ObjectiveThis paper aims to investigate and evaluate the staged efficacy and safety of the representative empirical prescription of the “Zhu Ke Jiao” theory， Qijia Rougan prescription， combined with entecavir in the treatment of hepatic fibrosis in chronic hepatitis B. MethodsA multicenter randomized controlled clinical study was conducted， and 101 patients diagnosed with chronic hepatitis B-related hepatic fibrosis （CHB-HF） who met the diagnosis and inclusion criteria were randomly assigned to an observation group （Qijia Rougan prescription + entecavir） and a control group （entecavir）. The treatment duration was 24 weeks. Liver stiffness measurement （LSM）， fibrosis-4 index （FIB-4）， portal vein diameter， hepatitis B serology， biochemical indicators， hepatic fibrosis markers in serum ［hyaluronic acid （HA）， laminin （LN）， procollagen Ⅲ peptide （PⅢP）， and type Ⅳ collagen （Ⅳ-C）］， and traditional Chinese medicine syndrome scores were used as efficacy evaluation indicators. Efficacy assessments and explorations of different staged subgroups of Qijia Rougan prescription were conducted according to LSM values based on the Metavir pathological staging standard. ResultsA total of 98 cases were included for statistical analysis， with 49 cases in the observation group and 49 in the control group. The general data of the patients in both groups were comparable. Compared with the same group before treatment， the observation group showed a significant reduction in LSM and FIB-4 （P<0.01）， as well as notable improvements in LN， Ⅳ-C， and various TCM syndrome scores （P<0.05， P<0.01）. When compared to the control group after treatment， the observation group demonstrated significant improvements in LSM， FIB-4， and various TCM syndrome score indicators （P<0.05， P<0.01）， indicating that the observation group performed better than the control group. Subgroup analysis of the regression of hepatic fibrosis stages showed that compared to the same group before treatment， the observation group had better improvement in regression of stages F2 and F3 （P<0.05）. When compared to the control group after treatment， the observation group exhibited superior improvement in regression of stage F3 （P<0.05）. No adverse events occurred in either group during the treatment period. ConclusionCompared with entecavir alone， the combination of Qijia Rougan prescription and entecavir significantly improves the degree of hepatic fibrosis and clinical TCM symptoms in patients. The optimal intervention period is primarily during stage F3， which is a potential “interception” point of the “Zhu Ke Jiao” theory.

AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

Since its emergence in the 1980s, the human immunodeficiency virus (HIV) has caused a global pandemic, posing a severe threat to human life and health as well as social development. Although pre-exposure prophylaxis (PrEP) effectively curbs HIV transmission and antiretroviral therapy (ART) significantly extends the lifespan of patients, vaccines remain a pivotal tool for blocking transmission and ending the pandemic. The high genetic variability of HIV-1, the glycan shield of its envelope glycoproteins, and the long-term persistence of latent reservoirs have repeatedly led to bottlenecks in traditional vaccine strategies. In recent years, mRNA technology has offered a novel approach to addressing these challenges, leveraging advantages such as sequence programmability, short production cycles, native conformational expression of antigens, and self-adjuvant effects. In recent years, mRNA vaccine technology has emerged as a transformative solution to longstanding vaccinology challenges, characterized by its sequence programmability, rapid production cycles, native conformational antigen expression, and intrinsic self-adjuvanting properties. Unlike traditional platforms reliant on pathogen culture or recombinant proteins, mRNA vaccines can be expeditiously designed and updated based solely on viral genomic sequences. Lipid nanoparticle (LNP)-encapsulated mRNA facilitates endogenous antigen expression and presentation, simultaneously eliciting potent humoral and cellular immune responses. Within this landscape, self-amplifying mRNA (saRNA) further extends in vivo antigen expression to enhance the persistence of immune responses. Moreover, the LNP delivery system not only protects mRNA from degradation and mediates endosomal escape but also synergizes with mRNA to optimize immune activation via self-adjuvant effects. Importantly, mRNA platforms circumvent the pre-existing immunity associated with viral vectors and the genomic integration risks of DNA vaccines, positioning them as a cornerstone for global pandemic preparedness. This review systematically delineates recent advances in mRNA technology for HIV-1 vaccine development, focusing on four pivotal research frontiers. First, mRNA innovations building upon the RV144 trial optimize antigens through codon modification and multivalent designs to induce more durable and broad-spectrum immunity. Second, particulate mRNA vaccine strategies, utilizing virus-like particles (VLPs) and ferritin nanoparticles, achieve in situ antigen self-assembly, significantly enhancing B cell activation and reducing infection risks in non-human primate models. Third, germline-targeting mRNA vaccines address the low-affinity barrier of broadly neutralizing antibody (bNAp) precursors, efficiently activating rare precursor B cells and promoting affinity maturation. Fourth, therapeutic mRNA vaccines offer unique advantages for an HIV functional cure; combining immunogens with mRNA-encoded adjuvants potentiates cellular immunity, while LNP-mediated “shock-and-kill” strategies specifically activate latent reservoirs to guide immune clearance. Comparative analyses with traditional platforms reveal that mRNA technology redefines antigen production and presentation, simulating chronic infection through sustained expression and enabling dual-pathway presentation via endogenous synthesis. Furthermore, we explore the mechanistic innovations of mRNA vaccines in inducing bNAps: sustained in vivo production prolongs the activation window for precursor B cells and maintains germinal center (GC) reactions; endogenously expressed antigens adopt native conformations to expose conserved epitopes; and self-adjuvanting effects modulate the functions of antigen-presenting cells (APCs) and follicular helper T cells (Tfh), driving somatic hypermutation and affinity maturation. We also address critical clinical translation challenges, including immune durability, adaptability to special populations, and large-scale LNP manufacturing, while proposing targeted optimization strategies. In conclusion, this review establishes a theoretical framework for utilizing mRNA technology to overcome HIV-1 immune escape, transitioning from a descriptive paradigm to a problem-solving-based synthesis of evidence. By integrating preclinical and early clinical data, we bridge the gap between basic design and translational verification. mRNA technology is poised to become a central pillar inHIV-1 prevention and therapy, providing a robust toolset to achieve the global goal of ending the AIDS pandemic and offering a blueprint for vaccine development against other recalcitrant infectious diseases.

ObjectiveThe malaria parasites remodel the host erythrocyte structure by exporting parasite proteins that interact with the membrane skeleton proteins of red blood cells (RBCs), facilitating their intracellular survival and pathogenicity. Skeleton-binding protein 1 (SBP1) is a conserved exported protein across Plasmodium species. In Plasmodium falciparum, SBP1 has been reported to interact with erythrocyte membrane skeleton proteins 4.1R and spectrin, while its contribution to erythrocyte remodeling and parasite virulence in Plasmodium berghei (Pb) remains unclear. This study aims to determine whether PbSBP1 associates with the host cytoskeletal protein 4.1R and to investigate its role in the remodeling of host RBCs and the pathogenicity of Plasmodium berghei. MethodsIn Plasmodium berghei, the relationship between PbSBP1 and the erythrocyte cytoskeletal protein 4.1R was examined using co-immunoprecipitation. A Pbsbp1 gene knockout mutant of Plasmodium berghei (Pbsbp1∆) was generated based on the principle of double crossover homologous recombination. The deformability of erythrocytes infected with Pbsbp1∆ parasites was assessed using microfluidic methods. Microchannels with an array of cylindrical pillars were used to detect modifications in infected RBC deformability. The infected RBCs were squashed between the rows and recovered between the columns and the transit velocity (μm/s) of infected RBCs travelling through the microchannel was recorded. The component of the erythrocyte membrane skeleton junctional complex, tropomodulin (TMOD), was fluorescently labeled, and the cytoskeletal network of infected erythrocytes was imaged using super-resolution stochastic optical reconstruction microscopy (STORM) to analyze ultrastructural changes in the cytoskeleton of wild-type (WT) and Pbsbp1∆-infected erythrocytes. Actin-based junctional complexes were displayed as individual clusters by the labeled TMOD in the STORM images, and the cluster densities and distances between adjacent clusters of infected RBCs were calculated. Additionally, rodent malaria models (BALB/c mice) and experimental cerebral malaria models (C57BL/6 mice) were employed to monitor the growth of Pbsbp1∆ and WT parasites during the intraerythrocytic stage and their capacity to induce cerebral malaria in mice. ResultsPbSBP1 may participate in the remodeling of infected erythrocytes through direct or indirect interaction with the erythrocyte cytoskeletal protein 4.1R. Microfluidic assays revealed that the deformability of erythrocytes infected with Pbsbp1∆ parasites was significantly enhanced compared to those infected with WT parasites. STORM imaging further demonstrated that the ultrastructure of the erythrocyte cytoskeleton in Pbsbp1∆-infected cells was altered relative to that in WT-infected erythrocytes. The distances between nearest neighbors of clusters had a tendency to increase while the cluster densities were decreased in Pbsbp1∆-infected RBCs compared to WT-infected RBCs. Subsequent phenotypic analysis indicated that the growth rate of Pbsbp1∆ parasites during the intraerythrocytic stage was significantly slower than that of WT parasites, and their ability to induce cerebral malaria in mice was also attenuated. These findings suggest that PbSBP1 is involved in the remodeling of the erythrocyte membrane skeleton, likely through its direct or indirect interaction with protein 4.1R, thereby regulating the deformability of infected erythrocytes and influencing the pathogenicity of the blood-stage parasites. ConclusionThis study establishes a role for PbSBP1 in host erythrocyte remodeling and parasite virulence, providing new research strategies for the prevention and treatment of malaria.

Hepatocellular carcinoma (HCC) is a lethal cancer with high morbidity rates worldwide. It is a major threat to public health in China, due to the combination of known and new risk factors, such as endemic hepatitis B virus (HBV), dietary aflatoxin exposure, and the occurrence of metabolic dysfunction-associated steatotic liver disease (MASLD). Although many methods for surveillance and multimodal therapies, such as surgery, local ablation, transarterial therapy, and new systemic agents, have been available, the survival rates of HCC remains poor. They have very limited durable responses, long post-treatment recurrence rates, and high resistance to treatment. This reflects an imperfect picture of the biological cause of the disease and a need for new mechanistic or targeted techniques. A significant characteristic of HCC, in common with other aggressive cancers, is the presence of reprogrammed, hyperactive cell metabolism. Tumor cells hijack metabolic pathways to promote their uncontrolled growth, stress survival, invasion and metastasis. While classical mechanisms such as the Warburg effect, lipid metabolism and glutamine utilization have been understood, the lysosome, which was once viewed as a static “waste disposal unit” to remove old organelles and proteins, is instead a dynamic signaling and metabolic core. The lysosomes incorporate nutrients, energy and stress signals by master regulators such as mTORC1 (activated on its surface) that balance anabolic growth and catabolic recycling to the cellular demands. In HCC, lysosomes are not passive, but are highly active and dysregulated. HCC cells upregulate lysosomes, which scavenge intracellular components via enhanced autophagy and engulf extracellular proteins via macropinocytosis, crucial for survival in the nutrient-poor, hypoxic tumor microenvironment. In addition to metabolism, lysosomes exhibit pro-invasive functions by secreting hydrolases to remodel the extracellular matrix, promote angiogenesis, and suppress stromal immune cells to foster a pro-tumor microenvironment. In a clinical context, lysosomes play an important role in therapeutic resistance: they sequester and inactivate chemotherapeutics via lysosomal sequestration, and enhanced autophagic flux protects the cell from therapy-induced damage, contributing to relapse, as lysosomal dysfunction is a key cause of treatment failure. This makes lysosomes promising yet challenging therapeutic targets in HCC. Recent preclinical and early clinical studies investigate multiple strategies to exploit the susceptibility of lysosomes: lysosome-specific agents, alkalinizing the lysosome lumen or inducing membrane permeabilization and lysosome-dependent cell death; pharmacological inhibition of key lysosomal enzymes or autophagy to impair nutrient recycling and stress adaptation; smart nanotherapeutic agents or antibody-drug conjugates, specifically activated in the acidic lysosomal environment or utilizing lysosomal pathways for efficient intracellular drug release; and combination strategies of lysosome-targeting agents with tyrosine kinase inhibitors or immunotherapy to overcome resistance and achieve synergistic antitumor effects. In summary, our review systematically presents the role of lysosomes in HCC, from metabolic reprogramming and microenvironmental adaptation to therapeutic resistance. By synthesizing the latest mechanistic insights and preclinical advances, this review highlights the indispensable role of lysosomes in the complex HCC biological network, emphasizing that an in-depth understanding of this dynamic organelle holds great promise for developing innovative, targeted therapies, offering new hope for improving the poor prognosis of global HCC patients.

Objective: To evaluate the feasibility of dynamic contrast-enhanced MRI (DCE-MRI) in differentiating tumor deposits (TDs) from metastatic lymph nodes (MLNs) in rectal cancer. Materials and Methods: A retrospective analysis was conducted on 70 patients with rectal cancer, including 168 lesions (70 TDs and 98 MLNs confirmed by histopathology), who underwent pretreatment MRI and subsequent surgery between March 2019 and December 2022. The morphological characteristics of TDs and MLNs, along with quantitative parameters derived from DCE-MRI (K trans , kep, and v e) and DWI (ADCmin, ADCmax, and ADCmean), were analyzed and compared between the two groups.Multivariable binary logistic regression and receiver operating characteristic (ROC) curve analyses were performed to assess the diagnostic performance of significant individual quantitative parameters and combined parameters in distinguishing TDs from MLNs. Results: All morphological features, including size, shape, border, and signal intensity, as well as all DCE-MRI parameters showed significant differences between TDs and MLNs (all P < 0.05). However, ADC values did not demonstrate significant differences (all P > 0.05). Among the single quantitative parameters, v e had the highest diagnostic accuracy, with an area under the ROC curve (AUC) of 0.772 for distinguishing TDs from MLNs. A multivariable logistic regression model incorporating short axis, border, v e, and ADC mean improved diagnostic performance, achieving an AUC of 0.833 (P = 0.027). Conclusion The combination of morphological features, DCE-MRI parameters, and ADC values can effectively aid in the preoperative differentiation of TDs from MLNs in rectal cancer.

ObjectiveTo investigate the processing technology of calcined Haematitum based on the concept of quality by design（QbD） and to assess its health risk. MethodsTaking whole iron content， Fe²⁺ dissolution content and looseness as critical quality attributes（CQAs）， and calcination temperature， calcination time， spreading thickness and particle size as critical process parameters（CPPs） determined by the failure mode and effect analysis（FMEA）， the processing technology of calcined Haematitum was optimized by orthogonal test combined with analytic hierarchy process-criteria importance through intercriteria correlation（AHP-CRITIC） hybrid weighting method. The contents of heavy metals and harmful elements were determined by inductively coupled plasma mass spectrometry， and the health risk assessment was carried out by daily exposure（EXP）， target hazard quotient（THQ） and lifetime cancer risk（LCR）， and the theoretical value of the maximum limit was deduced. ResultsThe optimal processing technology for calcined Haematitum was calcination at 650 ℃， calcination time of 1 h， particle size of 0.2-0.5 cm， spreading thickness of 1 cm， and vinegar quenching for 1 time［Haematitum-vinegar（10：3）］. The contents of 5 heavy metals and harmful elements in 13 batches of calcined Haematitum were all decreased with reductions of up to 5-fold. The cumulative THQ of 2 batches of samples was>1， while the cumulative THQ of all batches of Haematitum was>1. The LCR of As in 1 batches of Haematitum was 1×10^-6-1×10^-4， and the LCR of the rest was<1×10^-6， and the LCRs of calcined Haematitum were all<1×10^-6， indicating that the carcinogenic risk of calcined Haematitum was low， but special attention should still be paid to Haematitum medicinal materials. Preliminary theoretical values of the maximum limits of Cu， As， Cd， Pb and Hg were formulated as 1 014， 25， 17， 27， 7 mg·kg^-1. ConclusionThe optimized processing technology of calcined Haematitum is stable and feasible， and the contents of heavy metals and harmful elements are reduced after processing. Preliminary theoretical values of the maximum limits of Cu， As， Cd， Pb and Hg are formulated to provide a scientific basis for the formulation of standards for the limits of harmful elements in Haematitum.

ObjectiveBased on the concept of quality by design（QbD）， the processing process of calcined Pyritum was optimized， and its X-ray diffraction（XRD） fingerprint was established. MethodsThe safety， effectiveness and quality controllability of calcined Pyritum were taken as the quality profile（QTPP）， the color， hardness， metallic luster， phase composition， the contents of heavy metals and hazardous elements were taken as the critical quality attributes（CQAs）， and the calcination temperature， calcination time， paving thickness and particle size were determined as the critical process parameters（CPPs）. Differential thermal analysis， X-ray diffraction（XRD） and inductively coupled plasma mass spectrometry（ICP-MS） were used to analyze the correlation between the calcination temperature and CQAs of calcined Pyritum. Then， based on the criteria importance through intercriteria correlation（CRITIC）-entropy weight method， the optimal processing process of calcined Pyritum was optimized by orthogonal test. Powder XRD was used to analyze the phase of calcined Pyritum samples processed according to the best process， and the mean and median maps of calcined Pyritum were established by the superposition of geometric topological figures， and similarity evaluation and cluster analysis were carried out. ResultsThe results of single factor experiments showed that the physical phase of Pyritum changed from FeS₂ to Fe₇S₈ during the process of temperature increase， the color gradually deepened from dark yellow， and the contents of heavy metals and harmful elements decreased. The optimized processing process of calcined Pyritum was as follows：calcination temperature at 750 ℃， calcination time of 2.5 h， paving thickness of 3 cm， particle size of 0.8-1.2 cm， vinegar quenching 1 time［Pyritum-vinegar（10∶3）］. After calcination， the internal structure of Pyritum was honeycomb-shaped， which was conducive to the dissolution of active ingredients. XRD fingerprints of 13 batches of calcined Pyritum characterized by 10 common peaks were established. The similarities of the relative peak intensities of the XRD fingerprints of the analyzed samples were>0.96， and it could effectively distinguish the raw products and unqualified products. ConclusionTemperature is the main factor affecting the quality of calcined Pyritum. After processing， the dissolution of the effective components in Pyritum increases， and the contents of heavy metals and harmful substances decrease， reflecting the function of processing to increase efficiency and reduce toxicity. The optimized processing process is stable and feasible， and the established XRD fingerprint can be used as one of the quality control standards of calcined Pyritum.

ObjectiveTo investigate the processing technology of calcined Haematitum based on the concept of quality by design（QbD） and to assess its health risk. MethodsTaking whole iron content， Fe²⁺ dissolution content and looseness as critical quality attributes（CQAs）， and calcination temperature， calcination time， spreading thickness and particle size as critical process parameters（CPPs） determined by the failure mode and effect analysis（FMEA）， the processing technology of calcined Haematitum was optimized by orthogonal test combined with analytic hierarchy process-criteria importance through intercriteria correlation（AHP-CRITIC） hybrid weighting method. The contents of heavy metals and harmful elements were determined by inductively coupled plasma mass spectrometry， and the health risk assessment was carried out by daily exposure（EXP）， target hazard quotient（THQ） and lifetime cancer risk（LCR）， and the theoretical value of the maximum limit was deduced. ResultsThe optimal processing technology for calcined Haematitum was calcination at 650 ℃， calcination time of 1 h， particle size of 0.2-0.5 cm， spreading thickness of 1 cm， and vinegar quenching for 1 time［Haematitum-vinegar（10：3）］. The contents of 5 heavy metals and harmful elements in 13 batches of calcined Haematitum were all decreased with reductions of up to 5-fold. The cumulative THQ of 2 batches of samples was>1， while the cumulative THQ of all batches of Haematitum was>1. The LCR of As in 1 batches of Haematitum was 1×10^-6-1×10^-4， and the LCR of the rest was<1×10^-6， and the LCRs of calcined Haematitum were all<1×10^-6， indicating that the carcinogenic risk of calcined Haematitum was low， but special attention should still be paid to Haematitum medicinal materials. Preliminary theoretical values of the maximum limits of Cu， As， Cd， Pb and Hg were formulated as 1 014， 25， 17， 27， 7 mg·kg^-1. ConclusionThe optimized processing technology of calcined Haematitum is stable and feasible， and the contents of heavy metals and harmful elements are reduced after processing. Preliminary theoretical values of the maximum limits of Cu， As， Cd， Pb and Hg are formulated to provide a scientific basis for the formulation of standards for the limits of harmful elements in Haematitum.

ObjectiveBased on the concept of quality by design（QbD）， the processing process of calcined Pyritum was optimized， and its X-ray diffraction（XRD） fingerprint was established. MethodsThe safety， effectiveness and quality controllability of calcined Pyritum were taken as the quality profile（QTPP）， the color， hardness， metallic luster， phase composition， the contents of heavy metals and hazardous elements were taken as the critical quality attributes（CQAs）， and the calcination temperature， calcination time， paving thickness and particle size were determined as the critical process parameters（CPPs）. Differential thermal analysis， X-ray diffraction（XRD） and inductively coupled plasma mass spectrometry（ICP-MS） were used to analyze the correlation between the calcination temperature and CQAs of calcined Pyritum. Then， based on the criteria importance through intercriteria correlation（CRITIC）-entropy weight method， the optimal processing process of calcined Pyritum was optimized by orthogonal test. Powder XRD was used to analyze the phase of calcined Pyritum samples processed according to the best process， and the mean and median maps of calcined Pyritum were established by the superposition of geometric topological figures， and similarity evaluation and cluster analysis were carried out. ResultsThe results of single factor experiments showed that the physical phase of Pyritum changed from FeS₂ to Fe₇S₈ during the process of temperature increase， the color gradually deepened from dark yellow， and the contents of heavy metals and harmful elements decreased. The optimized processing process of calcined Pyritum was as follows：calcination temperature at 750 ℃， calcination time of 2.5 h， paving thickness of 3 cm， particle size of 0.8-1.2 cm， vinegar quenching 1 time［Pyritum-vinegar（10∶3）］. After calcination， the internal structure of Pyritum was honeycomb-shaped， which was conducive to the dissolution of active ingredients. XRD fingerprints of 13 batches of calcined Pyritum characterized by 10 common peaks were established. The similarities of the relative peak intensities of the XRD fingerprints of the analyzed samples were>0.96， and it could effectively distinguish the raw products and unqualified products. ConclusionTemperature is the main factor affecting the quality of calcined Pyritum. After processing， the dissolution of the effective components in Pyritum increases， and the contents of heavy metals and harmful substances decrease， reflecting the function of processing to increase efficiency and reduce toxicity. The optimized processing process is stable and feasible， and the established XRD fingerprint can be used as one of the quality control standards of calcined Pyritum.