1.Evaluation system for standardized surgery in elderly patients with lung cancer
Xingqi MI ; Nan CHEN ; Jiandong MEI ; Hecheng LI ; Shuguang ZHANG ; Huanwen CHEN ; Peng JIAO ; Jun WANG ; Chunfang ZHANG ; Guangjian ZHANG ; Xin LI ; Qiang PU ; Peng LIN ; Lunxu LIU
Chinese Journal of Clinical Thoracic and Cardiovascular Surgery 2026;33(06):866-873
To address the growing challenge of an increasing number of elderly lung cancer patients amidst China's aging population and to fill the gap in quality control standards for surgical treatment in this special population, this study aimed to develop a standardized surgical evaluation system for elderly lung cancer patients tailored to China's national conditions. The system was established through a literature review, integrated the pathophysiological characteristics of elderly patients, and was constructed following review, feedback, and revision by experts from multiple thoracic surgery centers. Employing a 100-point scoring system, it comprises three primary domains: physical infrastructure and geriatric adaptability foundational conditions (10 points); management level and perioperative care models (20 points); and technical proficiency and clinical outcomes (70 points). The system places a strong emphasis on geriatric adaptability, proposing specific, quantifiable indicators for age-friendly facility modifications, control of elderly-specific complications, multidisciplinary collaboration, and standardized perioperative management. It provides a convenient and measurable assessment tool for quality control in the surgical treatment of elderly lung cancer in China, which is expected to promote the standardization and homogenization of diagnosis and treatment.
2.Structural and Functional Abnormalities of White-matter Tracts in Male College Smokers
Xiao-Jiao LI ; Da-Hua YU ; Ting XUE ; Kai YUAN ; Zhen-Zhen MAI ; Xu-Wen WANG ; Fang DONG ; Juan WANG ; Yu-Xin MA
Progress in Biochemistry and Biophysics 2026;53(6):1770-1779
ObjectiveThe present study aimed to investigate alterations in white matter microstructure and spontaneous neural activity in male college smokers, and to further explore their associations with nicotine dependence. Given that adolescence and early adulthood represent critical periods for brain maturation, particularly for white matter development, understanding the neural correlates of smoking behavior during this stage is of substantial importance for both neuroscience and public health. MethodsA total of 115 male undergraduate students were initially recruited for this study. After quality control and exclusion procedures, 52 male college smokers and 42 demographically matched healthy non-smokers were included in the final analysis. All participants underwent multimodal magnetic resonance imaging (MRI), including diffusion tensor imaging (DTI) and resting-state functional MRI (rs-fMRI). White matter fiber tracts were reconstructed using the automated fiber quantification (AFQ) method, which enables precise identification and quantification of major fiber bundles. Eighteen major white matter tracts were segmented for each participant. Along the core trajectory of each tract, 100 equidistant nodes were sampled. Fractional anisotropy (FA) was calculated at each node to assess white matter microstructural integrity, while amplitude of low-frequency fluctuation (ALFF) was computed to evaluate spontaneous neural activity within white matter tracts. Between-group differences in FA and ALFF were assessed using two-sample t-tests, with appropriate corrections applied for multiple comparisons. Furthermore, Pearson correlation analyses were conducted to examine the relationships between imaging-derived metrics (FA and ALFF values in regions showing significant group differences) and nicotine dependence severity, as measured by the Fagerström test for nicotine dependence (FTND). ResultsCompared with healthy non-smokers, male college smokers exhibited significantly increased FA values in several white matter tracts, including the left thalamic radiation, right corticospinal tract, forceps major of the corpus callosum, left uncinate fasciculus, and right arcuate fasciculus. These findings suggest altered microstructural organization or increased directional coherence within these pathways. In addition, smokers demonstrated significantly elevated ALFF values in the forceps major, right uncinate fasciculus, and left arcuate fasciculus, indicating enhanced spontaneous neural activity in these white matter regions. Correlation analyses revealed that FA values in the left thalamic radiation and right corticospinal tract were negatively correlated with FTND scores, suggesting that higher levels of nicotine dependence were associated with reduced microstructural integrity or altered fiber organization in these regions. In contrast, ALFF values in the forceps major and right uncinate fasciculus were positively correlated with FTND scores, indicating that greater nicotine dependence was associated with increased spontaneous neural activity in specific white matter pathways. ConclusionThe present study provides evidence that male college smokers exhibit distinct alterations in both white matter microstructure and functional activity. These abnormalities are not uniformly distributed but rather localized to specific fiber tracts implicated in sensorimotor processing, interhemispheric communication, and higher-order cognitive and emotional regulation. Importantly, the observed associations between imaging metrics and nicotine dependence severity suggest that these structural and functional alterations may reflect neurobiological mechanisms underlying addiction. The combination of AFQ-based tract profiling and multimodal MRI offers a sensitive approach for detecting subtle changes along white matter pathways, highlighting its potential utility in identifying neuroimaging biomarkers of nicotine dependence. Overall, these findings indicate that smoking during early adulthood may disrupt ongoing white matter maturation, potentially leading to long-term consequences for brain function. This study provides novel insights into the neural basis of nicotine dependence and underscores the importance of early intervention and prevention strategies targeting young smokers.
3.The efficacy of oral solution of magnesium sodium potassium sulfate in bowel preparation before colonoscopy
Xin HUANG ; Rujie YANG ; Feng QIN ; Shilian ZHANG ; Xin WU ; Xiaoyan YIN
Journal of Pharmaceutical Practice and Service 2026;44(2):85-87
Objective To explore the efficacy and safety of oral solution of magnesium sodium potassium sulfate in bowel preparation before colonoscopy. Methods Patients who planned to undergo colonoscopy at the digestive department of the Ninth People’s Hospital, affiliated to School of Medicine of Shanghai Jiao Tong University from January 2023 to August 2023 were selected and eligible subjects were divided into two groups: Group A took polyethylene glycol (PEG) and Group B took oral solution of magnesium sodium potassium sulfate (OSS). The quality, drug tolerance, and safety of intestinal preparation were evaluated. The quality of bowel preparation was evaluated by the boston bowel preparation scale (BBPS). Results The right colon BBPS score of Group B was (2.39±0.82) points, which was significantly higher than of Group A (2.11±0.43) points (P<0.05). The overall score of Group B was higher than that of Group A (P<0.05). OSS was easier to take than PEG, with a good taste and overall sensation. Patients were willing to use OSS to clean their bowels even when they were willing to undergo another examination (P<0.05). There was a significant difference in nausea and vomiting symptoms between the two groups (P<0.05), and there were no significant changes in renal function and electrolytes before and after medication in the two groups of patients. Conclusion OSS had a higher quality of bowel cleaning and was easier for patients to accept.
4.Related research on pathogenic candidate genes for familial blepharophimosis-ptosis-epicanthus inversus syndrome
Xin TAN ; Linan JIAO ; Xianfang PU ; Yunqin LI ; Yue ZOU ; Jianshu KANG
International Eye Science 2026;26(1):142-147
AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.
5.Etiology and treatment of dysuria shortly after holmium laser enucleation of the prostate: a report of 98 cases
Chao LU ; Xin GU ; Wenfeng LI ; Chong LIU ; Bao HUA ; Jiangyi WANG ; Minkai XIE ; Yiwei WANG ; Qing YANG
Journal of Modern Urology 2026;31(5):435-439
Objective To investigate the etiology and treatment of dysuria shortly after holmium laser enucleation of the prostate (HoLEP) for benign prostatic hyperplasia (BPH), so as to improve the therapeutic efficacy. Methods A retrospective analysis was conducted on 1361 BPH patients who received HoLEP at our hospital during Mar. 2018 and Mar. 2025. All patients underwent ultrasound, computed tomography (CT), urethral probing or radiography, cystourethroscopy, and urodynamic testing. The causes, treatments and prognosis of dysuria after operation were summarized. Results ninety-eight patients (7.2%) experienced dysuria within 3 months after surgery, and all patients received initial urethral dilation. Among the 62 cases with urethral stricture, 28 were treated with urethral dilation (average of 8 sessions), 16 underwent external urethral incision, 8 underwent anterior urethroplasty, and 10 underwent transurethral plasma incision for urethral stricture. Of the 12 cases with residual prostate tissue, 5 underwent urethral plasma prostatectomy and 7 received medication. All of the 12 cases with bladder neck contracture underwent transurethral plasma incision of the bladder neck and local drug injection. Five cases with intravesical blood clots underwent urethral blood clot irrigation, 2 of which developed active bleeding and then underwent electrocoagulation. Four cases with detrusor dysfunction had catheters re-indwelled for one week followed by medication. Two cases with stone and one case with tissue fragment impacted in the urethra underwent urethral holmium lithotripsy and cystoscopic removal. All patients underwent reoperation successfully and experienced complete resolution or significant improvement of urinary difficulties. Conclusion A certain proportion of patients experience dysuria after HoLEP, with diverse etiologies. The combination of prevention and treatment can reduce the incidence of dysuria.
6.Umbrella decision-making model for diagnosis and treatment of elderly lung cancer patients: Construction and practice
Lunxu LIU ; Jian ZHOU ; Xiang DING ; Nan CHEN ; Jianxin XUE ; Xuelei MA ; Ye WANG ; Weiya WANG ; Liqing PENG ; Xin YOU ; Minggang SU ; Xu CHENG ; Jiao WANG ; Ning GE ; Deying KANG ; Yuchen HUANG ; Jinghan WANG ; Yu TONG ; Yaoxi ZHANG ; Jirong YUE ; Hu LIAO
Chinese Journal of Clinical Thoracic and Cardiovascular Surgery 2026;33(06):833-839
With the accelerating trend of population aging, the number of elderly patients with lung cancer continues to rise, and the disease burden is becoming increasingly heavy. The clinical management of these patients faces severe challenges due to their decreased physiological reserve, complex comorbidities, and significant individual heterogeneity. Consequently, under traditional diagnosis and treatment models, doctors often struggle to identify the individualized risks of elderly patients in a timely and comprehensive manner, which can easily lead to decision biases such as undertreatment or overtreatment. In view of this, this study advocates for the establishment of an umbrella decision-making model specifically tailored for elderly lung cancer patients. Grounded in a multidisciplinary team (MDT) platform, this model deeply integrates oncological indicators with the comprehensive geriatric assessment (CGA) system. By holistically considering multidimensional variables including tumor burden, organ function, frailty index, cognitive status, and social support, the model establishes an operational mechanism characterized by "single entry, precise stratification, and targeted selection". Accordingly, patients can be scientifically triaged into distinct intervention tiers, such as active surveillance, minimally invasive surgery, drug therapy, radiotherapy, and best supportive care, thereby achieving real-time alignment between treatment intensity and patient fitness. This article elaborates on the construction logic and key operational procedures of this novel decision-making framework, aiming to guide clinical practice beyond the limitations of a tumor-centric perspective toward a holistic, dynamic, whole-course management strategy. This transition seeks to ensure optimal quality of life and clinical net benefit for elderly patients alongside survival prolongation.
7.Optimization of Ovarian Tissue Vitrification Using Hydrogel Encapsulation and Magnetic Induction Nanowarming
Yu-Kun CAO ; Na YE ; Zheng LI ; Xin-Li ZHOU
Progress in Biochemistry and Biophysics 2025;52(2):464-477
ObjectiveFor prepubertal and urgently treated malignant tumor patients, ovarian tissue cryopreservation and transplantation represent more appropriate fertility preservation methods. Current clinical practices often involve freezing ovarian tissue with high concentrations of cryoprotectants (CPAs) and thawing with water baths. These processes lead to varying degrees of toxicity and devitrification damage to ovarian tissue. Therefore, this paper proposes optimized methods for vitrification of ovarian tissues based on sodium alginate hydrogel encapsulation and magnetic induction nanowarming technology. MethodsFirstly, the study investigated the effects of sodium alginate concentration, the sequence of hydrogel encapsulation and CPAs loading on vitrification efficiency of encapsulated ovarian tissue. Additionally, the capability of sodium alginate hydrogel encapsulation to reduce the required concentration of CPAs was validated. Secondly, a platform combining water bath and magnetic induction nanowarming was established to rewarm ovarian tissue under various concentrations of magnetic nanoparticles and magnetic field strengths. The post-warming follicle survival rate, antioxidant capacity, and ovarian tissue integrity were evaluated to assess the efficacy of the method. ResultsThe study found that ovarian tissue encapsulated with 2% sodium alginate hydrogel exhibited the highest follicle survival rate after vitrification. The method of loading CPAs prior to encapsulation proved more suitable for ovarian tissue cryopreservation, effectively reducing the required concentration of CPAs by 50%. A combination of 8 g/L Fe3O4 nanoparticles and an alternating magnetic field of 300 Gs showed optimal warming effectiveness for ovarian tissue. Combining water bath rewarming with magnetic induction nanowarming yielded the highest follicle survival rate, enhanced antioxidant capacity, and preserved tissue morphology. ConclusionSodium alginate hydrogel encapsulation of ovarian tissue reduces the concentration of CPAs required during the freezing process. The combination of magnetic induction nanowarming with water bath provides an efficient method ovarian tissue rewarming. This study offers novel approaches to optimize ovarian tissues vitrification.
8.Clinical practice guidelines for intraoperative cell salvage in patients with malignant tumors
Changtai ZHU ; Ling LI ; Zhiqiang LI ; Xinjian WAN ; Shiyao CHEN ; Jian PAN ; Yi ZHANG ; Xiang REN ; Kun HAN ; Feng ZOU ; Aiqing WEN ; Ruiming RONG ; Rong XIA ; Baohua QIAN ; Xin MA
Chinese Journal of Blood Transfusion 2025;38(2):149-167
Intraoperative cell salvage (IOCS) has been widely applied as an important blood conservation measure in surgical operations. However, there is currently a lack of clinical practice guidelines for the implementation of IOCS in patients with malignant tumors. This report aims to provide clinicians with recommendations on the use of IOCS in patients with malignant tumors based on the review and assessment of the existed evidence. Data were derived from databases such as PubMed, Embase, the Cochrane Library and Wanfang. The guideline development team formulated recommendations based on the quality of evidence, balance of benefits and harms, patient preferences, and health economic assessments. This study constructed seven major clinical questions. The main conclusions of this guideline are as follows: 1) Compared with no perioperative allogeneic blood transfusion (NPABT), perioperative allogeneic blood transfusion (PABT) leads to a more unfavorable prognosis in cancer patients (Recommended); 2) Compared with the transfusion of allogeneic blood or no transfusion, IOCS does not lead to a more unfavorable prognosis in cancer patients (Recommended); 3) The implementation of IOCS in cancer patients is economically feasible (Recommended); 4) Leukocyte depletion filters (LDF) should be used when implementing IOCS in cancer patients (Strongly Recommended); 5) Irradiation treatment of autologous blood to be reinfused can be used when implementing IOCS in cancer patients (Recommended); 6) A careful assessment of the condition of cancer patients (meeting indications and excluding contraindications) should be conducted before implementing IOCS (Strongly Recommended); 7) Informed consent from cancer patients should be obtained when implementing IOCS, with a thorough pre-assessment of the patient's condition and the likelihood of blood loss, adherence to standardized internally audited management procedures, meeting corresponding conditions, and obtaining corresponding qualifications (Recommended). In brief, current evidence indicates that IOCS can be implemented for some malignant tumor patients who need allogeneic blood transfusion after physician full evaluation, and LDF or irradiation should be used during the implementation process.
9.Study on the efficacy of vacuum-assisted minimally invasive gyrotomy for benign lesions in the lower quadrant of the breast
Zhiqiang ZHANG ; Xin SUN ; Yinqi GAO ; Jian JIAO ; Siqi LIU ; Fangcai LIN
Journal of Clinical Surgery 2025;33(8):852-855
Objective To explore the efficacy of vacuum-assisted minimally invasive gyrotomy for benign lesions in the lower quadrant of the breast.Methods From August 2022 to August 2023,90 patients with benign lesions in the lower quadrant of the breast were treated.According to the different surgical methods,they were divided into two groups:the traditional group included 45 cases,which underwent surgery through the trans-areolar incision;the minimally invasive group included 45 cases,which underwent surgery through the trans-mammary fold incision with vacuum-assisted minimally invasive technique.The surgical-related indicators,inflammatory response indicators,patient satisfaction,and safety were compared between the two groups.Results The operation time[(20.45±6.18)min],intraoperative bleeding[(7.78±2.23)ml],hospital stay[(4.37±1.05)d],scar length[(2.32±0.42)cm]and healing time[(3.46±1.08)d]in the minimally invasive group were significantly better than those in the traditional group[(34.52±9.46)min,(23.16±6.44)ml,(8.72±2.73)d,(19.14±4.18)cm and(7.37±2.16)d](P<0.05).The levels of IL-6[(12.14±2.86)ng/L],IL-10[(14.33±3.74)pg/ml],CRP[(13.85±3.11)mg/L],Cor[(131.27±6.43)nmol/L]and NE[(82.55±8.44)in the minimally invasive group at 3 days after surgery ng/ml were increased and VEGF was decreased[(59.72±7.44)mg/L]than the traditional group[(17.23±3.38)ng/L,(19.62±4.88)pg/ml,(28.36±4.67)mg/L,(196.52±8.84)nmol/L,(117.62±7.14)ng/ml and(88.46±7.89)mg/L](P<0.05).The satisfaction of patients in minimally invasive group(97.78%,44/45)was significantly higher than that in traditional group(82.22%,37/45)(P<0.05).The incidence of adverse events in minimally invasive group(4.44%,2/45)was significantly lower than that in traditional group(22.22%,10/45)(P<0.05).Conclusion Vacuum-assisted minimally invasive rotatory excision can optimize surgical indicators,improve serological indicators,enhance patient satisfaction and treatment safety compared to traditional areola incision surgery.
10.The clinical value of NHR combined with MLR for predicting early rebleeding after endoscopic treatment in patients with cirrhosis complicated by acute esophageal-gastric variceal rupture and bleeding
Yan LI ; Haitao JIAO ; Haiyang HUA ; Wei LIU ; Shuling LIU ; Xinju CAO ; Xin HAO ; Aimin WANG
Tianjin Medical Journal 2025;53(11):1152-1157
Objective To evaluate the predictive value of neutrophil/high-density lipoprotein cholesterol ratio(NHR)combined with monocyte/lymphocyte ratio(MLR)for early rebleeding after endoscopic treatment in patients with cirrhosis complicated by acute esophagogastric variceal bleeding(AEVB).Methods A total of 228 patients with cirrhosis complicated by AEVB were included in this study.According to the occurrence of early rebleeding,patients were divided into the rebleeding group(96 cases)and the non-rebleeding group(132 cases).General information and laboratory indicators of both groups were collected,and the End-Stage Liver Disease(MELD)score,Child-Turcotte-Pugh(CTP)score,Fibrosis-4(FIB-4)index,NHR,and MLR were calculated.Logistic regression analysis was used to identify the risk factors for early rebleeding in patients with cirrhosis complicated by AEVB.A nomogram model based on NHR and MLR was constructed to predict the risk of early rebleeding.The predictive performance and goodness of fit of the model were evaluated using receiver operating characteristic(ROC)curve,Hosmer-Lemeshow test,Net Reclassification Index(NRI)and Integrated Discrimination Improvement(IDI).Results Compared with the non-rebleeding group,systolic blood pressure,platelet count(PLT),albumin/globulin ratio(A/G)and low-density lipoprotein cholesterol(LDL-C)were decreased in the rebleeding group,while total bile acids(TBA),aspartate aminotransferase(AST),alanine aminotransferase(ALT),total bilirubin(TBIL),activated partial thromboplastin time(APTT),thrombin time(TT),international normalized ratio(INR),Fibrosis-4(FIB-4),NHR,MLR,MELD score and CTP score were increased(P<0.05).NHR was positively correlated with AST,TBIL and INR(P<0.05).MLR was negatively correlated with PLT,and positively correlated with AST,TBIL and FIB-4(P<0.05).Logistic regression analysis results showed that prolonged TT,elevated NHR and MLR were independent risk factors for early rebleeding in patients with cirrhosis complicated by AEVB.The nomogram model based on NHR and MLR to predict early rebleeding had an area under the curve of 0.810(95%CI:0.754-0.866).The Hosmer-Lemeshow test suggested that the model fit well.IDI and NRI analyse showed that the combination of NHR and MLR had better predictive value for the early rebleeding than that of MELD score and CTP score.Conclusion NHR and MLR are effective indicators for predicting early rebleeding after endoscopic treatment in patients with cirrhosis complicated by AEVB.They are helpful in the early identification of high-risk patients and provide a reference for clinical intervention.

Result Analysis
Print
Save
E-mail