This paper introduces a real-world cohort research model for community-acquired pneumonia （CAP） based on the Jiangsu Traditional Chinese Medicine （TCM） Dominant Diseases Diagnosis and Treatment Data Platform. Firstly， data cleaning is performed by standardizing diagnosis， symptoms， treatment and imaging， intelligently extracting unstructured information， and cleaning and constructing a standardized database. Secondly， for cohort establishment， CAP patients across the province are screened in accordance with CAP diagnostic criteria to build a high-quality disease-specific cohort. Lastly， in terms of protocol design， the characteristics of TCM research and the CAP disease profile are considered to determine appropriate inclusion and exclusion criteria， estimate sample size， define interventions， outcomes and economic evaluations， providing a reference for real-world TCM research on CAP.

This paper introduces a real-world cohort research model for community-acquired pneumonia （CAP） based on the Jiangsu Traditional Chinese Medicine （TCM） Dominant Diseases Diagnosis and Treatment Data Platform. Firstly， data cleaning is performed by standardizing diagnosis， symptoms， treatment and imaging， intelligently extracting unstructured information， and cleaning and constructing a standardized database. Secondly， for cohort establishment， CAP patients across the province are screened in accordance with CAP diagnostic criteria to build a high-quality disease-specific cohort. Lastly， in terms of protocol design， the characteristics of TCM research and the CAP disease profile are considered to determine appropriate inclusion and exclusion criteria， estimate sample size， define interventions， outcomes and economic evaluations， providing a reference for real-world TCM research on CAP.

ObjectiveTo investigate the mechanism of Xiezhuo Jiedu prescription in the treatment of ulcerative colitis （UC） by inhibiting ferroptosis and alleviating intestinal mucosal injury based on the nuclear factor E₂ related factor 2/solute carrier family 7 member/glutathione peroxidase 4 （Nrf2/SLC7A11/GPX4） signaling pathway. MethodsA total of 60 male SD rats were divided into a normal group， a model group， high- and low-dose Xiezhuo Jiedu prescription groups （26.64 and 13.32 g·kg^-1， respectively）， a ferroptosis inhibitor group （Ferrostatin-1， 0.005 g·kg^-1）， and a mesalazine group （0.27 g·kg^-1）， with 10 rats in each group. A UC rat model was established by intrarectal administration of trinitrobenzene sulfonic acid （TNBS）-ethanol. The normal group and the model group were intragastrically administered normal saline. The other groups were given intragastric administration according to the corresponding dosage for 7 d. The general condition， disease activity index （DAI） score， colon length， and mucosal injury index （CDMI） score were observed in each group. The pathological changes of colon tissue in each group were observed by hematoxylin-eosin （HE） staining. The intestinal mucosa and mitochondrial morphology in each group were observed by transmission electron microscopy. The expression levels of Occludin， Claudin-1， mucin 2 （MUC2）， and E-cadherin in intestinal tissue were detected by immunofluorescence （IF）. Enzyme-linked immunosorbent assay （ELISA） was used to detect the expression levels of serum tumor necrosis factor-α （TNF-α）， interleukin-6 （IL-6）， and interleukin-10 （IL-10） in each group， and a lactic acid assay kit or ELISA was employed to detect the expression levels of reactive oxygen species （ROS）， ferrous ions （Fe²⁺）， glutathione （GSH）， malondialdehyde （MDA）， 4-hydroxynonenal （4-HNE）， diamine oxidase （DAO）， and D-lactate （D-LA）. Real-time quantitative polymerase chain reaction （Real-time PCR） was applied to detect the mRNA expression levels of Nrf2， SLC7A11， GPX4， Occludin， Claudin-1， MUC2， and E-cadherin in each group， and Western blot was adopted to detect the protein expression levels of Nrf2， p-Nrf2， SLC7A11， and GPX4 in each group. ResultsCompared with the normal group， rats in the model group exhibited listlessness， sluggish response， and mucopurulent and bloody stools. The model group also showed significantly increased DAI score， colon length， CDMI score， and expression levels of TNF-α， IL-6， ROS， Fe²⁺， MDA， 4-HNE， DAO， and D-LA （P<0.01）. In addition， it presented significantly decreased IF values of Occludin， Claudin-1， MUC2， and E-cadherin and mRNA and protein expression levels of IL-10， GSH， Nrf2， p-Nrf2， SLC7A11， and GPX4 （P<0.01）. There were different degrees of improvement in each administration group after treatment， and the improvement was the most significant in the high-dose Xiezhuo Jiedu prescription group （P<0.01）. ConclusionXiezhuo Jiedu prescription may alleviate intestinal mucosal injury by inhibiting ferroptosis of intestinal epithelial cells via regulating the Nrf2/SLC7A11/GPX4 signaling pathway， thereby exhibiting efficacy in the treatment of UC.

AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

OBJECTIVE To conduct a clinical rapid evaluation of the marketed proprotein convertase subtilisin/kexin type 9 （PCSK9） inhibitors in China， including evolocumab， tafolecimab， recaticimab， ebronucimab， ongericimab and inclisiran. METHODS Based on the Rapid Guide for Drug Evaluation and Selection in Chinese Medical Institutions （second edition）， drug instructions， clinical diagnosis and treatment guidelines， and literature for six drugs were retrieved from CNKI， Wanfang Data， VIP， PubMed， Embase， Cochrane Library and related official websites. The clinical rapid evaluation was conducted from five aspects： pharmaceutical characteristics， effectiveness， safety， economy， and other attributes. RESULTS The pharmaceutical characteristics， effectiveness， safety， economy， other attributes， and total score of evolocumab scored 24， 27， 15.7， 10， 5.3， and 82 points， respectively. Tafolecimab scored 23.5， 23， 11.5， 9.97， 4.6， and 72.57 points， respectively. Recaticimab scored 20.5， 22， 15.5， 6.37， 3.5， and 67.87 points. Ebronucimab scored 20， 23， 11， 6.48， 3.5， and 63.98 points. Ongericimab scored 20.5， 23， 8.5， 4.83， 3.5， and 60.33 points. Inclisiran scored 25.5， 24， 13， 6.48， 5， and 73.98 points. CONCLUSIONS Evolocumab is the optimal choice for treating hypercholesterolemia and is recommended as the first-line option. Tafolecimab is the second-line option， and recaticimab is suitable for patients who are sensitive to drug adverse reactions. Inclisiran is suitable for patients with poor compliance. Ebronucimab and ongericimab are weakly recommended due to their later market introduction. Clinicians should make individualized drug selections based on factors such as patient risk level and compliance requirements.

As one of the chronic diseases with high incidence in contemporary society, cervical spondylosis has increasing patient groups who gradually present a low age, and it seriously affects social and public health. Although modern medicine has made great progress in the pathological research and clinical treatment of cervical spondylosis, patients still face gastrointestinal side effects of nonsteroidal anti-inflammatory drugs(NSAIDs), neck pain, limited mobility, upper limb numbness, and other symptoms after conservative or surgical treatment. In the theory of traditional Chinese medicine(TCM), cervical spondylosis belongs to the categories of "Bi syndrome" "stiff neck" "stiff Bi", etc. With the change of the times, the change of lifestyle, and the application of western medicine treatment, the etiology and pathogenesis of TCM in cervical spondylosis also show new characteristics. In terms of etiology and pathogenesis, it involves the invasion of wind, cold, and dampness, long-term strain, liver and kidney deficiency, Qi and blood stasis, which are associated with factors such as cervical degeneration, muscle tension and spasm, intervertebral disc herniation, and nerve root compression in modern medicine. In terms of the evolution of pathogenesis, in the early stage, wind, cold, and dampness, were more common in Xuanfu, resulting in unfavorable muscles and bones, poor flow of Qi and blood, and cervical spondylosis and radiculopathy. Medium-term phlegm stasis and internal knots, sluggish muscles and veins, and long-term weathering and fire are more likely to occur in the vertebral artery and sympathetic radiculopathy. In the later stage, the positive Qi is depleted; the true Yin is damaged, and the viscera Qi and blood are deficient, which is most common in cervical myelopathy. The strategy of treating cervical spondylosis with TCM classic formulas applies Gegen Decoction, Wutou Decoction, Qianghuo Shengshi Decoction, Mahuang Jiazhu Decoction to patients with wind, cold, and dampness. Patients with phlegm dampness and blood stasis are treated with Huoxue Xiaoling Dan, Jinlingzi Powder, Siwu Decoction, Banxia Baizhu Tianma Decoction, Shuanghe Decoction, etc. For those patients with liver, spleen, and kidney deficiency, Huangqi Guizhi Wuwu Decoction, Tianma Gouteng Decoction, Guishao Dihuang Pills, Shenling Baizhu Powder, and Lizhong Decoction are used to invigorate the spleen, nourish Qi and blood, and tonify liver and kidney. In clinical practice, the authors advocate a safe and effective treatment plan of classic formulas based on deficiency and excess, the integration of formulas and syndromes, and the combination of modern research results, so as to relieve symptoms, reduce recurrence, and reduce medical burden.
Humans ; Spondylosis/drug therapy* ; Medicine, Chinese Traditional/methods* ; Drugs, Chinese Herbal/therapeutic use* ; Cervical Vertebrae/pathology*

Many triterpenoid compounds have been successfully heterologously synthesized in Saccharomyces cerevisiae. To increase the yield of triterpenoids, various metabolic engineering strategies have been developed. One commonly applied strategy is to enhance the supply of precursors, which has been widely used by researchers. Squalene, as a precursor to triterpenoid biosynthesis, plays a crucial role in the synthesis of these compounds. This study primarily investigates the effect of different squalene levels in chassis strains on the synthesis of triterpenoids(oleanolic acid and ursolic acid), and the underlying mechanisms are further explored using real-time quantitative PCR(qPCR) analysis. The results demonstrate that the chassis strain CB-9-5, which produces high levels of squalene, inhibits the synthesis of oleanolic acid and ursolic acid. In contrast, chassis strains with moderate to low squalene production, such as Y8-1 and CNPK, are more conducive to the synthesis of oleanolic acid and ursolic acid. The qPCR analysis reveals that the expression levels of ERG1, βAS, and CrCYP716A154 in the oleanolic acid-producing strain CB-OA are significantly lower than those in the control strains C-OA and Y-OA, suggesting that high squalene production in the chassis strains suppresses the transcription of certain genes, leading to a reduced yield of triterpenoids. Our findings indicate that when constructing S. cerevisiae strains for triterpenoid production, chassis strains with high squalene content may suppress the expression of certain genes, ultimately lowering their production, whereas chassis strains with moderate squalene levels are more favorable for triterpenoid biosynthesis.
Squalene/analysis* ; Saccharomyces cerevisiae/genetics* ; Triterpenes/metabolism* ; Metabolic Engineering ; Oleanolic Acid/biosynthesis* ; Ursolic Acid

This study aims to evaluate the efficacy of Chinese medicine injections in treating transient ischemic attack(TIA) based on network Meta-analysis. Randomized controlled trial(RCT) about Chinese medicine injections in treating TIA were retrieved from PubMed, Web of Science, Cochrane Library, EMbase, CNKI, VIP, Wanfang, and SinoMed with the time interval from inception to March 1, 2024. The methodological quality of the included articles was assessed by ROB 2.0, and the GRADE system was employed to evaluate the quality of evidence. The gemtc package of R 4.1.2 was used to perform the network Meta-analysis. Finally, 63 RCTs with a total sample size of 5 750 cases were included, involving 11 Chinese medicine injections(Shuxuetong Injection, Danhong Injection, Shuxuening Injection, Ginkgo Damo Injection, Shenxiong Glucose Injection, Ligustrazine Injection, Salviae Miltiorrhizae and Ligustrazine Hydrochloride Injection, Salvianolic Acids for Injection, Dengzhan Xixin Injection, Guhong Injection, and Xueshuantong Injection). All patients received conventional western medicine treatment, and the experimental group was additionally treated with Chinese medicine injection. Network Meta-analysis yielded the following results.(1) In terms of improving the clinical total response rate, 11 Chinese medicine injections combined with conventional western medicine outperformed conventional western medicine alone, and Dengzhan Xixin Injection + conventional western medicine had the best effect.(2) In terms of reducing plasma viscosity, 7 Chinese medicine injections combined with conventional western medicine outperformed conventional western medicine alone, and Shenxiong Glucose Injection + conventional western medicine had the best effect.(3) In terms of reducing whole blood high shear viscosity, 6 Chinese medicine injections combined with conventional western medicine outperformed conventional western medicine alone, and Guhong Injection + conventional western medicine had the best effect.(4) In terms of reducing whole blood low shear viscosity, 6 Chinese medicine injections combined with conventional western medicine outperformed conventional western medicine alone, and Shuxuening Injection + conventional western medicine had the best effect.(5) In terms of reducing fibrinogen, 9 Chinese medicine injections combined with conventional western medicine outperformed conventional western medicine alone, and Ginkgo Damo Injection + conventional western medicine had the best effect.(6) In terms of increasing the average blood flow velocity, 3 Chinese medicine injections combined with conventional western medicine outperformed conventional western medicine alone, and Shuxuening Injection + conventional western medicine had the best effect. In summary, compared with conventional western medicine alone, Chinese medicine injections combined with conventional western medicine were effective in improving the clinical total response rate and the average blood flow velocity, as well as reducing plasma viscosity, whole blood high shear viscosity, whole blood low shear viscosity, and fibrinogen. However, due to the limited quality and quantity of the included articles, the above conclusions need to be verified by more high-quality, multi-center, and large-sample RCT.
Humans ; Drugs, Chinese Herbal/administration & dosage* ; Injections ; Ischemic Attack, Transient/drug therapy* ; Randomized Controlled Trials as Topic ; Treatment Outcome

Based on the ultra performance liquid chromatography-quadrupole Exactive Orbitrap mass spectrometry(UPLC-Q-Exactive Orbitrap-MS) technology, combined with related literature, databases, and reference material information, this study qualitatively analyzed the components of Dayuanyin in the tissue of rats after gavage and employed molecular docking technology to predict the rationality of the mechanism behind the antipyretic effect of the in vivo components in Dayuanyin. A total of 21, 26, 20, 21, 14, and 31 prototype components and 3, 16, 3, 7, 5, and 24 metabolites were identified from the heart, liver, spleen, lung, kidney, and hypothalamus of the rats, respectively, and the binding ability of key components and targets was further verified by molecular docking. The results showed that all components had good binding ability with targets. The established UPLC-Q-Exactive Orbitrap-MS could effectively and quickly identify the Dayuanyin components distributed in tissue and preliminarily identify their metabolites. Many components were identified in the hypothalamus, which suggested that the components delivered to the brain should be focused on in the study on Dayuanyin in the treatment of febrile diseases. The molecular docking technology was used to predict the rationality of the mechanism behind its antipyretic effect, which lays the foundation for the clarification of the material basis and action mechanism of Dayuanyin, the development of new preparations, and the prediction of quality markers.
Animals ; Drugs, Chinese Herbal/administration & dosage* ; Rats ; Molecular Docking Simulation ; Male ; Antipyretics/metabolism* ; Rats, Sprague-Dawley ; Tissue Distribution ; Mass Spectrometry ; Chromatography, High Pressure Liquid ; Hypothalamus/metabolism*

The study investigated the intrinsic changes in material basis of Angelicae Sinensis Radix during wine processing by headspace-gas chromatography-ion mobility spectrometry(HS-GC-IMS), headspace-solid phase microextraction-gas chromatography-mass spectrometry(HS-SPME-GC-MS), and ultra-high performance liquid chromatography-quadrupole-orbitrap mass spectrometry(UPLC-Q-Orbitrap-MS) combined with chemometrics. HS-GC-IMS fingerprints of Angelicae Sinensis Radix before and after wine processing were established to analyze the variation trends of volatile components and characterize volatile small-molecule substances before and after processing. Principal component analysis(PCA) and orthogonal partial least squares-discriminant analysis(OPLS-DA) were employed for differentiation and difference analysis. A total of 89 volatile components in Angelicae Sinensis Radix were identified by HS-GC-IMS, including 14 unsaturated hydrocarbons, 16 aldehydes, 13 ketones, 9 alcohols, 16 esters, 6 organic acids, and 15 other compounds. HS-SPME-GC-MS detected 118 volatile components, comprising 42 unsaturated hydrocarbons, 11 aromatic compounds, 30 alcohols, 8 alkanes, 6 organic acids, 4 ketones, 7 aldehydes, 5 esters, and 5 other volatile compounds. UPLC-Q-Orbitrap-MS identified 76 non-volatile compounds. PCA revealed distinct clusters of raw and wine-processed Angelicae Sinensis Radix samples across the three detection methods. Both PCA and OPLS-DA effectively discriminated between the two groups, and 145 compounds(VIP>1) were identified as critical markers for evaluating processing quality, including 4-methyl-3-penten-2-one, ethyl 2-methylpentanoate, and 2,4-dimethyl-1,3-dioxolane detected by HS-GC-IMS, angelic acid, β-pinene, and germacrene B detected by HS-SPME-GC-MS, and L-tryptophan, licoricone, and angenomalin detected by UPLC-Q-Orbitrap-MS. In conclusion, the integration of the three detection methods with chemometrics elucidates the differences in the chemical material basis between raw and wine-processed Angelicae Sinensis Radix, providing a scientific foundation for understanding the processing mechanisms and clinical applications of wine-processed Angelicae Sinensis Radix.
Wine/analysis* ; Gas Chromatography-Mass Spectrometry/methods* ; Chromatography, High Pressure Liquid/methods* ; Angelica sinensis/chemistry* ; Solid Phase Microextraction/methods* ; Drugs, Chinese Herbal/isolation & purification* ; Chemometrics ; Volatile Organic Compounds/chemistry* ; Principal Component Analysis ; Ion Mobility Spectrometry/methods*