatography, High Pressure Liquid ; Macrophages/immunology* ; RAW 264.7 Cells

OBJECTIVE: To investigate the effect of femoral condyle sliding osteotomy (FCSO) on the flexion gap and external rotation of the prosthesis in balancing coronal instability during initial total knee arthroplasty (TKA). METHODS: Between November 2021 and October 2024, FCSO technique was applied to balance the coronal medial and lateral spaces during initial TKA in 3 patients, including medial condyle sliding osteotomy (MCSO) and lateral condyle sliding osteotomy (LCSO). There were 1 male and 2 females with the age of 81, 68, and 68 years old. The affected knee has varus or valgus deformity, with tibia-femoral angles of 169.7°, 203.3°, and 162.2°, respectively. The hip-knee-ankle angle (HKA), range of motion (ROM), knee society scoring system (KSS), and pain visual analogue scale (VAS) score were used to evaluate joint function and pain relief. Based on model bone, the thickness and bone bed area of the medial and lateral femoral condyle osteotomy blocks in FCSO were measured. During TKA in 12 patients, the range of osteotomy block movement was evaluated. By simplifying the upward and forward movement of the osteotomy block into a geometric model, the impact of movement on the flexion gap and external rotation of the prosthesis was calculated. RESULTS: After application of FCSO during TKA, the limb alignment and medial and lateral balance at extension and flexion positions were restored in 3 patients. Three patients were followed up 23, 11, and 3 months, respectively. Postoperative HKA, pain VAS score, KSS score, and ROM all showed significant improvement compared to preoperative levels. The maximum thickness of osteotomy blocks by MCSO and LCSO was 17 and 12 mm, respectively. The simple upward movement of the osteotomy block mainly affected the extension gap, and had little effect on the flexion gap and external rotation of the prosthesis. Moving the osteotomy block forward at the same time had a significant impact on the flexion gap and external rotation of the prosthesis, especially on LCSO. Mild forward movement leaded to a decrease in external rotation of more than 3°, which had a serious impact on the patellar trajectory. CONCLUSION FCSO can effectively solve the problem of imbalance between the medial and lateral spaces during initial TKA, avoiding knee joint instability caused by excessive loosening and limiting the use of constrained condylar prosthesis. The distance for the downward movement of the osteotomy block in MCSO and LCSO was 3-5 mm and 6-8 mm, respectively, with 10-15 mm of space for forward movement and almost no space for backward movement. For MCSO, the upward and forward movement of the osteotomy block will increase the external rotation of the prosthesis, which is beneficial for improving the patellar trajectory and suitable for valgus knee. LCSO is suitable for varus knee, and the osteotomy block only slides vertically up and down without moving forward and backward.
Humans ; Osteotomy/methods* ; Male ; Female ; Arthroplasty, Replacement, Knee/methods* ; Aged ; Range of Motion, Articular ; Femur/surgery* ; Knee Joint/physiopathology* ; Aged, 80 and over ; Knee Prosthesis ; Treatment Outcome ; Osteoarthritis, Knee/surgery*

OBJECTIVE: To evaluate the feasibility and short-term effectiveness of three-dimensional (3D)-printed customized porous acetabular components for reconstruction of extensive acetabular bone defects during primary total hip arthroplasty (THA). METHODS: The clinical data of 8 patients with extensive acetabular bone defects, who were treated with 3D-printed individualized porous acetabular components between July 2018 and January 2022, were retrospectively analyzed. The cohort comprised 4 males and 4 females with an average age of 48 years ranging from 34 to 56 years. Acetabular bone defects were classified as Paprosky type ⅢA in 3 cases and type ⅢB in 5 cases. The causes of acetabular destruction were hip tuberculosis (5 cases), pigmented villonodular synovitis (2 cases), and syphilitic arthritis (1 case). Visual analogue scale (VAS) score and Harris hip score (HHS) were used to evaluate the pain relief and hip function before and after operation. Reconstruction outcomes were further assessed by imaging results [X-ray film and Tomosynthesis Shimadzumetal artefact reduction technology (T-SMART)], and the mechanical properties were evaluated by finite element analysis. RESULTS: The operation time ranged from 174 to 195 minutes (mean, 187 minutes), and intraoperative blood loss ranged from 390 to 530 mL (mean, 465 mL). All 8 patients were follow-up 26-74 months (mean, 44 months). Among the 5 patients with tuberculosis, none experienced postoperative recurrence. At last follow-up, the VAS score was 0.3±0.5 and the HHS score was 87.9±3.7, both significantly improved compared to preoperative values ( t=25.170, P<0.001; t=-28.322, P<0.001). X-ray films at 2 years after operation demonstrated satisfactory matching between the 3D-printed customized acetabular component and the acetabulum. The postoperative center of rotation of the operated hip was shifted by (2.1±0.5) mm horizontally and (2.0±0.7) mm vertically relative to the contralateral side, with both offsets showing significant differences compared to preoperative values ( t=24.700, P<0.001; t=55.230, P<0.001). T-SMART imaging showed satisfactory osseointegration at the implant-host bone interface. No complications such as aseptic loosening or screw breakage was observed during follow-up. Finite element analysis showed that the acetabular component had good mechanical properties. CONCLUSION The application of 3D-printed individualized porous acetabular components in the reconstruction of extensive acetabular bone defects demonstrated precise anatomical reconstruction, stable mechanical support, and good functional performance in short-term follow-up, offering a potential alternative for acetabular defect reconstruction in primary THA.
Humans ; Middle Aged ; Male ; Female ; Printing, Three-Dimensional ; Arthroplasty, Replacement, Hip/instrumentation* ; Acetabulum/diagnostic imaging* ; Adult ; Follow-Up Studies ; Retrospective Studies ; Hip Prosthesis ; Prosthesis Design ; Porosity ; Treatment Outcome ; Plastic Surgery Procedures/methods*

Multiple myeloma is a common and refractory hematological malignancy for which there is currently no radical treatment, and it is prone to relapse. Patients with relapsed and refractory myeloma have often been previously treated with multiple drugs including proteasome inhibitors and / or immunomodulatory drugs. Therefore, for such patients, the primary goal of treatment is to achieve disease control with acceptable toxicity and maintenance of quality of life. In this paper, the aim is to review the clinical effect of selinexor in treating patients with RRMM. As a novel treatment for RRMM, selinexor has a unique pharmacological mechanism that may further improve the clinical response rate of RRMM patients and enhance patients' quality of life. Although selinexor can cause a series of adverse reactions, most of these adverse reactions can be alleviated or disappear after clinical targeted treatment, and effective preventive measures can also minimize the occurrence of adverse reactions. In conclusion, selinexor has shown broad application prospects in RRMM patients, and further research will be conducted in the future to optimize the treatment regimen of selinexor, so that more RRMM patients can benefit from it.
Humans ; Multiple Myeloma/drug therapy* ; Hydrazines/therapeutic use* ; Triazoles/therapeutic use* ; Quality of Life ; Recurrence