AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

ObjectiveTo explore the effects of Yimei Baijiang formula （YMBJF） on colitis-associated colorectal cancer （CAC） and the nuclear factor kappaB （NF-κB） signaling pathway in mice. MethodsSixty male Balb/c mice of 4-6 weeks old were randomized into 6 groups： Normal， model， capecitabine （0.83 g·kg^-1）， and low-， medium-， and high-dose （4.63， 9.25， 18.50 g·kg^-1， respectively） YMBJF. The mouse model of CAC was established by combining azoxymethane （AOM， 10 mg·kg^-1） and dextran sulfate sodium （DSS， 2%）. At the 5^th week after the start of modeling， the capecitabine group and the YMBJF groups were respectively administrated with the corresponding doses of drugs by gavage once a day for a total of 6 weeks. The body weights and general conditions of mice were measured and observed， and the disease activity index （DAI） was scored. The tumors in the colorectal tissue were counted， and the colorectal length was measured. The histological features of the colorectal tissue in each group of mice were observed by hematoxylin-eosin （HE） staining. The levels of inflammatory cytokines including interleukin-6 （IL-6）， interleukin-1β （IL-1β）， and tumor necrosis factor-α （TNF-α） in the serum were determined by enzyme-linked immunosorbent assay （ELISA）. The expression and localization of proliferating cell nuclear antigen-67 （Ki67）， proliferating cell nuclear antigen （PCNA）， and phosphorylated nuclear transcription factor-κB p65 （p-NF-κB p65） proteins were observed by immunohistochemistry （IHC）. The apoptosis of tumor cells was observed by the TUNEL assay. The mRNA levels of IL-6，IL-1β， TNF-α， nuclear transcription factor-κB p65 （NF-κB p65）， NF-κB inhibitor alpha （IκBα）， B-cell lymphoma-2 （Bcl-2）， and Bcl-2-associated X protein （Bax） in the colorectal tissue were quantified by Real-time polymerase chain reaction（Real-time PCR）. The protein levels of NF-κB p65， phosphorylated （p）-NF-κB p65， IκBα， p-IκBα， Bcl-2， and Bax in the colorectal tissue were determined by Western blot. ResultsCompared with the model group， each YMBJF group showed decreases in DAI and tumor number （P0.01）， and the medium-dose and high-dose YMBJF groups showed increases in colorectal length （P0.05）. In addition， each YMBJF group showed alleviated colorectal mucosal pathological injury， declined levels of IL-6， IL-1β， and TNF-α in the serum （P0.05）， reduced expression of Ki67 and PCNA （P0.01）， and down-regulated expression of p-NF-κB p65 （P0.05）. The apoptosis in the medium-dose and high-dose YMBJF groups increased （P0.01）. Each YMBJF group and the capecitabine group showed down-regulated mRNA levels of IL-1β， TNF-α， IL-6， NF-κB p65， and Bcl-2 （P0.05） and up-regulated mRNA levels of IκBα and Bax （P0.05）. The mRNA level of IκBα was up-regulated， and that of Bcl-2 was down-regulated （P0.05） in the high-dose YMBJF group. The protein levels of p-IκBα and Bcl-2 were down-regulated （P0.05） in each YMBJF group. The protein levels of IκBα and Bax were up-regulated in the medium-dose and high-dose YMBJF groups （P0.01）， while those of NF-κB p65 and p-NF-κB p65 were down-regulated （P0.05）. ConclusionYMBJF can reduce the number of tumors， reduce the levels of inflammatory factors， promote tumor cell apoptosis， and inhibit tumor cell proliferation by regulating the direct effector molecules of the NF-κB signaling pathway in the mouse model of CRC.

ObjectiveTo explore the effects of Yimei Baijiang formula （YMBJF） on colitis-associated colorectal cancer （CAC） and the nuclear factor kappaB （NF-κB） signaling pathway in mice. MethodsSixty male Balb/c mice of 4-6 weeks old were randomized into 6 groups： Normal， model， capecitabine （0.83 g·kg^-1）， and low-， medium-， and high-dose （4.63， 9.25， 18.50 g·kg^-1， respectively） YMBJF. The mouse model of CAC was established by combining azoxymethane （AOM， 10 mg·kg^-1） and dextran sulfate sodium （DSS， 2%）. At the 5^th week after the start of modeling， the capecitabine group and the YMBJF groups were respectively administrated with the corresponding doses of drugs by gavage once a day for a total of 6 weeks. The body weights and general conditions of mice were measured and observed， and the disease activity index （DAI） was scored. The tumors in the colorectal tissue were counted， and the colorectal length was measured. The histological features of the colorectal tissue in each group of mice were observed by hematoxylin-eosin （HE） staining. The levels of inflammatory cytokines including interleukin-6 （IL-6）， interleukin-1β （IL-1β）， and tumor necrosis factor-α （TNF-α） in the serum were determined by enzyme-linked immunosorbent assay （ELISA）. The expression and localization of proliferating cell nuclear antigen-67 （Ki67）， proliferating cell nuclear antigen （PCNA）， and phosphorylated nuclear transcription factor-κB p65 （p-NF-κB p65） proteins were observed by immunohistochemistry （IHC）. The apoptosis of tumor cells was observed by the TUNEL assay. The mRNA levels of IL-6，IL-1β， TNF-α， nuclear transcription factor-κB p65 （NF-κB p65）， NF-κB inhibitor alpha （IκBα）， B-cell lymphoma-2 （Bcl-2）， and Bcl-2-associated X protein （Bax） in the colorectal tissue were quantified by Real-time polymerase chain reaction（Real-time PCR）. The protein levels of NF-κB p65， phosphorylated （p）-NF-κB p65， IκBα， p-IκBα， Bcl-2， and Bax in the colorectal tissue were determined by Western blot. ResultsCompared with the model group， each YMBJF group showed decreases in DAI and tumor number （P0.01）， and the medium-dose and high-dose YMBJF groups showed increases in colorectal length （P0.05）. In addition， each YMBJF group showed alleviated colorectal mucosal pathological injury， declined levels of IL-6， IL-1β， and TNF-α in the serum （P0.05）， reduced expression of Ki67 and PCNA （P0.01）， and down-regulated expression of p-NF-κB p65 （P0.05）. The apoptosis in the medium-dose and high-dose YMBJF groups increased （P0.01）. Each YMBJF group and the capecitabine group showed down-regulated mRNA levels of IL-1β， TNF-α， IL-6， NF-κB p65， and Bcl-2 （P0.05） and up-regulated mRNA levels of IκBα and Bax （P0.05）. The mRNA level of IκBα was up-regulated， and that of Bcl-2 was down-regulated （P0.05） in the high-dose YMBJF group. The protein levels of p-IκBα and Bcl-2 were down-regulated （P0.05） in each YMBJF group. The protein levels of IκBα and Bax were up-regulated in the medium-dose and high-dose YMBJF groups （P0.01）， while those of NF-κB p65 and p-NF-κB p65 were down-regulated （P0.05）. ConclusionYMBJF can reduce the number of tumors， reduce the levels of inflammatory factors， promote tumor cell apoptosis， and inhibit tumor cell proliferation by regulating the direct effector molecules of the NF-κB signaling pathway in the mouse model of CRC.

ObjectiveColorectal cancer (CRC) is a highly heterogeneous malignancy, and traditional Chinese medicine (TCM) syndrome differentiation is widely used in its clinical management. However, the biological basis underlying different TCM syndromes remains insufficiently understood. This study aimed to investigate the proteomic differences between qi-blood deficiency syndrome (QBDS) and damp-heat syndrome (DHS) in CRC patients and to establish a “syndrome-differential protein-herbal component” network for exploring potential molecular mechanisms and therapeutic targets associated with syndrome-specific treatment strategies. MethodsTumor tissue samples were collected from 10 patients with pathologically confirmed CRC, including 5 patients diagnosed with QBDS and 5 with DHS according to standardized TCM syndrome differentiation criteria. Tandem mass tag (TMT)-based quantitative proteomics was employed to identify differentially expressed proteins (DEPs) between the two syndrome groups. Functional enrichment analyses, including Gene Ontology (GO) annotation and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analyses, were performed to characterize the biological functions and signaling pathways associated with the identified DEPs. Least absolute shrinkage and selection operator (LASSO) regression analysis was further applied to screen key syndrome-related proteins and construct a core protein prediction model. Subsequently, molecular docking was conducted to evaluate the binding affinities between representative herbal compounds, astragaloside IV and berberine, and the identified core proteins. Finally, cell counting kit-8 (CCK-8) assays were performed in HCT 116 and HT-29 colorectal cancer cell lines to validate the anti-proliferative activities of these compounds in vitro. ResultsA total of 44 DEPs were identified between QBDS and DHS tissues, including 21 upregulated and 23 downregulated proteins in the QBDS group relative to the DHS group. Functional enrichment analyses revealed that these proteins were primarily associated with antiviral immune responses, regulation of inflammatory signaling, NF‑κB signaling pathways, cholesterol metabolism, and other biological processes relevant to tumor progression and host immune regulation. LASSO regression analysis identified eight core proteins with potential syndrome-specific significance. Among them, ST7, GPCPD1, and PODXL were closely associated with QBDS, whereas FAT1, GRB7, KRT7, MAFF, and MMP8 were associated with DHS. Molecular docking demonstrated favorable interactions between astragaloside IV and QBDS-related proteins, with binding energies lower than -5 kcal/mol, indicating stable binding activity. Berberine exhibited even lower binding energies and stronger binding specificity toward DHS-related core proteins. In vitro experiments further confirmed that both compounds inhibited CRC cell proliferation, while berberine displayed significantly greater anti-proliferative efficacy. The lowest 48 h IC₅₀ value of berberine reached 15.21 mg/L in CRC cells, indicating a stronger growth-inhibitory effect than astragaloside IV. ConclusionCRC patients with QBDS and DHS exhibit distinct proteomic characteristics, suggesting that different TCM syndromes possess unique molecular signatures. The identified core proteins may serve as potential biomarkers for syndrome differentiation, while astragaloside IV and berberine may exert therapeutic effects through targeting syndrome-specific molecular networks. These findings provide preliminary proteomic evidence supporting syndrome-guided precision integrative medicine in CRC and offer new insights into the biological basis of TCM syndrome differentiation and individualized therapeutic strategies.

Intraoperative cell salvage (IOCS) has been widely applied as an important blood conservation measure in surgical operations. However, there is currently a lack of clinical practice guidelines for the implementation of IOCS in patients with malignant tumors. This report aims to provide clinicians with recommendations on the use of IOCS in patients with malignant tumors based on the review and assessment of the existed evidence. Data were derived from databases such as PubMed, Embase, the Cochrane Library and Wanfang. The guideline development team formulated recommendations based on the quality of evidence, balance of benefits and harms, patient preferences, and health economic assessments. This study constructed seven major clinical questions. The main conclusions of this guideline are as follows: 1) Compared with no perioperative allogeneic blood transfusion (NPABT), perioperative allogeneic blood transfusion (PABT) leads to a more unfavorable prognosis in cancer patients (Recommended); 2) Compared with the transfusion of allogeneic blood or no transfusion, IOCS does not lead to a more unfavorable prognosis in cancer patients (Recommended); 3) The implementation of IOCS in cancer patients is economically feasible (Recommended); 4) Leukocyte depletion filters (LDF) should be used when implementing IOCS in cancer patients (Strongly Recommended); 5) Irradiation treatment of autologous blood to be reinfused can be used when implementing IOCS in cancer patients (Recommended); 6) A careful assessment of the condition of cancer patients (meeting indications and excluding contraindications) should be conducted before implementing IOCS (Strongly Recommended); 7) Informed consent from cancer patients should be obtained when implementing IOCS, with a thorough pre-assessment of the patient's condition and the likelihood of blood loss, adherence to standardized internally audited management procedures, meeting corresponding conditions, and obtaining corresponding qualifications (Recommended). In brief, current evidence indicates that IOCS can be implemented for some malignant tumor patients who need allogeneic blood transfusion after physician full evaluation, and LDF or irradiation should be used during the implementation process.

[Objective] To explore the temperature parameters affecting the polybrene test and determine the optimal temperature conditions for detecting unexpected antibodies of the Rh system. [Methods] The reaction of IgG human anti-D antibody with different dilutions (undiluted, 1∶2, 1∶4, 1∶8, 1∶16, 1∶32，1∶64) with D antigen-positive red blood cells was detected by manual polybrene test (MPT). Different temperatures (25℃ and 37℃) were set, and the reaction time with low ionic medium was 4 minutes. The agglutination integral value of anti-D and red cell depolymerization time were compared to observe the effect of enhanced agglutination reaction, thereby establishing the test temperature reaction conditions for enhancing the MPT. The same reaction condition was applied to 36 blood samples containing unexpected antibodies of the Rh system, and the effect of enhanced MPT was observed in comparison with the polybrene method and the antiglobulin test (column agglutination). [Results] With all other conditions held constant, when low ionic medium was added, the incubation temperature of 25℃ and 37℃ resulted in different total agglutination integral values for anti-D (20.9±2.025 vs 25.5±2.635), and the comparison showed a significant difference (P<0.05). When the antibody dilution was 1∶16, the incubation temperature of 25℃ and 37℃ resulted in different agglutination integral values (3.9±0.738 vs 5.8±0.632), and the comparison showed a significant difference (P<0.05). Erythrocyte depolymerization time (62.8±8.149 vs 90.1±10.713) was significantly different (P<0.05). At a dilution of 1∶32, the incubation temperatures of 25℃ and 37℃ resulted in different agglutination integral values (2.5±0.527 vs 4.3±0.675), as well as different red blood cell dissociation times (35.4±7.792 vs 57.4±10.885)(P<0.05), and the comparison showed a significant difference (P<0.05), with no differences observed in the other groups. In the detection of 36 Rh system unexpected antibody samples, when the antibody titer was ≤2, the enhanced polybrene method had a higher positive rate, and when the antibody titer was ≥4, the detection rates of the three methods were consistent. [Conclusion] The reference temperature condition for the modified MPT is incubation at 37℃ for 4 min after the addition of low ionic medium. The application of this temperature condition to unexpected antibody samples of Rh system could achieve a significant enhancement effect, thereby increasing transfusion safety for the treatment of emergency patients, and is worth popularizing.

Objective:To explore the factors influencing adherence to voice therapy among patients with voice disorders in China. Methods:Patients with voice disorders who visited the Voice Therapy Center at Sun Yat-sen Memorial Hospital, Sun Yat-sen University, from February to May 2022 were enrolled in the study. Adherence was assessed using the URICA-Voice scale, while influencing factors were assessed through the Voice Handicap Index（VHI） scale and a general information questionnaire. Correlation analysis was conducted using univariate and multivariate logistic regression analysis. Results:A total of 247 patients were included in the study, comprising 57 males（23.08%） and 190 females（76.92%）. The results revealed that: ①Female patients demonstrated higher likelihood of being in the contemplation stage（OR=0.22） compared to males. ②Patients with a monthly family income per capita>6 000 yuan were more likely to be in the contemplation stage than those with<3 000 yuan with an OR = 13.94. ③High vocal-demand occupations increased contemplation stage probability（OR=7.70） compared to moderate-demand occupations. ④Residence within 30-minute commute predicted action/maintenance stages（OR=7.14） versus≥60-minute commute. ⑤Patients whose occupations had high voice demands were more likely to be in the action and maintenance stages than those with average voice demands, with an OR of 16.20. Conclusion:Gender, monthly family income per capita, occupational voice demands, and distance to the hospital significantly impact the URICA-Voice compliance stages of patients. Patients who are female, have higher family income, have occupations with high voice demands, and live closer to the hospital exhibit higher compliance with voice training.
Humans ; Male ; Female ; Voice Disorders/therapy* ; Patient Compliance ; Voice Training ; Surveys and Questionnaires ; China ; Middle Aged ; Adult ; Voice Quality ; Logistic Models ; Aged

Objective:To compare the efficacy of gasless robotic surgery via transaxillary approach and combined axillary-retroauricular approach for unilateral N1b PTC, and to explore the safety and effectiveness of gasless robotic surgery via transaxillary approach for unilateral N1b PTC. Methods:Unilateral N1b PTC patients who underwent surgery in the Department of Otolaryngology, Sun Yat Sen Memorial Hospital, Sun Yat sen University between July 2016 and December 2024 were included and analyzed. According to the inclusion and exclusion criteria and the differences of surgical approaches, the patients were divided into the transaxillary approach（TA） group and the combined axillary-retroauricular approach（TARA） group. The demographic data, operation time, intraoperative blood loss, postoperative drainage volume, postoperative complications, shoulder function evaluation, postoperative visual analogue scale（VAS） of neck aesthetics and recurrence of the two groups were statistically analyzed. Results:A total of 88 patients undergoing gasless robotic surgery were included in this study, including 23 cases in the TA group and 65 cases in the TARA group. The proportion of males in the TA group was significantly higher than that in the TARA group（56.5% vs 21.5%, χ²=9.776, P=0.002）. The total operation time in the TA group was significantly lower than that in the TARA Group（180.00[155.00, 220.00]min vs 220.00[177.50, 272.50]min, z=-2.775, P=0.006）, and the postoperative blood loss in the TA group was significantly lower than that in the TARA Group（30.00[20.00, 50.00]ml vs 50.00[30.00, 60.00]ml, Z=-2.127, P=0.033）. The proportion of area Ⅱ-Ⅴ in the TA group and the TARA group was 87.0% and 70.8%, respectively, and there was no significant difference between the two groups（P>0.05）. There was no significant difference in lateral cervical lymph node dissection and central lymph node dissection between the two groups（P>0.05）. During the follow-up period, no recurrence was found in the two groups, and there was no significant difference in the incidence of complications between the two groups（P>0.05）. According to the stratification of dynamic recurrence risk assessment, it can be seen that the proportion of curative effect satisfaction in the TA group was as high as 95.7%, and that in the TARA group was as high as 81.5%, with no significant difference between the two groups. There was no significant difference in VAS score of neck, Constant Shoulder Score and NDⅡ scale between the two groups（P>0.05）. Conclusion:Gasless robotic surgery via transaxillary approach for unilateral N1b PTC is safe and feasible, and the amount postoperative lymph node acquisition is equivalent to that of combined axillary-retroauricular approach, which can provide a new choice for the treatment of unilateral N1b PTC patients.
Humans ; Robotic Surgical Procedures/methods* ; Axilla/surgery* ; Male ; Female ; Operative Time ; Middle Aged ; Adult ; Treatment Outcome ; Postoperative Complications

The prevalence of Class III malocclusion varies among different countries and regions. The populations from Southeast Asian countries (Chinese and Malaysian) showed the highest prevalence rate of 15.8%, which can seriously affect oral function, facial appearance, and mental health. As anterior crossbite tends to worsen with growth, early orthodontic treatment can harness growth potential to normalize maxillofacial development or reduce skeletal malformation severity, thereby reducing the difficulty and shortening the treatment cycle of later-stage treatment. This is beneficial for the physical and mental growth of children. Therefore, early orthodontic treatment for Class III malocclusion is particularly important. Determining the optimal timing for early orthodontic treatment requires a comprehensive assessment of clinical manifestations, dental age, and skeletal age, and can lead to better results with less effort. Currently, standardized treatment guidelines for early orthodontic treatment of Class III malocclusion are lacking. This review provides a comprehensive summary of the etiology, clinical manifestations, classification, and early orthodontic techniques for Class III malocclusion, along with systematic discussions on selecting early treatment plans. The purpose of this expert consensus is to standardize clinical practices and improve the treatment outcomes of Class III malocclusion through early orthodontic treatment.
Humans ; Malocclusion, Angle Class III/classification* ; Orthodontics, Corrective/methods* ; Consensus ; Child

Instrument separation is a critical complication during root canal therapy, impacting treatment success and long-term tooth preservation. The etiology of instrument separation is multifactorial, involving the intricate anatomy of the root canal system, instrument-related factors, and instrumentation techniques. Instrument separation can hinder thorough cleaning, shaping, and obturation of the root canal, posing challenges to successful treatment outcomes. Although retrieval of separated instrument is often feasible, it carries risks including perforation, excessive removal of tooth structure and root fractures. Effective management of separated instruments requires a comprehensive understanding of the contributing factors, meticulous preoperative assessment, and precise evaluation of the retrieval difficulty. The application of appropriate retrieval techniques is essential to minimize complications and optimize clinical outcomes. The current manuscript provides a framework for understanding the causes, risk factors, and clinical management principles of instrument separation. By integrating effective strategies, endodontists can enhance decision-making, improve endodontic treatment success and ensure the preservation of natural dentition.
Humans ; Root Canal Therapy/adverse effects* ; Consensus ; Root Canal Preparation/adverse effects*