1.Staged Efficacy of Qijia Rougan Prescription Combined with Entecavir for Chronic Hepatitis B-related Hepatic Fibrosis with Qi Deficiency and Collateral Stasis Syndrome Based on "Zhu Ke Jiao" Theory
Baixue LI ; Xin WANG ; Jibin LIU ; Li WEN ; Cen JIANG ; Wenjun WU ; Dong WANG ; Shuwan LIU ; Huabao LIU ; Yongli ZHENG ; Liang HUANG ; Yue SU ; Song ZHANG ; Yanan SHANG ; Hang ZHOU ; Quansheng FENG
Chinese Journal of Experimental Traditional Medical Formulae 2026;32(9):180-188
ObjectiveThis paper aims to investigate and evaluate the staged efficacy and safety of the representative empirical prescription of the “Zhu Ke Jiao” theory, Qijia Rougan prescription, combined with entecavir in the treatment of hepatic fibrosis in chronic hepatitis B. MethodsA multicenter randomized controlled clinical study was conducted, and 101 patients diagnosed with chronic hepatitis B-related hepatic fibrosis (CHB-HF) who met the diagnosis and inclusion criteria were randomly assigned to an observation group (Qijia Rougan prescription + entecavir) and a control group (entecavir). The treatment duration was 24 weeks. Liver stiffness measurement (LSM), fibrosis-4 index (FIB-4), portal vein diameter, hepatitis B serology, biochemical indicators, hepatic fibrosis markers in serum [hyaluronic acid (HA), laminin (LN), procollagen Ⅲ peptide (PⅢP), and type Ⅳ collagen (Ⅳ-C)], and traditional Chinese medicine syndrome scores were used as efficacy evaluation indicators. Efficacy assessments and explorations of different staged subgroups of Qijia Rougan prescription were conducted according to LSM values based on the Metavir pathological staging standard. ResultsA total of 98 cases were included for statistical analysis, with 49 cases in the observation group and 49 in the control group. The general data of the patients in both groups were comparable. Compared with the same group before treatment, the observation group showed a significant reduction in LSM and FIB-4 (P<0.01), as well as notable improvements in LN, Ⅳ-C, and various TCM syndrome scores (P<0.05, P<0.01). When compared to the control group after treatment, the observation group demonstrated significant improvements in LSM, FIB-4, and various TCM syndrome score indicators (P<0.05, P<0.01), indicating that the observation group performed better than the control group. Subgroup analysis of the regression of hepatic fibrosis stages showed that compared to the same group before treatment, the observation group had better improvement in regression of stages F2 and F3 (P<0.05). When compared to the control group after treatment, the observation group exhibited superior improvement in regression of stage F3 (P<0.05). No adverse events occurred in either group during the treatment period. ConclusionCompared with entecavir alone, the combination of Qijia Rougan prescription and entecavir significantly improves the degree of hepatic fibrosis and clinical TCM symptoms in patients. The optimal intervention period is primarily during stage F3, which is a potential “interception” point of the “Zhu Ke Jiao” theory.
2.Strategies of HIV-1 Vaccines Based on mRNA Platforms
Pei LIU ; Zhong-Yue FANG ; Xin-Xin CHEN ; Shao-Wei LI ; Ying GU
Progress in Biochemistry and Biophysics 2026;53(4):826-839
Since its emergence in the 1980s, the human immunodeficiency virus (HIV) has caused a global pandemic, posing a severe threat to human life and health as well as social development. Although pre-exposure prophylaxis (PrEP) effectively curbs HIV transmission and antiretroviral therapy (ART) significantly extends the lifespan of patients, vaccines remain a pivotal tool for blocking transmission and ending the pandemic. The high genetic variability of HIV-1, the glycan shield of its envelope glycoproteins, and the long-term persistence of latent reservoirs have repeatedly led to bottlenecks in traditional vaccine strategies. In recent years, mRNA technology has offered a novel approach to addressing these challenges, leveraging advantages such as sequence programmability, short production cycles, native conformational expression of antigens, and self-adjuvant effects. In recent years, mRNA vaccine technology has emerged as a transformative solution to longstanding vaccinology challenges, characterized by its sequence programmability, rapid production cycles, native conformational antigen expression, and intrinsic self-adjuvanting properties. Unlike traditional platforms reliant on pathogen culture or recombinant proteins, mRNA vaccines can be expeditiously designed and updated based solely on viral genomic sequences. Lipid nanoparticle (LNP)-encapsulated mRNA facilitates endogenous antigen expression and presentation, simultaneously eliciting potent humoral and cellular immune responses. Within this landscape, self-amplifying mRNA (saRNA) further extends in vivo antigen expression to enhance the persistence of immune responses. Moreover, the LNP delivery system not only protects mRNA from degradation and mediates endosomal escape but also synergizes with mRNA to optimize immune activation via self-adjuvant effects. Importantly, mRNA platforms circumvent the pre-existing immunity associated with viral vectors and the genomic integration risks of DNA vaccines, positioning them as a cornerstone for global pandemic preparedness. This review systematically delineates recent advances in mRNA technology for HIV-1 vaccine development, focusing on four pivotal research frontiers. First, mRNA innovations building upon the RV144 trial optimize antigens through codon modification and multivalent designs to induce more durable and broad-spectrum immunity. Second, particulate mRNA vaccine strategies, utilizing virus-like particles (VLPs) and ferritin nanoparticles, achieve in situ antigen self-assembly, significantly enhancing B cell activation and reducing infection risks in non-human primate models. Third, germline-targeting mRNA vaccines address the low-affinity barrier of broadly neutralizing antibody (bNAp) precursors, efficiently activating rare precursor B cells and promoting affinity maturation. Fourth, therapeutic mRNA vaccines offer unique advantages for an HIV functional cure; combining immunogens with mRNA-encoded adjuvants potentiates cellular immunity, while LNP-mediated “shock-and-kill” strategies specifically activate latent reservoirs to guide immune clearance. Comparative analyses with traditional platforms reveal that mRNA technology redefines antigen production and presentation, simulating chronic infection through sustained expression and enabling dual-pathway presentation via endogenous synthesis. Furthermore, we explore the mechanistic innovations of mRNA vaccines in inducing bNAps: sustained in vivo production prolongs the activation window for precursor B cells and maintains germinal center (GC) reactions; endogenously expressed antigens adopt native conformations to expose conserved epitopes; and self-adjuvanting effects modulate the functions of antigen-presenting cells (APCs) and follicular helper T cells (Tfh), driving somatic hypermutation and affinity maturation. We also address critical clinical translation challenges, including immune durability, adaptability to special populations, and large-scale LNP manufacturing, while proposing targeted optimization strategies. In conclusion, this review establishes a theoretical framework for utilizing mRNA technology to overcome HIV-1 immune escape, transitioning from a descriptive paradigm to a problem-solving-based synthesis of evidence. By integrating preclinical and early clinical data, we bridge the gap between basic design and translational verification. mRNA technology is poised to become a central pillar inHIV-1 prevention and therapy, providing a robust toolset to achieve the global goal of ending the AIDS pandemic and offering a blueprint for vaccine development against other recalcitrant infectious diseases.
3.Skeleton Binding Protein 1 of Plasmodium berghei Influences Deformability and Cytoskeletal Ultrastructure of Infected Erythrocyte
Xin-Yue GUO ; Huan-Qi ZHAO ; Yan-Xuan ZHONG ; Ru-Meng JIANG ; Yao-Xian LI ; Lei-Ting PAN ; Qian WANG ; Xiao-Yu SHI
Progress in Biochemistry and Biophysics 2026;53(4):1015-1027
ObjectiveThe malaria parasites remodel the host erythrocyte structure by exporting parasite proteins that interact with the membrane skeleton proteins of red blood cells (RBCs), facilitating their intracellular survival and pathogenicity. Skeleton-binding protein 1 (SBP1) is a conserved exported protein across Plasmodium species. In Plasmodium falciparum, SBP1 has been reported to interact with erythrocyte membrane skeleton proteins 4.1R and spectrin, while its contribution to erythrocyte remodeling and parasite virulence in Plasmodium berghei (Pb) remains unclear. This study aims to determine whether PbSBP1 associates with the host cytoskeletal protein 4.1R and to investigate its role in the remodeling of host RBCs and the pathogenicity of Plasmodium berghei. MethodsIn Plasmodium berghei, the relationship between PbSBP1 and the erythrocyte cytoskeletal protein 4.1R was examined using co-immunoprecipitation. A Pbsbp1 gene knockout mutant of Plasmodium berghei (Pbsbp1∆) was generated based on the principle of double crossover homologous recombination. The deformability of erythrocytes infected with Pbsbp1∆ parasites was assessed using microfluidic methods. Microchannels with an array of cylindrical pillars were used to detect modifications in infected RBC deformability. The infected RBCs were squashed between the rows and recovered between the columns and the transit velocity (μm/s) of infected RBCs travelling through the microchannel was recorded. The component of the erythrocyte membrane skeleton junctional complex, tropomodulin (TMOD), was fluorescently labeled, and the cytoskeletal network of infected erythrocytes was imaged using super-resolution stochastic optical reconstruction microscopy (STORM) to analyze ultrastructural changes in the cytoskeleton of wild-type (WT) and Pbsbp1∆-infected erythrocytes. Actin-based junctional complexes were displayed as individual clusters by the labeled TMOD in the STORM images, and the cluster densities and distances between adjacent clusters of infected RBCs were calculated. Additionally, rodent malaria models (BALB/c mice) and experimental cerebral malaria models (C57BL/6 mice) were employed to monitor the growth of Pbsbp1∆ and WT parasites during the intraerythrocytic stage and their capacity to induce cerebral malaria in mice. ResultsPbSBP1 may participate in the remodeling of infected erythrocytes through direct or indirect interaction with the erythrocyte cytoskeletal protein 4.1R. Microfluidic assays revealed that the deformability of erythrocytes infected with Pbsbp1∆ parasites was significantly enhanced compared to those infected with WT parasites. STORM imaging further demonstrated that the ultrastructure of the erythrocyte cytoskeleton in Pbsbp1∆-infected cells was altered relative to that in WT-infected erythrocytes. The distances between nearest neighbors of clusters had a tendency to increase while the cluster densities were decreased in Pbsbp1∆-infected RBCs compared to WT-infected RBCs. Subsequent phenotypic analysis indicated that the growth rate of Pbsbp1∆ parasites during the intraerythrocytic stage was significantly slower than that of WT parasites, and their ability to induce cerebral malaria in mice was also attenuated. These findings suggest that PbSBP1 is involved in the remodeling of the erythrocyte membrane skeleton, likely through its direct or indirect interaction with protein 4.1R, thereby regulating the deformability of infected erythrocytes and influencing the pathogenicity of the blood-stage parasites. ConclusionThis study establishes a role for PbSBP1 in host erythrocyte remodeling and parasite virulence, providing new research strategies for the prevention and treatment of malaria.
4.Related research on pathogenic candidate genes for familial blepharophimosis-ptosis-epicanthus inversus syndrome
Xin TAN ; Linan JIAO ; Xianfang PU ; Yunqin LI ; Yue ZOU ; Jianshu KANG
International Eye Science 2026;26(1):142-147
AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.
5.DIA Proteomic Profiling on Staged Regulatory Effect of Tonifying Deficiency and Dredging Collaterals Method on Liver Fibrosis in Rats Based on Theory of "Zhu Ke Jiao"
Xin WANG ; Pengyu ZHU ; Li WEN ; Jibin LIU ; Aochun YUE ; Ziyi CHEN ; Jing ZHANG ; Li ZHU ; Quansheng FENG ; Cen JIANG
Chinese Journal of Experimental Traditional Medical Formulae 2026;32(14):119-132
ObjectiveThis paper aims to investigate the differential mechanisms underlying the staged therapeutic effects of Qijia Rougan formula on liver fibrosis using proteomic technology. MethodsThe staged rat model of liver fibrosis was established by subcutaneous injection of carbon tetrachloride (CCl4) and olive oil. One hundred and four SD rats were randomized into thirteen groups:a normal group,a two-week model group,a four-week model group,a six-week model group,an eight-week model group,a two-week Qijia Rougan formula group,a four-week Qijia Rougan formula group,a six-week Qijia Rougan formula group,an eight-week Qijia Rougan formula group,a two-week compound Biejia Ruangan tablet group,a four-week Compound Biejia Ruangan Tablet group,a six-week Compound Biejia Ruangan Tablet group,and an eight-week compound Biejia Ruangan tablet group. After two weeks of drug intervention,liver tissue and abdominal aortic blood samples were collected from the rats for testing. Hematoxylin-eosin (HE) staining,Masson staining,and Picro Sirius red staining were used to observe pathological damage and collagen fiber deposition in liver tissues. Immunohistochemistry (IHC) was employed to detect the contents of fibrosis markers in liver tissues. The contents of liver function indicators in the serum were measured using a fully automated biochemical analyzer,and the levels of liver fibrosis indicators in the serum were assessed by enzyme-linked immunosorbent assay (ELISA). Liver tissues from the normal group,each model group,and each Qijia Rougan formula group were subjected to label-free quantitative proteomic analysis to identify differential proteins among the groups,with key proteins validated by Western blot. Finally,bioinformatics analysis was performed on the differential proteins. Results(1) The staged rat model of liver fibrosis constructed with CCl4 and olive oil showed pathological results at the 2nd,4th,6th,and 8th weeks of modeling that were consistent with the Metavir standards for the F1,F2,F3,and F4 stages. Compared with those in the normal control group,the protein expressions of α-smooth muscle actin (α-SMA) and Collagen Ⅰ were significantly increased in each stage (P<0.05). The levels of liver function indicators in the serum,including alanine aminotransferase (ALT),aspartate aminotransferase (AST),alkaline phosphatase (ALP),direct bilirubin (DBIL),and total bilirubin (TBil) in each model group,were significantly elevated in each stage (P<0.01). The levels of liver fibrosis indicators in the serum,including procollagen Ⅲ peptide (PⅢP),type Ⅳ collagen(Ⅳ-C),hyaluronic acid (HA),and laminin (LN) in each model group,were significantly increased in each stage (P<0.05,P<0.01). This study successfully established a staged rat model of liver fibrosis. (2) Compared with the model groups at each stage,the administration groups showed a reduction in hepatocyte ballooning degeneration,a more orderly arrangement of hepatocytes,and a decrease of inflammatory cell infiltration. The blue-stained collagen fibers became significantly thinner and finer,with reduced and narrowed fibrous septa. The areas of collagen fibers and Picro Sirius red staining were reduced (P<0.05). The positive areas of α-SMA and Collagen Ⅰ expression were significantly decreased (P<0.05). The levels of ALT,AST,ALP,DBIL,and TBil in the rats of the model groups at each stage were significantly reduced (P<0.05,P<0.01). The levels of PⅢP,Ⅳ-C,HA,and LN in the rats of the model groups at each stage were significantly decreased (P<0.05). Among these,the improvements in all indicators were most significant in the F3 stage (P<0.01).(3) The proteomic results show that a total of 165 differential proteins exhibit a callback trend when comparing the model groups at four stages with the normal group,and when comparing the Qijia Rougan formula group with the model group. Western blot analysis reveals that the levels of NAD(P)H:quinone oxidoreductase 1 (NQO1),mitogen-activated protein kinase 1 (MAPK1),arginase 1 (Arg1),and glutathione S-transferase α1 (GSTA1) were consistent with the proteomic results. Bioinformatics results reveal that 165 differentially expressed proteins are enriched in multiple signaling pathways. Notably,signaling pathways such as drug metabolism-cytochrome P450,arginine biosynthesis,and the peroxisome proliferator-activated receptor (PPAR) signaling pathway were found to be closely associated with liver fibrosis,suggesting that the Qijia Rougan formula may exert its staged regulatory effects on liver fibrosis by regulating these pathways. ConclusionThe Qijia Rougan formula may achieve staged regulation of liver fibrosis by regulating drug metabolism-cytochrome P450,arginine biosynthesis,and the PPAR signaling pathway.
6.Mechanism of mesenchymal stromal cells reversing fibrosis of the uterine endometrium after injury
Shiqi LI ; Yue DANG ; Qingqing ZHOU ; Xin SHANG ; Jiali LIU
Journal of China Pharmaceutical University 2026;57(3):360-368
To investigate the effect of mesenchymal stromal cells (MSCs) on the fibrosis progression and endometrial regeneration in mouse models of endometrial injury, a mouse endometrial injury model was established by physical scraping combined with lipopolysaccharide (LPS) chemical induction, and the endometrium morphology and collagen deposition were evaluated by HE and Masson staining after unilateral administration of MSCs. RT-qPCR and immunofluorescence were used to detect the expression of epithelial markers Epcam and collagen I (Col1). Primary endometrial epithelial cells were isolated to assess p21 expression. Fibrosis-related genes and signaling pathways were validated using transcriptome sequencing and RT-qPCR. The experimental results showed that MSCs increased endometrial thickness and number of glands (P<0.05), up-regulated the expression of Epcam (P<0.01), while significantly reducing uterine collagen fiber deposition (P<0.05) and the expression of p21 in primary epithelial cells (P<0.0001). Transcriptomic analysis revealed that MSCs attenuated collagen deposition by modulating genes involved in the TGF-β signaling pathway. This study elucidates that MSCs facilitate uterine repair by reversing endometrial fibrosis and promoting epithelial regeneration, and their role is related to the regulation of the TGF-β/SMAD pathway and suppression of aberrant collagen accumulation.
7.Heterogeneity of Adipose Tissue From a Single-cell Transcriptomics Perspective
Yong-Lang WANG ; Si-Si CHEN ; Qi-Long LI ; Yu GONG ; Xin-Yue DUAN ; Ye-Hui DUAN ; Qiu-Ping GUO ; Feng-Na LI
Progress in Biochemistry and Biophysics 2025;52(4):820-835
Adipose tissue is a critical energy reservoir in animals and humans, with multifaceted roles in endocrine regulation, immune response, and providing mechanical protection. Based on anatomical location and functional characteristics, adipose tissue can be categorized into distinct types, including white adipose tissue (WAT), brown adipose tissue (BAT), beige adipose tissue, and pink adipose tissue. Traditionally, adipose tissue research has centered on its morphological and functional properties as a whole. However, with the advent of single-cell transcriptomics, a new level of complexity in adipose tissue has been unveiled, showing that even under identical conditions, cells of the same type may exhibit significant variation in morphology, structure, function, and gene expression——phenomena collectively referred to as cellular heterogeneity. Single-cell transcriptomics, including techniques like single-cell RNA sequencing (scRNA-seq) and single-nucleus RNA sequencing (snRNA-seq), enables in-depth analysis of the diversity and heterogeneity of adipocytes at the single-cell level. This high-resolution approach has not only deepened our understanding of adipocyte functionality but also facilitated the discovery of previously unidentified cell types and gene expression patterns that may play key roles in adipose tissue function. This review delves into the latest advances in the application of single-cell transcriptomics in elucidating the heterogeneity and diversity within adipose tissue, highlighting how these findings have redefined the understanding of cell subpopulations within different adipose depots. Moreover, the review explores how single-cell transcriptomic technologies have enabled the study of cellular communication pathways and differentiation trajectories among adipose cell subgroups. By mapping these interactions and differentiation processes, researchers gain insights into how distinct cellular subpopulations coordinate within adipose tissues, which is crucial for maintaining tissue homeostasis and function. Understanding these mechanisms is essential, as dysregulation in adipose cell interactions and differentiation underlies a range of metabolic disorders, including obesity and diabetes mellitus type 2. Furthermore, single-cell transcriptomics holds promising implications for identifying therapeutic targets; by pinpointing specific cell types and gene pathways involved in adipose tissue dysfunction, these technologies pave the way for developing targeted interventions aimed at modulating specific adipose subpopulations. In summary, this review provides a comprehensive analysis of the role of single-cell transcriptomic technologies in uncovering the heterogeneity and functional diversity of adipose tissues.
8.Discriminating Tumor Deposits From Metastatic Lymph Nodes in Rectal Cancer: A Pilot Study Utilizing Dynamic Contrast-Enhanced MRI
Xue-han WU ; Yu-tao QUE ; Xin-yue YANG ; Zi-qiang WEN ; Yu-ru MA ; Zhi-wen ZHANG ; Quan-meng LIU ; Wen-jie FAN ; Li DING ; Yue-jiao LANG ; Yun-zhu WU ; Jian-peng YUAN ; Shen-ping YU ; Yi-yan LIU ; Yan CHEN
Korean Journal of Radiology 2025;26(5):400-410
Objective:
To evaluate the feasibility of dynamic contrast-enhanced MRI (DCE-MRI) in differentiating tumor deposits (TDs) from metastatic lymph nodes (MLNs) in rectal cancer.
Materials and Methods:
A retrospective analysis was conducted on 70 patients with rectal cancer, including 168 lesions (70 TDs and 98 MLNs confirmed by histopathology), who underwent pretreatment MRI and subsequent surgery between March 2019 and December 2022. The morphological characteristics of TDs and MLNs, along with quantitative parameters derived from DCE-MRI (K trans , kep, and v e) and DWI (ADCmin, ADCmax, and ADCmean), were analyzed and compared between the two groups.Multivariable binary logistic regression and receiver operating characteristic (ROC) curve analyses were performed to assess the diagnostic performance of significant individual quantitative parameters and combined parameters in distinguishing TDs from MLNs.
Results:
All morphological features, including size, shape, border, and signal intensity, as well as all DCE-MRI parameters showed significant differences between TDs and MLNs (all P < 0.05). However, ADC values did not demonstrate significant differences (all P > 0.05). Among the single quantitative parameters, v e had the highest diagnostic accuracy, with an area under the ROC curve (AUC) of 0.772 for distinguishing TDs from MLNs. A multivariable logistic regression model incorporating short axis, border, v e, and ADC mean improved diagnostic performance, achieving an AUC of 0.833 (P = 0.027).
Conclusion
The combination of morphological features, DCE-MRI parameters, and ADC values can effectively aid in the preoperative differentiation of TDs from MLNs in rectal cancer.
9.Discriminating Tumor Deposits From Metastatic Lymph Nodes in Rectal Cancer: A Pilot Study Utilizing Dynamic Contrast-Enhanced MRI
Xue-han WU ; Yu-tao QUE ; Xin-yue YANG ; Zi-qiang WEN ; Yu-ru MA ; Zhi-wen ZHANG ; Quan-meng LIU ; Wen-jie FAN ; Li DING ; Yue-jiao LANG ; Yun-zhu WU ; Jian-peng YUAN ; Shen-ping YU ; Yi-yan LIU ; Yan CHEN
Korean Journal of Radiology 2025;26(5):400-410
Objective:
To evaluate the feasibility of dynamic contrast-enhanced MRI (DCE-MRI) in differentiating tumor deposits (TDs) from metastatic lymph nodes (MLNs) in rectal cancer.
Materials and Methods:
A retrospective analysis was conducted on 70 patients with rectal cancer, including 168 lesions (70 TDs and 98 MLNs confirmed by histopathology), who underwent pretreatment MRI and subsequent surgery between March 2019 and December 2022. The morphological characteristics of TDs and MLNs, along with quantitative parameters derived from DCE-MRI (K trans , kep, and v e) and DWI (ADCmin, ADCmax, and ADCmean), were analyzed and compared between the two groups.Multivariable binary logistic regression and receiver operating characteristic (ROC) curve analyses were performed to assess the diagnostic performance of significant individual quantitative parameters and combined parameters in distinguishing TDs from MLNs.
Results:
All morphological features, including size, shape, border, and signal intensity, as well as all DCE-MRI parameters showed significant differences between TDs and MLNs (all P < 0.05). However, ADC values did not demonstrate significant differences (all P > 0.05). Among the single quantitative parameters, v e had the highest diagnostic accuracy, with an area under the ROC curve (AUC) of 0.772 for distinguishing TDs from MLNs. A multivariable logistic regression model incorporating short axis, border, v e, and ADC mean improved diagnostic performance, achieving an AUC of 0.833 (P = 0.027).
Conclusion
The combination of morphological features, DCE-MRI parameters, and ADC values can effectively aid in the preoperative differentiation of TDs from MLNs in rectal cancer.
10.Application of Recombinant Collagen in Biomedicine
Huan HU ; Hong ZHANG ; Jian WANG ; Li-Wen WANG ; Qian LIU ; Ning-Wen CHENG ; Xin-Yue ZHANG ; Yun-Lan LI
Progress in Biochemistry and Biophysics 2025;52(2):395-416
Collagen is a major structural protein in the matrix of animal cells and the most widely distributed and abundant functional protein in mammals. Collagen’s good biocompatibility, biodegradability and biological activity make it a very valuable biomaterial. According to the source of collagen, it can be broadly categorized into two types: one is animal collagen; the other is recombinant collagen. Animal collagen is mainly extracted and purified from animal connective tissues by chemical methods, such as acid, alkali and enzyme methods, etc. Recombinant collagen refers to collagen produced by gene splicing technology, where the amino acid sequence is first designed and improved according to one’s own needs, and the gene sequence of improved recombinant collagen is highly consistent with that of human beings, and then the designed gene sequence is cloned into the appropriate vector, and then transferred to the appropriate expression vector. The designed gene sequence is cloned into a suitable vector, and then transferred to a suitable expression system for full expression, and finally the target protein is obtained by extraction and purification technology. Recombinant collagen has excellent histocompatibility and water solubility, can be directly absorbed by the human body and participate in the construction of collagen, remodeling of the extracellular matrix, cell growth, wound healing and site filling, etc., which has demonstrated significant effects, and has become the focus of the development of modern biomedical materials. This paper firstly elaborates the structure, type, and tissue distribution of human collagen, as well as the associated genetic diseases of different types of collagen, then introduces the specific process of producing animal source collagen and recombinant collagen, explains the advantages of recombinant collagen production method, and then introduces the various systems of expressing recombinant collagen, as well as their advantages and disadvantages, and finally briefly introduces the application of animal collagen, focusing on the use of animal collagen in the development of biopharmaceutical materials. In terms of application, it focuses on the use of animal disease models exploring the application effects of recombinant collagen in wound hemostasis, wound repair, corneal therapy, female pelvic floor dysfunction (FPFD), vaginal atrophy (VA) and vaginal dryness, thin endometritis (TE), chronic endometritis (CE), bone tissue regeneration in vivo, cardiovascular diseases, breast cancer (BC) and anti-aging. The mechanism of action of recombinant collagen in the treatment of FPFD and CE was introduced, and the clinical application and curative effect of recombinant collagen in skin burn, skin wound, dermatitis, acne and menopausal urogenital syndrome (GSM) were summarized. From the exploratory studies and clinical applications, it is evident that recombinant collagen has demonstrated surprising effects in the treatment of all types of diseases, such as reducing inflammation, promoting cell proliferation, migration and adhesion, increasing collagen deposition, and remodeling the extracellular matrix. At the end of the review, the challenges faced by recombinant collagen are summarized: to develop new recombinant collagen types and dosage forms, to explore the mechanism of action of recombinant collagen, and to provide an outlook for the future development and application of recombinant collagen.

Result Analysis
Print
Save
E-mail