AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

ObjectiveTo explore the effects of Yimei Baijiang formula （YMBJF） on colitis-associated colorectal cancer （CAC） and the nuclear factor kappaB （NF-κB） signaling pathway in mice. MethodsSixty male Balb/c mice of 4-6 weeks old were randomized into 6 groups： Normal， model， capecitabine （0.83 g·kg^-1）， and low-， medium-， and high-dose （4.63， 9.25， 18.50 g·kg^-1， respectively） YMBJF. The mouse model of CAC was established by combining azoxymethane （AOM， 10 mg·kg^-1） and dextran sulfate sodium （DSS， 2%）. At the 5^th week after the start of modeling， the capecitabine group and the YMBJF groups were respectively administrated with the corresponding doses of drugs by gavage once a day for a total of 6 weeks. The body weights and general conditions of mice were measured and observed， and the disease activity index （DAI） was scored. The tumors in the colorectal tissue were counted， and the colorectal length was measured. The histological features of the colorectal tissue in each group of mice were observed by hematoxylin-eosin （HE） staining. The levels of inflammatory cytokines including interleukin-6 （IL-6）， interleukin-1β （IL-1β）， and tumor necrosis factor-α （TNF-α） in the serum were determined by enzyme-linked immunosorbent assay （ELISA）. The expression and localization of proliferating cell nuclear antigen-67 （Ki67）， proliferating cell nuclear antigen （PCNA）， and phosphorylated nuclear transcription factor-κB p65 （p-NF-κB p65） proteins were observed by immunohistochemistry （IHC）. The apoptosis of tumor cells was observed by the TUNEL assay. The mRNA levels of IL-6，IL-1β， TNF-α， nuclear transcription factor-κB p65 （NF-κB p65）， NF-κB inhibitor alpha （IκBα）， B-cell lymphoma-2 （Bcl-2）， and Bcl-2-associated X protein （Bax） in the colorectal tissue were quantified by Real-time polymerase chain reaction（Real-time PCR）. The protein levels of NF-κB p65， phosphorylated （p）-NF-κB p65， IκBα， p-IκBα， Bcl-2， and Bax in the colorectal tissue were determined by Western blot. ResultsCompared with the model group， each YMBJF group showed decreases in DAI and tumor number （P0.01）， and the medium-dose and high-dose YMBJF groups showed increases in colorectal length （P0.05）. In addition， each YMBJF group showed alleviated colorectal mucosal pathological injury， declined levels of IL-6， IL-1β， and TNF-α in the serum （P0.05）， reduced expression of Ki67 and PCNA （P0.01）， and down-regulated expression of p-NF-κB p65 （P0.05）. The apoptosis in the medium-dose and high-dose YMBJF groups increased （P0.01）. Each YMBJF group and the capecitabine group showed down-regulated mRNA levels of IL-1β， TNF-α， IL-6， NF-κB p65， and Bcl-2 （P0.05） and up-regulated mRNA levels of IκBα and Bax （P0.05）. The mRNA level of IκBα was up-regulated， and that of Bcl-2 was down-regulated （P0.05） in the high-dose YMBJF group. The protein levels of p-IκBα and Bcl-2 were down-regulated （P0.05） in each YMBJF group. The protein levels of IκBα and Bax were up-regulated in the medium-dose and high-dose YMBJF groups （P0.01）， while those of NF-κB p65 and p-NF-κB p65 were down-regulated （P0.05）. ConclusionYMBJF can reduce the number of tumors， reduce the levels of inflammatory factors， promote tumor cell apoptosis， and inhibit tumor cell proliferation by regulating the direct effector molecules of the NF-κB signaling pathway in the mouse model of CRC.

ObjectiveTo explore the effects of Yimei Baijiang formula （YMBJF） on colitis-associated colorectal cancer （CAC） and the nuclear factor kappaB （NF-κB） signaling pathway in mice. MethodsSixty male Balb/c mice of 4-6 weeks old were randomized into 6 groups： Normal， model， capecitabine （0.83 g·kg^-1）， and low-， medium-， and high-dose （4.63， 9.25， 18.50 g·kg^-1， respectively） YMBJF. The mouse model of CAC was established by combining azoxymethane （AOM， 10 mg·kg^-1） and dextran sulfate sodium （DSS， 2%）. At the 5^th week after the start of modeling， the capecitabine group and the YMBJF groups were respectively administrated with the corresponding doses of drugs by gavage once a day for a total of 6 weeks. The body weights and general conditions of mice were measured and observed， and the disease activity index （DAI） was scored. The tumors in the colorectal tissue were counted， and the colorectal length was measured. The histological features of the colorectal tissue in each group of mice were observed by hematoxylin-eosin （HE） staining. The levels of inflammatory cytokines including interleukin-6 （IL-6）， interleukin-1β （IL-1β）， and tumor necrosis factor-α （TNF-α） in the serum were determined by enzyme-linked immunosorbent assay （ELISA）. The expression and localization of proliferating cell nuclear antigen-67 （Ki67）， proliferating cell nuclear antigen （PCNA）， and phosphorylated nuclear transcription factor-κB p65 （p-NF-κB p65） proteins were observed by immunohistochemistry （IHC）. The apoptosis of tumor cells was observed by the TUNEL assay. The mRNA levels of IL-6，IL-1β， TNF-α， nuclear transcription factor-κB p65 （NF-κB p65）， NF-κB inhibitor alpha （IκBα）， B-cell lymphoma-2 （Bcl-2）， and Bcl-2-associated X protein （Bax） in the colorectal tissue were quantified by Real-time polymerase chain reaction（Real-time PCR）. The protein levels of NF-κB p65， phosphorylated （p）-NF-κB p65， IκBα， p-IκBα， Bcl-2， and Bax in the colorectal tissue were determined by Western blot. ResultsCompared with the model group， each YMBJF group showed decreases in DAI and tumor number （P0.01）， and the medium-dose and high-dose YMBJF groups showed increases in colorectal length （P0.05）. In addition， each YMBJF group showed alleviated colorectal mucosal pathological injury， declined levels of IL-6， IL-1β， and TNF-α in the serum （P0.05）， reduced expression of Ki67 and PCNA （P0.01）， and down-regulated expression of p-NF-κB p65 （P0.05）. The apoptosis in the medium-dose and high-dose YMBJF groups increased （P0.01）. Each YMBJF group and the capecitabine group showed down-regulated mRNA levels of IL-1β， TNF-α， IL-6， NF-κB p65， and Bcl-2 （P0.05） and up-regulated mRNA levels of IκBα and Bax （P0.05）. The mRNA level of IκBα was up-regulated， and that of Bcl-2 was down-regulated （P0.05） in the high-dose YMBJF group. The protein levels of p-IκBα and Bcl-2 were down-regulated （P0.05） in each YMBJF group. The protein levels of IκBα and Bax were up-regulated in the medium-dose and high-dose YMBJF groups （P0.01）， while those of NF-κB p65 and p-NF-κB p65 were down-regulated （P0.05）. ConclusionYMBJF can reduce the number of tumors， reduce the levels of inflammatory factors， promote tumor cell apoptosis， and inhibit tumor cell proliferation by regulating the direct effector molecules of the NF-κB signaling pathway in the mouse model of CRC.

Turning to critical illness is a common stage of various diseases and injuries before death. Patients usually have complex health conditions, while the treatment process involves a wide range of content, along with high requirements for doctor′s professionalism and multi-specialty teamwork, as well as a great demand for time-sensitive treatments. However, this is not matched with critical care professionals and the current state of medical care in China. Telemedicine, which shortens the distance of medical professionals and the gap of disease diagnosis and treatments in various regions through electronic information, can effectively solve the current problem. Therefore, there is an urgent need to develop a standardized, high-quality visualization telemedicine round system .Therefore, experts have been organized to search domestic and foreign literature on telemedicine round for critically ill patients and to form this consensus based on clinical experiences so as to further improve the level of critical care treatments in regions.

AIM To study the chemical constituents from ethyl acetate fraction of Balanophora harlandii Hook.f.and their tyrosinase inhibitory activity.METHODS Separation and purification were performed using silica gel,MCI,ODS,Sephadex LH-20 and semi-preparative HPLC,then the structures of obtained compounds were identified by physicochemical properties and spectral data.The monophenolase inhibitory activity was determined by the tyrosinase-catalyzed oxidation of L-tyrosine.RESULTS Twenty-four compounds were isolated and identified as sesamin(1),methyl caffeate(2),quercetin(3),5,7-dihydroxychromanone(4),methyl 3,4-dihydroxybenzoate(5),esculetin(6),kaempferol(7),naringenin(8),pyrogallic acid(9),pinosylvin(10),methyl propionate(11),caffeic acid(12),saccharinol(13),ferulic acid(14),trans-p-hydroxycinnamic acid(15),cinnamic acid(16),vanillic acid(17),vanillin(18),4-hydroxyacetophenone(19),4-hydroxybenzaldehyde(20),apigenin(21),(-)-isolariciresinol(22),(-)-secoisolariciresinol(23)and meso-2,3-di(3′,4′-methylenedioxybenzyl)butane-1,4-diol(24).The IC50 values of compounds 3,5,7,8,19,and 20 ranged from(0.246 5±0.028 3)to(1.278 2±0.021 3)mmol/L.CONCLUSION Compounds 1-9、11、15、17-21、24 are isolated from this plant for the first time,and 1,6,9,17-19,24 are first isolated from genus Balanophora.Compounds 3、5、7、8、19 and 20 have tyrosinase inhibitory activity.

A 36-year-old male presented to the Department of Neurosurgery of the Second People′s Hospital of Hunan Province on February 12, 2024, due to "10 days of aggravated paroxysmal headache and 1 day of mental abnormality". Ten days ago, after catching a cold, the patient developed persistent low fever and paroxysmal headache. On February 12, 2024, acuted mental and behavioral abnormalities developed, including slow response, self-talk, defecation and urination, no sense of shame and other mental and behavioral abnormalities. On February 22nd, metagenomic next-generation sequencing (mNGS) in cerebrospinal fluid confirmed feline rickettsia infection. One week after doxycycline anti-rickettsia treatment, cerebrospinal fluid mNGS results indicated that the etiology turned negative, and the clinical symptoms improved. Mental disorders caused by rickettsial encephalitis in cats are rare but clinically significant. This case highlights the diagnostic value of mNGS in critical and difficult cases, and supports its integration with traditional diagnostic techniques to achieve precision medicine.

OBJECTIVE: To assess the feasibility of first polar body transfer (PB1T) combined with preimplantation mitochondrial genetic testing for blocking the transmission of a pathogenic mitochondrial DNA 8993T>G mutation. METHODS: A Chinese family affected with Leigh syndrome which had attended the Reproductive Medicine Centre of the First Affiliated Hospital of Anhui Medical University in September 2021 was selected as the study subject. Controlled ovarian hyperstimulation was carried out for the proband after completing the detection of the mitochondrial DNA 8993T>G mutation load among the pedigree members. Mature MII oocytes were inseminated by intracytoplasmic sperm injection (ICSI), cultured in vitro for 5 to 6 days to the blastocyst stage, and trophoblastocytes were obtained by microbiopsy. Mitochondrial DNA testing (PGT-MT) and chromosomal aneuploidy (PGT-A) analyses were carried out after whole-genome amplification, and the embryos with zero mutation load were selected for transfer. Amniotic fluid and umbilical cord blood samples were collected during middle pregnancy and after birth respectively for mitochondrial DNA testing to verify the reliability of embryo screening. As an attempt, PB1 with good morphology of MII oocytes was selected for transfer into the enucleated oocytoplasm from healthy donors, followed by ICSI fertilization, blastocyst culture and PGT of embryos using the same procedure. This study has been approved by the Ethics Committee of the First Affiliated Hospital of Anhui Medical University (No. 2021zhyx-B12). RESULTS: An antagonist protocol was used for ovarian stimulation, and a total of 19 oocytes were obtained, of which 14 MII were fertilized by ICSI, and 2 had developed into blastocysts. PGT-MT was carried out on biopsied trophoblastocytes, in which the mitochondrial DNA 8993T>G mutation load was not detected in one embryo, the other was 100% mutated, and the mutation loads of the remaining unfertilized eggs and developmentally arrested embryos ranged from 0% ~ 100%, presenting a clear biased distribution. With fully informed consent, one PGT-MT zero mutation load blastocyst was transferred and clinical pregnancy was achieved. Mitochondrial DNA and chromosomal testing of amniotic fluid cells during middle pregnancy had revealed no abnormalities. The proband had delivered a healthy boy through Caesarean section at 39⁺⁵ weeks of gestation, and no mutation was detected in the cord blood sample. Five well-formed PBs from 14 eggs were selected for PB1 transfer, followed by ICSI and culture, and two of the reconstituted embryos had formed blastocysts, with none of the above mutations detected in the biopsied samples. CONCLUSION The PGT-MT technology can help families affected with mitochondrial diseases to have healthy offspring. PB1 transfer in combination with ICSI and PGT-MT holds the promise of turning waste into treasure and providing an alternative means of fertility for such families.
Humans ; Preimplantation Diagnosis/methods* ; Female ; DNA, Mitochondrial/genetics* ; Genetic Testing/methods* ; Pregnancy ; Mitochondrial Diseases/genetics* ; Polar Bodies ; Adult ; Feasibility Studies ; Sperm Injections, Intracytoplasmic/methods* ; Embryo Transfer/methods* ; Mutation ; Male ; Blastocyst/metabolism* ; Pedigree

Objective: To analyze respiratory syncytial virus(RSV) outbreaks surveillance results and the epidemiological characteristics in kindergarten and school in Shenzhen during 2017-2023 , so as to provide a scientific reference for control and prevention of RSV. Methods: Epidemiological data and surveillance results of RSV outbreaks in kindergarten and school from 2017 to 2023 were collected for descriptive analyses. Results: A total of 31 RSV outbreaks were identified in kindergarten and school in 2017-2023 in Shenzhen, 346 cases were reported, the average incidence rate was 22.02%. The most annual RSV outbreaks were reported in 2020 with 14 outbreaks, followed by 8 outbreaks in 2023. A total of 64.52% of RSV outbreaks were identified in kindergarten with rest occurring in primary school or middle school. The greatest monthly count of outbreak was 18 (58.06%) in September, followed by 3 outbreaks (9.68%) in March and October. A total of 244 swab samples were collected, 169 samples were positive for respiratory viruses, the positive rate was 69.26%, 121 samples were positive for RSV,from 31 respiratory syncytical virus outbreaks 57 and samples were positive for other respiratory viruses(9 samples were positive for two respiratory viruses). A toral of 14(45.16%) outbreaks are caused by RSV alone, 17 outbreaks (54.84%) were caused by RSV and other respiratory viruses. Conclusions Most RSV outbreaks in kindergarten and school are reported after 2020 in Shenzhen, most RSV outbreaks occur in kindergarten, peak seasons of RSV outbreaks are autumn and spring.

Ferroptosis, a programmed cell death modality discovered and defined in the last decade, is primarily induced by iron-dependent lipid peroxidation. At present, it has been found that ferroptosis is involved in various physiological functions such as immune regulation, growth and development, aging, and tumor suppression. Especially its role in tumor biology has attracted extensive attention and research. Breast cancer is one of the most common female tumors, characterized by high heterogeneity and complex genetic background. Triple negative breast cancer (TNBC) is a special type of breast cancer, which lacks conventional breast cancer treatment targets and is prone to drug resistance to existing chemotherapy drugs and has a low cure rate after progression and metastasis. There is an urgent need to find new targets or develop new drugs. With the increase of studies on promoting ferroptosis in breast cancer, it has gradually attracted attention as a treatment strategy for breast cancer. Some studies have found that certain compounds and natural products can act on TNBC, promote their ferroptosis, inhibit cancer cells proliferation, enhance sensitivity to radiotherapy, and improve resistance to chemotherapy drugs. To promote the study of ferroptosis in TNBC, this article summarized and reviewed the compounds and natural products that induce ferroptosis in TNBC and their mechanisms of action. We started with the exploration of the pathways of ferroptosis, with particular attention to the System X_c^--cystine-GPX4 pathway and iron metabolism. Then, a series of compounds, including sulfasalazine (SAS), metformin, and statins, were described in terms of how they interact with cells to deplete glutathione (GSH), thereby inhibiting the activity of glutathione peroxidase 4 (GPX4) and preventing the production of lipid peroxidases. The disruption of the cellular defense against oxidative stress ultimately results in the death of TNBC cells. We have also our focus to the realm of natural products, exploring the therapeutic potential of traditional Chinese medicine extracts for TNBC. These herbal extracts exhibit multi-target effects and good safety, and have shown promising capabilities in inducing ferroptosis in TNBC cells. We believe that further exploration and characterization of these natural compounds could lead to the development of a new generation of cancer therapeutics. In addition to traditional chemotherapy, we discussed the role of drug delivery systems in enhancing the efficacy and reducing the toxicity of ferroptosis inducers. Nanoparticles such as exosomes and metal-organic frameworks (MOFs) can improve the solubility and bioavailability of these compounds, thereby expanding their therapeutic potential while minimizing systemic side effects. Although preclinical data on ferroptosis inducers are relatively robust, their translation into clinical practice remains in its early stages. We also emphasize the urgent need for more in-depth and comprehensive research to understand the complex mechanisms of ferroptosis in TNBC. This is crucial for the rational design and development of clinical trials, as well as for leveraging ferroptosis to improve patient outcomes. Hoping the above summarize and review could provide references for the research and development of lead compounds for the treatment for TNBC.

Paraplegia caused by spinal cord injury is a serious neurological complication, for which surgery is currently the main treatment method. Due to different surgical approaches, patients are usually expected to maintain a passive prone position for a long time or switch between the supine and prone positions. Affected by multiple factors such as neurogenic sensory disorders, pathological changes in muscle tone and operative duration, the risk of intraoperative acquired pressure injury (IAPI) is significantly increased. Current clinical prevention strategies for IAPI in these patients predominantly focus on localized pressure relief during positioning, lacking systematic, standardized comprehensive prevention protocols or evidence-based guidelines. To address it, Department of Nursing, Orthopedics Branch, China International Exchange and Promotive Association for Medical and Health Care, Spinal Trauma Professional Committee, Orthopedics Branch, Chinese Medical Doctor Association, Nursing Group of Spine and Spinal Cord Professional Committee of Chinese Association of Rehabilitation Medicine organized experts in relevant fields to formulate Guideline for the prevention of intraoperative acquired pressure injury in paraplegic patients with spinal cord injury ( version 2025), based on evidence-based medical evidence and latest research results and clinical practice at home and abroad. Eleven recommendations were put forward from the aspects of preoperative risk assessment, intraoperative prevention strategies, postoperative handover and monitoring, and supportive mechanisms for IAPI prevention, aiming to standardize the prevention measures and management strategies of IAPI in paraplegic patients with spinal cord injury and accelerate the recovery of patients and improve the therapeutic effect.