AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

ObjectiveThis paper aims to investigate and evaluate the staged efficacy and safety of the representative empirical prescription of the “Zhu Ke Jiao” theory， Qijia Rougan prescription， combined with entecavir in the treatment of hepatic fibrosis in chronic hepatitis B. MethodsA multicenter randomized controlled clinical study was conducted， and 101 patients diagnosed with chronic hepatitis B-related hepatic fibrosis （CHB-HF） who met the diagnosis and inclusion criteria were randomly assigned to an observation group （Qijia Rougan prescription + entecavir） and a control group （entecavir）. The treatment duration was 24 weeks. Liver stiffness measurement （LSM）， fibrosis-4 index （FIB-4）， portal vein diameter， hepatitis B serology， biochemical indicators， hepatic fibrosis markers in serum ［hyaluronic acid （HA）， laminin （LN）， procollagen Ⅲ peptide （PⅢP）， and type Ⅳ collagen （Ⅳ-C）］， and traditional Chinese medicine syndrome scores were used as efficacy evaluation indicators. Efficacy assessments and explorations of different staged subgroups of Qijia Rougan prescription were conducted according to LSM values based on the Metavir pathological staging standard. ResultsA total of 98 cases were included for statistical analysis， with 49 cases in the observation group and 49 in the control group. The general data of the patients in both groups were comparable. Compared with the same group before treatment， the observation group showed a significant reduction in LSM and FIB-4 （P<0.01）， as well as notable improvements in LN， Ⅳ-C， and various TCM syndrome scores （P<0.05， P<0.01）. When compared to the control group after treatment， the observation group demonstrated significant improvements in LSM， FIB-4， and various TCM syndrome score indicators （P<0.05， P<0.01）， indicating that the observation group performed better than the control group. Subgroup analysis of the regression of hepatic fibrosis stages showed that compared to the same group before treatment， the observation group had better improvement in regression of stages F2 and F3 （P<0.05）. When compared to the control group after treatment， the observation group exhibited superior improvement in regression of stage F3 （P<0.05）. No adverse events occurred in either group during the treatment period. ConclusionCompared with entecavir alone， the combination of Qijia Rougan prescription and entecavir significantly improves the degree of hepatic fibrosis and clinical TCM symptoms in patients. The optimal intervention period is primarily during stage F3， which is a potential “interception” point of the “Zhu Ke Jiao” theory.

Collagen is a major structural protein in the matrix of animal cells and the most widely distributed and abundant functional protein in mammals. Collagen’s good biocompatibility, biodegradability and biological activity make it a very valuable biomaterial. According to the source of collagen, it can be broadly categorized into two types: one is animal collagen; the other is recombinant collagen. Animal collagen is mainly extracted and purified from animal connective tissues by chemical methods, such as acid, alkali and enzyme methods, etc. Recombinant collagen refers to collagen produced by gene splicing technology, where the amino acid sequence is first designed and improved according to one’s own needs, and the gene sequence of improved recombinant collagen is highly consistent with that of human beings, and then the designed gene sequence is cloned into the appropriate vector, and then transferred to the appropriate expression vector. The designed gene sequence is cloned into a suitable vector, and then transferred to a suitable expression system for full expression, and finally the target protein is obtained by extraction and purification technology. Recombinant collagen has excellent histocompatibility and water solubility, can be directly absorbed by the human body and participate in the construction of collagen, remodeling of the extracellular matrix, cell growth, wound healing and site filling, etc., which has demonstrated significant effects, and has become the focus of the development of modern biomedical materials. This paper firstly elaborates the structure, type, and tissue distribution of human collagen, as well as the associated genetic diseases of different types of collagen, then introduces the specific process of producing animal source collagen and recombinant collagen, explains the advantages of recombinant collagen production method, and then introduces the various systems of expressing recombinant collagen, as well as their advantages and disadvantages, and finally briefly introduces the application of animal collagen, focusing on the use of animal collagen in the development of biopharmaceutical materials. In terms of application, it focuses on the use of animal disease models exploring the application effects of recombinant collagen in wound hemostasis, wound repair, corneal therapy, female pelvic floor dysfunction (FPFD), vaginal atrophy (VA) and vaginal dryness, thin endometritis (TE), chronic endometritis (CE), bone tissue regeneration in vivo, cardiovascular diseases, breast cancer (BC) and anti-aging. The mechanism of action of recombinant collagen in the treatment of FPFD and CE was introduced, and the clinical application and curative effect of recombinant collagen in skin burn, skin wound, dermatitis, acne and menopausal urogenital syndrome (GSM) were summarized. From the exploratory studies and clinical applications, it is evident that recombinant collagen has demonstrated surprising effects in the treatment of all types of diseases, such as reducing inflammation, promoting cell proliferation, migration and adhesion, increasing collagen deposition, and remodeling the extracellular matrix. At the end of the review, the challenges faced by recombinant collagen are summarized: to develop new recombinant collagen types and dosage forms, to explore the mechanism of action of recombinant collagen, and to provide an outlook for the future development and application of recombinant collagen.

BACKGROUND:Ca2+expression in astrocytes has been found to be closely related to cognitive function,and the Ca2+signaling pathway regulated by inositol 1,4,5-trisphosphate receptors(IP3R2)and ryanodine receptor(RYR)2 receptors has become a hot spot in the study of cognitive disorder-related diseases. OBJECTIVE:To investigate the expression of Ca2+signals mediated by IP3R2 and RYR2 in hippocampal astrocytes in animal models of delayed encephalopathy after acute carbon monoxide poisoning,and to explore the possible pathogenesis of delayed encephalopathy after acute carbon monoxide poisoning. METHODS:C57BL mice with qualified cognitive function were selected by Morris water maze experiment and randomly divided into control group and experimental group.An animal model of delayed encephalopathy after acute carbon monoxide poisoning was established by static carbon monoxide inhalation in the experimental group,and the same amount of air was inhaled in the control group.Behavioral and neuronal changes,astrocyte specific marker glial fibrillary acidic protein,IP3R2,RYR2 receptor and Ca2+concentration in astrocytes of the two groups were detected using Morris water maze,hematoxylin-eosin staining,western blot,immunofluorescence double labeling and Ca2+fluorescence probe at 21 days after modeling. RESULTS AND CONCLUSION:In the Morris water maze,the escape latency of the experimental group was significantly longer than that of the control group(P<0.05).Hematoxylin-eosin staining results showed that in the experimental group,the number of hippocampal pyramidal cells decreased,the cell structure was disordered,and the nucleus was broken and dissolved.Immunofluorescence results showed that IP3R2 and RYR2 were co-expressed with glial fibrillary acidic protein in the hippocampus,and the expressions of IP3R2,RYR2 and glial fibrillary acidic protein were up-regulated in the hippocampus of the experimental group(P<0.05).Western blot analysis showed that the expressions of IP3R2,RYR2,and glial fibrillary acidic protein in the hippocampus of the experimental group were increased(P<0.05).Ca2+concentration in hippocampal astrocytes increased significantly in the experimental group(P<0.05).To conclude,astrocytes may affect Ca2+signals by mediating IP3R2 and RYR2 receptors,then impair the cognitive function of mice with carbon monoxide poisoning,and eventually lead to delayed encephalopathy after acute carbon monoxide poisoning.

The Golgi apparatus (GA) is a key membranous organelle in eukaryotic cells, acting as a central component of the endomembrane system. It plays an irreplaceable role in the processing, sorting, trafficking, and modification of proteins and lipids. Under normal conditions, the GA cooperates with other organelles, including the endoplasmic reticulum (ER), lysosomes, mitochondria, and others, to achieve the precise processing and targeted transport of nearly one-third of intracellular proteins, thereby ensuring normal cellular physiological functions and adaptability to environmental changes. This function relies on Golgi protein quality control (PQC) mechanisms, which recognize and handle misfolded or aberrantly modified proteins by retrograde transport to the ER, proteasomal degradation, or lysosomal clearance, thus preventing the accumulation of toxic proteins. In addition, Golgi-specific autophagy (Golgiphagy), as a selective autophagy mechanism, is also crucial for removing damaged or excess Golgi components and maintaining its structural and functional homeostasis. Under pathological conditions such as oxidative stress and infection, the Golgi apparatus suffers damage and stress, and its homeostatic regulatory network may be disrupted, leading to the accumulation of misfolded proteins, membrane disorganization, and trafficking dysfunction. When the capacity and function of the Golgi fail to meet cellular demands, cells activate a series of adaptive signaling pathways to alleviate Golgi stress and enhance Golgi function. This process reflects the dynamic regulation of Golgi capacity to meet physiological needs. To date, 7 signaling pathways related to the Golgi stress response have been identified in mammalian cells. Although these pathways have different mechanisms, they all help restore Golgi homeostasis and function and are vital for maintaining overall cellular homeostasis. It is noteworthy that the regulation of Golgi homeostasis is closely related to multiple programmed cell death pathways, including apoptosis, ferroptosis, and pyroptosis. Once Golgi function is disrupted, these signaling pathways may induce cell death, ultimately participating in the occurrence and progression of diseases. Studies have shown that Golgi homeostatic imbalance plays an important pathological role in various major diseases. For example, in Alzheimer’s disease (AD) and Parkinson’s disease (PD), Golgi fragmentation and dysfunction aggravate the abnormal processing of amyloid β-protein (Aβ) and Tau protein, promoting neuronal loss and advancing neurodegenerative processes. In cancer, Golgi homeostatic imbalance is closely associated with increased genomic instability, enhanced tumor cell proliferation, migration, invasion, and increased resistance to cell death, which are important factors in tumor initiation and progression. In infectious diseases, pathogens such as viruses and bacteria hijack the Golgi trafficking system to promote their replication while inducing host defensive cell death responses. This process is also a key mechanism in host-pathogen interactions. This review focuses on the role of the Golgi apparatus in cell death and major diseases, systematically summarizing the Golgi stress response, regulatory mechanisms, and the role of Golgi-specific autophagy in maintaining homeostasis. It emphasizes the signaling regulatory role of the Golgi apparatus in apoptosis, ferroptosis, and pyroptosis. By integrating the latest research progress, it further clarifies the pathological significance of Golgi homeostatic disruption in neurodegenerative diseases, cancer, and infectious diseases, and reveals its potential mechanisms in cellular signal regulation.

ObjectiveThis study proposes a novel single-cell protein localization method based on a class perception graph convolutional network (CP-GCN) to overcome several critical challenges in protein microscopic image analysis, including the scarcity of cell-level annotations, inadequate feature extraction, and the difficulty in achieving precise protein localization within individual cells. The methodology involves multiple innovative components designed to enhance both feature extraction and localization accuracy. MethodsFirst, a class perception module (CPM) is developed to effectively capture and distinguish semantic features across different subcellular categories, enabling more discriminative feature representation. Building upon this, the CP-GCN network is designed to explore global features of subcellular proteins in multicellular environments. This network incorporates a category feature-aware module to extract protein semantic features aligned with label dimensions and establishes a subcellular relationship mining module to model correlations between different subcellular structures. By doing so, it generates co-occurrence embedding features that encode spatial and contextual relationships among subcellular locations, thereby improving feature representation. To further refine localization, a multi-scale feature analysis approach is employed using the K-means clustering algorithm, which classifies multi-scale features within each subcellular category and generates multi-cell class activation maps (CAMs). These CAMs highlight discriminative regions associated with specific subcellular locations, facilitating more accurate protein localization. Additionally, a pseudo-label generation strategy is introduced to address the lack of annotated single-cell data. This strategy segments multicellular images into single-cell images and assigns reliable pseudo-labels based on the CAM-predicted regions, ensuring high-quality training data for single-cell analysis. Under a transfer learning framework, the model is trained to achieve precise single-cell-level protein localization, leveraging both the extracted features and pseudo-labels for robust performance. ResultsExperimental validation on multiple single-cell test datasets demonstrates that the proposed method significantly outperforms existing approaches in terms of robustness and localization accuracy. Specifically, on the Kaggle 2021 dataset, the method achieves superior mean average precision (mAP) metrics across 18 subcellular categories, highlighting its effectiveness in diverse protein localization tasks. Visualization of the generated CAM results further confirms the model’s capability to accurately localize subcellular proteins within individual cells, even in complex multicellular environments. ConclusionThe integration of the CP-GCN network with a pseudo-labeling strategy enables the proposed method to effectively capture heterogeneous cellular features in protein images and achieve precise single-cell protein localization. This advancement not only addresses key limitations in current protein image analysis but also provides a scalable and accurate solution for subcellular protein studies, with potential applications in biomedical research and diagnostic imaging. The success of this method underscores the importance of combining advanced deep learning architectures with innovative training strategies to overcome data scarcity and improve localization performance in biological image analysis. Future work could explore the extension of this framework to other types of microscopic imaging and its application in large-scale protein interaction studies.

Extensive studies have identified potential adverse effects on semen quality of obesity, based on body mass index, but the association between body fat distribution, a more relevant indicator for obesity, and semen quality remains less clear. We conducted a longitudinal study of 4304 sperm donors from the Guangdong Provincial Human Sperm Bank (Guangzhou, China) during 2017-2021. A body composition analyzer was used to measure total and local body fat percentage for each participant. Generalized estimating equations were employed to assess the association between body fat percentage and sperm count, motility, and morphology. We estimated that each 10% increase in total body fat percentage (estimated change [95% confidence interval, 95% CI]) was significantly associated with a 0.18 × 10 6 (0.09 × 10 6 -0.27 × 10 6 ) ml and 12.21 × 10 6 (4.52 × 10 6 -19.91 × 10 6 ) reduction in semen volume and total sperm count, respectively. Categorical analyses and exposure-response curves showed that the association of body fat distribution with semen volume and total sperm count was stronger at higher body fat percentages. In addition, the association still held among normal weight and overweight participants. We observed similar associations for upper limb, trunk, and lower limb body fact distributions. In conclusion, we found that a higher body fat distribution was significantly associated with lower semen quality (especially semen volume) even in men with a normal weight. These findings provide useful clues in exploring body fat as a risk factor for semen quality decline and add to evidence for improving semen quality for those who are expected to conceive.
Humans ; Male ; Adult ; Semen Analysis ; China ; Body Fat Distribution ; Longitudinal Studies ; Sperm Count ; Sperm Motility ; Body Mass Index ; Tissue Donors ; Obesity/complications* ; Spermatozoa ; Young Adult ; Middle Aged ; East Asian People

OBJECTIVES: To study the impact of family socioeconomic status on children's reading fluency and the chain mediation effect of family reading environment and children's living and learning styles in this relationship. METHODS: A total of 473 children from grades 2 to 6 in two primary schools in Nanjing were selected through stratified random sampling. The children's reading fluency was assessed, and a questionnaire was used to collect information on family socioeconomic status, family reading environment, and children's living and learning styles. The mediation model was established using the Process macro in SPSS, and the Bootstrap method was employed to test the significance of the mediation effects. RESULTS: Family socioeconomic status, family reading environment, and children's living and learning styles were significantly positively correlated with reading fluency (P<0.001). The family reading environment and children's living and learning styles mediated the relationship between family socioeconomic status and children's reading fluency. Specifically, the independent mediation effect of family reading environment accounted for 11.02% of the total effect, while the independent mediation effect of children's living and learning styles accounted for 10.79%. The chain mediation effect of family reading environment and children's living and learning styles accounted for 7.41% of the total effect. CONCLUSIONS Family socioeconomic status can affect children's reading fluency through three pathways: family reading environment, children's living and learning styles, and the chain mediation effect of family reading environment and children's living and learning styles.
Humans ; Child ; Male ; Female ; Reading ; Learning ; Social Class ; Family

The cyclic GMP-AMP synthase (cGAS)-stimulator of interferon gene (STING) signaling pathway is a crucial component of the immune system. It detects abnormal cytosolic double-stranded DNA and promotes the expression of type I interferons and other inflammatory factors, thereby protecting the body from pathogenic infections. In children, an immature immune system or genetic mutations can lead to immune dysregulation, increasing the risk of autoimmune diseases (AID) and autoinflammatory diseases. Recent studies have shown that aberrant activation of the cGAS-STING signaling pathway is associated with the development of AID and autoinflammatory diseases in children. This review summarizes the research progress on the cGAS-STING signaling pathway in childhood AID and autoinflammatory diseases, aiming to provide new directions for clinical diagnosis and treatment.
Humans ; Nucleotidyltransferases/physiology* ; Membrane Proteins/physiology* ; Signal Transduction/physiology* ; Child ; Autoimmune Diseases/immunology* ; Inflammation/etiology*

OBJECTIVE: To investigate the susceptibility of venetoclax-resistant acute myeloid leukemia (AML) cell lines to ferroptosis and to uncover the underlying molecular mechanisms using transcriptomic and metabolomic analysis methods. METHODS: Venetoclax-resistant AML cell lines were constructed using a low-dose concentration escalation method. The sensitivity of cells to chemotherapeutic drugs was detected by CCK-8 assay. The susceptibility of drug-resistant cell lines to ferroptosis was assessed using transcriptomic and metabolomic analysis methods. The expression of cellular GPX4 and SLC7A11 protein was detected by Western blot, and cell death and lipid peroxidation levels were measured by flow cytometry. Depmap database and TCGA cohort were applied to explore the effect of ferroptosis-related genes expression on prognosis. RESULTS: Venetoclax-resistant cell lines exhibited sensitivity to ferroptosis inducers RSL3, APR246, and sorafenib. The ferroptosis inhibitor Fer-1 partially inhibited cell death induced by these inducers. Compared with the parental cells, significant changes in metabolites and gene expression levels related to ferroptosis were observed in the resistant cell lines. In particular, deregulated expression of SLC7A11 and GPX4 may play critical role in ferroptosis susceptibility. Besides, GPX4 was identified as more important for AML cell survival and higher GPX4 expression may predict shortened overall survival, NPM1 mutant and IDH1 R132 mutation positive patients may prone to possess higher GPX4 expression. CONCLUSION Venetoclax-resistant AML cell lines remain susceptible to ferroptosis, higher GPX4 expression maybe a critical marker for poor prognosis. Regulating the expression of ferroptosis-related genes and metabolites may enhance the efficacy of venetoclax and provide new treatment options for AML patients.
Humans ; Ferroptosis ; Leukemia, Myeloid, Acute/metabolism* ; Sulfonamides/pharmacology* ; Bridged Bicyclo Compounds, Heterocyclic/pharmacology* ; Drug Resistance, Neoplasm ; Metabolomics ; Cell Line, Tumor ; Phospholipid Hydroperoxide Glutathione Peroxidase ; Amino Acid Transport System y+/metabolism* ; Transcriptome