1.Related research on pathogenic candidate genes for familial blepharophimosis-ptosis-epicanthus inversus syndrome
Xin TAN ; Linan JIAO ; Xianfang PU ; Yunqin LI ; Yue ZOU ; Jianshu KANG
International Eye Science 2026;26(1):142-147
AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.
2.Discussion on Modern Development of Traditional Chinese Medicine Diagnosis Based on Artificial Intelligence
Kun LIAN ; Xueqin WANG ; Duoting TAN ; Weijun LI ; Lin LI ; Xin LI ; Zhixi HU
Chinese Journal of Experimental Traditional Medical Formulae 2026;32(9):336-346
Traditional Chinese medicine (TCM) diagnostics is a discipline that studies the basic theories and fundamental skills of diagnostic methods, disease diagnosis, and differentiation in accordance with the theories of TCM. The artificial intelligence (AI) technology has gained remarkable achievements in the intelligentization of the four diagnostic methods in TCM and the standardization of differentiation and diagnosis. However, it still faces many challenges. The standardization of clinical data collection is difficult, and the data quality is uneven, which affects the usability of the data. The integration of the four diagnostic information is insufficient. Most instruments can only collect data from a single diagnostic method, lacking overall integrity. The scientific nature of the diagnostic model needs to be improved. The existing models lack dynamics and the reasoning logic of TCM differentiation. The accuracy of intelligent methods needs to be improved, and the existing evaluation indicators cannot fully reflect the practical application effect of the model. Furthermore, the relevant laws and regulations are still not perfect, and data security and patient privacy lack guarantees. The cultivation of compound talents is insufficient, and there is a lack of interdisciplinary talents who are proficient in both TCM and AI. On this basis, this paper expounded on the current development status, difficulties, and bottlenecks of AI in TCM diagnosis and then explored the development trend of AI in the field of TCM diagnosis. It proposed solutions such as optimizing the data collection process, constructing multimodal diagnostic models, facilitating multi-disciplinary exchanges and cooperation, improving laws and regulations, and cultivating compound talents. It is hoped that modern, standardized, normalized, and intelligent TCM diagnosis can be further promoted, thereby providing new impetus and methods for the inheritance and innovation of TCM.
3.Construction and clinical application exploration of an artificial intelligence-based high-quality lung cancer surgery dataset
Xuhua HUANG ; Yunfeng NIE ; Liang SHEN ; Pengxu KONG ; Xin TAN ; Zihao LI ; Wang LV ; Min ZHOU ; Xudong LV ; Jian HU
Chinese Journal of Clinical Thoracic and Cardiovascular Surgery 2026;33(05):717-727
Objective To construct a lung cancer surgery-oriented disease-specific database covering the entire perioperative care pathway, thereby improving the quality and usability of key surgical data elements. Methods Real-world clinical data were extracted from a single-center thoracic surgery department. A standardized data model was established based on the open electronic health record (openEHR) standard. Large language model (LLM), optical character recognition (OCR), and artificial intelligence (AI)-driven techniques were employed to extract, structure, and perform quality control on unstructured clinical narratives, imaging reports, and radiological data, with a focus on capturing surgically relevant perioperative indicator. Results A multimodal database comprising 19 917 patients was established, including 7 930 males and 11 987 females, with ages ranging from 15 to 97 (61.7±9.7) years. The database includes 582 structured data variables, textual report data corresponding to 69 clinical indicators, 13 000 pulmonary function test PDF reports, and chest CT imaging data from 16 884 patients. This database comprehensively covers major information relevant to surgical diagnosis and treatment of lung cancer, significantly improving the completeness and granularity of surgical detail data. Large language models (LLMs) and optical character recognition (OCR) technologies enhanced the efficiency of converting unstructured data into structured formats, while a multi-level manual verification process ensured data accuracy and traceability. The database supports real-world research including comparisons of surgical procedures, prediction of postoperative complications, prognosis assessment, and multimodal data association analyses.
4.Rectal Administration of Leek and Konjac-derived Extracellular Vesicles Alleviates High-fat Diet-induced Obesity in Mice via Gut Microbiota Modulation
Ya-Ru ZHANG ; Yu-Jia WU ; Cheng-Bang LIANG ; Xin-He YU ; Yan MU ; Yan TAN
Progress in Biochemistry and Biophysics 2026;53(5):1224-1239
ObjectiveObesity, a global chronic metabolic disease, is closely associated with disruptions in lipid metabolism and gut microbiota. Current intervention strategies still have limitations in terms of safety and microecological regulation, necessitating the exploration of novel natural regulatory approaches. Based on the early pathological characteristics of obesity, this study innovatively employs a rectal delivery method alongside a high-fat diet (HFD)-induced obesity model to systematically evaluate the inhibitory effects, safety, and gut microbiota regulation mechanisms of leek-derived and konjac-derived extracellular vesicles on obesity development. By simulating early clinical intervention scenarios, this study aims to explore the preventive potential of plant-derived extracellular vesicles during the initial stages of obesity onset. MethodsExtracellular vesicles from leek and konjac were isolated using ultracentrifugation combined with density gradient centrifugation. Their nanoscale properties were characterized by dynamic light scattering (DLS), transmission electron microscopy (TEM), and nanoparticle tracking analysis (NTA). Male C57BL/6J mice were randomly divided into four groups: normal control (NC), high-fat diet (HFD), leek-derived extracellular vesicles (LEVs), and konjac-derived extracellular vesicles (KEVs). Beginning simultaneously with HFD feeding, mice in the intervention groups received 20 g/L vesicles rectally every 3 d for 4 weeks. Body mass and body composition were monitored throughout. At endpoint, mouse serum, adipose tissue, and colonic contents were collected. Serum biochemical indices (lipid profile, liver and kidney function, cardiac markers) were assessed to evaluate safety and metabolic efficacy, while 16S rRNA sequencing was employed to analyze gut microbial structure and diversity. ResultsDLS, NTA, and TEM confirmed that both LEVs and KEVs exhibited typical cup-shaped nanostructures with average particle sizes of approximately 284 nm and 223 nm, respectively. LEVs and KEVs treatment significantly suppressed HFD-induced weight gain and elevation of body-fat percentage (P<0.05), and reduced accumulation of abdominal white and epididymal adipose tissue. Serological analyses showed that both vesicles lowered total cholesterol, triglycerides and LDL-cholesterol, and ameliorated liver enzyme profiles (ALT, AST), demonstrating lipid-metabolic regulation and hepatoprotective effects. No hepatic, renal or cardiac dysfunction was observed, indicating favorable safety. Gut microbiota analyses revealed that vesicle intervention partially restored HFD-depleted microbial diversity and reshaped community structure. Notably, LEVs markedly increased the relative abundance of the beneficial taxon Lachnospiraceae at the family level, which is known for producing short-chain fatty acids and enhancing intestinal barrier function. Furthermore, Phylogenetic Investigation of Communities by Reconstruction of Unobserved States (PICRUSt) functional prediction suggested that LEVs and KEVs modulated gut microbial functions through distinct mechanisms: LEVs downregulated pathways related to ribosomes and DNA replication while enhancing xenobiotic degradation, whereas KEVs tended to upregulate energy metabolism and protein synthesis toward healthy levels. ConclusionRectally administered LEVs and KEVs exhibit excellent safety and pronounced metabolic benefits during the early phase of obesity, suppressing weight gain, correcting lipid dysregulation, and exerting effects via modulation of gut microbial composition and function. This study provides systematic experimental evidence supporting plant-derived exosome-like vesicles as an early intervention strategy against obesity.
5.Rectal Administration of Leek and Konjac-derived Extracellular Vesicles Alleviates High-fat Diet-induced Obesity in Mice via Gut Microbiota Modulation
Ya-Ru ZHANG ; Yu-Jia WU ; Cheng-Bang LIANG ; Xin-He YU ; Yan MU ; Yan TAN
Progress in Biochemistry and Biophysics 2026;53(5):1224-1239
ObjectiveObesity, a global chronic metabolic disease, is closely associated with disruptions in lipid metabolism and gut microbiota. Current intervention strategies still have limitations in terms of safety and microecological regulation, necessitating the exploration of novel natural regulatory approaches. Based on the early pathological characteristics of obesity, this study innovatively employs a rectal delivery method alongside a high-fat diet (HFD)-induced obesity model to systematically evaluate the inhibitory effects, safety, and gut microbiota regulation mechanisms of leek-derived and konjac-derived extracellular vesicles on obesity development. By simulating early clinical intervention scenarios, this study aims to explore the preventive potential of plant-derived extracellular vesicles during the initial stages of obesity onset. MethodsExtracellular vesicles from leek and konjac were isolated using ultracentrifugation combined with density gradient centrifugation. Their nanoscale properties were characterized by dynamic light scattering (DLS), transmission electron microscopy (TEM), and nanoparticle tracking analysis (NTA). Male C57BL/6J mice were randomly divided into four groups: normal control (NC), high-fat diet (HFD), leek-derived extracellular vesicles (LEVs), and konjac-derived extracellular vesicles (KEVs). Beginning simultaneously with HFD feeding, mice in the intervention groups received 20 g/L vesicles rectally every 3 d for 4 weeks. Body mass and body composition were monitored throughout. At endpoint, mouse serum, adipose tissue, and colonic contents were collected. Serum biochemical indices (lipid profile, liver and kidney function, cardiac markers) were assessed to evaluate safety and metabolic efficacy, while 16S rRNA sequencing was employed to analyze gut microbial structure and diversity. ResultsDLS, NTA, and TEM confirmed that both LEVs and KEVs exhibited typical cup-shaped nanostructures with average particle sizes of approximately 284 nm and 223 nm, respectively. LEVs and KEVs treatment significantly suppressed HFD-induced weight gain and elevation of body-fat percentage (P<0.05), and reduced accumulation of abdominal white and epididymal adipose tissue. Serological analyses showed that both vesicles lowered total cholesterol, triglycerides and LDL-cholesterol, and ameliorated liver enzyme profiles (ALT, AST), demonstrating lipid-metabolic regulation and hepatoprotective effects. No hepatic, renal or cardiac dysfunction was observed, indicating favorable safety. Gut microbiota analyses revealed that vesicle intervention partially restored HFD-depleted microbial diversity and reshaped community structure. Notably, LEVs markedly increased the relative abundance of the beneficial taxon Lachnospiraceae at the family level, which is known for producing short-chain fatty acids and enhancing intestinal barrier function. Furthermore, Phylogenetic Investigation of Communities by Reconstruction of Unobserved States (PICRUSt) functional prediction suggested that LEVs and KEVs modulated gut microbial functions through distinct mechanisms: LEVs downregulated pathways related to ribosomes and DNA replication while enhancing xenobiotic degradation, whereas KEVs tended to upregulate energy metabolism and protein synthesis toward healthy levels. ConclusionRectally administered LEVs and KEVs exhibit excellent safety and pronounced metabolic benefits during the early phase of obesity, suppressing weight gain, correcting lipid dysregulation, and exerting effects via modulation of gut microbial composition and function. This study provides systematic experimental evidence supporting plant-derived exosome-like vesicles as an early intervention strategy against obesity.
6.Research progress on typical work-related diseases
Xuemei TAN ; Yingying FENG ; Tangfei GUAN ; Yuqin YAO ; Xin SUN ; Juan LIAO ; Yajia LAN ; Qin ZHANG
Journal of Environmental and Occupational Medicine 2026;43(1):108-115
Work serves as a critical means of obtaining resources, facilitating personal growth, realizing self-worth, and engaging in social interactions. However, work-related diseases pose significant threats to workers’ health and productivity, and impose considerable economic burdens. This article categorized work-related diseases into six major types, including musculoskeletal disorders, mental and behavioral disorders, cardiovascular and metabolic diseases, digestive system diseases, reproductive system diseases, and non-specific respiratory diseases, and summarized their risk factors, assessment methods, policy regulation, and prevention and control measures. Current research in this field predominantly relies on cross-sectional studies, which present limitations in causal inference and potential risks of bias. Future studies should expand sample sizes, optimize research designs, and establish multidimensional evaluation systems to comprehensively assess the health and economic impacts of work-related diseases. It is recommended to enhance the translation of research findings into practice, thereby providing a scientific basis for the occupational health protection system and promoting the well-being and sustainable development of the working population.
7.Prevalence of impostor phenomenon and burnout in a Singapore health system.
Jun Hui TAN ; Ke Xin EH ; Zheng Jye LING
Singapore medical journal 2025;66(10):540-544
INTRODUCTION:
Impostor phenomenon (IP) is a set of feelings encountered by individuals of being incompetent, despite experiencing successes. IP affects not only individuals on a personal level, but also organisations where the leadership diversity decreases due to employees' self-doubt. We aim to investigate the prevalence of IP and burnout among employees in the National University Health System (NUHS).
METHODS:
All permanently employed full-time NUHS employees aged 21 years and above were invited to participate in this self-administered cross-sectional study between April 2021 and August 2021. Mass emails with the embedded study link were sent every 2-3 weeks to the employees' corporate email accounts.
RESULTS:
In our study, 61% of our study respondents reported having IP experiences and 97% reported having burnout. The associations of IP with ethnicity and age group were significant. Post hoc tests, however, showed that the association was statistically significant only in the 21-29 years age group.
CONCLUSION
We found that there was no statistical significance between gender and the Maslach Burnout Inventory (MBI) profile types. However, we found that IP was significantly associated with individuals in the 21-29 years age group. This could be because younger individuals who just entered workforce may feel uncomfortable with their newfound independence and responsibility. Workplace support, such as workshops, and emotional support were found to be useful in helping individuals cope with IP. Future studies could be done post coronavirus disease 2019 (COVID-19) pandemic among healthcare workers to have a larger sample size to determine true IP and burnout prevalence.
Humans
;
Singapore/epidemiology*
;
Adult
;
Male
;
Female
;
Burnout, Professional/psychology*
;
Cross-Sectional Studies
;
Prevalence
;
Middle Aged
;
Young Adult
;
Surveys and Questionnaires
;
COVID-19/epidemiology*
;
Workplace/psychology*
8.Awareness and attitudes of elderly Southeast Asian adults towards telehealth during the COVID-19 pandemic: a qualitative study.
Ryan Eyn Kidd MAN ; Aricia Xin Yi HO ; Ester Pei Xuan LEE ; Eva Katie Diana FENWICK ; Amudha ARAVINDHAN ; Kam Chun HO ; Gavin Siew Wei TAN ; Daniel Shu Wei TING ; Tien Yin WONG ; Khung Keong YEO ; Su-Yen GOH ; Preeti GUPTA ; Ecosse Luc LAMOUREUX
Singapore medical journal 2025;66(5):256-264
INTRODUCTION:
We aimed to understand the awareness and attitudes of elderly Southeast Asians towards telehealth services during the coronavirus disease 2019 (COVID-19) pandemic in this study.
METHODS:
In this qualitative study, 78 individuals from Singapore (51.3% female, mean age 73.0 ± 7.6 years) were interviewed via telephone between 13 May 2020 and 9 June 2020 during Singapore's first COVID-19 'circuit breaker'. Participants were asked to describe their understanding of telehealth, their experience of and willingness to utilise these services, and the barriers and facilitators underlying their decision. Transcripts were analysed using thematic analysis, guided by the United Theory of Acceptance Use of Technology framework.
RESULTS:
Of the 78 participants, 24 (30.8%) were able to describe the range of telehealth services available and 15 (19.2%) had previously utilised these services. Conversely, 14 (17.9%) participants thought that telehealth comprised solely home medication delivery and 50 (51.3%) participants did not know about telehealth. Despite the advantages offered by telehealth services, participants preferred in-person consultations due to a perceived lack of human interaction and accuracy of diagnoses, poor digital literacy and a lack of access to telehealth-capable devices.
CONCLUSION
Our results showed poor overall awareness of the range of telehealth services available among elderly Asian individuals, with many harbouring erroneous views regarding their use. These data suggest that public health education campaigns are needed to improve awareness of and correct negative perceptions towards telehealth services in elderly Asians.
Humans
;
COVID-19/epidemiology*
;
Female
;
Telemedicine
;
Aged
;
Male
;
Singapore/epidemiology*
;
Qualitative Research
;
Health Knowledge, Attitudes, Practice
;
SARS-CoV-2
;
Aged, 80 and over
;
Middle Aged
;
Pandemics
;
Awareness
;
Asian People
;
Southeast Asian People
9.Building an artificial intelligence and digital ecosystem: a smart hospital's data-driven path to healthcare excellence.
Weien CHOW ; Narayan VENKATARAMAN ; Hong Choon OH ; Sandhiya RAMANATHAN ; Srinath SRIDHARAN ; Sulaiman Mohamed ARISH ; Kok Cheong WONG ; Karen Kai Xin HAY ; Jong Fong HOO ; Wan Har Lydia TAN ; Charlene Jin Yee LIEW
Singapore medical journal 2025;66(Suppl 1):S75-S83
Hospitals worldwide recognise the importance of data and digital transformation in healthcare. We traced a smart hospital's data-driven journey to build an artificial intelligence and digital ecosystem (AIDE) to achieve healthcare excellence. We measured the impact of data and digital transformation on patient care and hospital operations, identifying key success factors, challenges, and opportunities. The use of data analytics and data science, robotic process automation, AI, cloud computing, Medical Internet of Things and robotics were stand-out areas for a hospital's data-driven journey. In the future, the adoption of a robust AI governance framework, enterprise risk management system, AI assurance and AI literacy are critical for success. Hospitals must adopt a digital-ready, digital-first strategy to build a thriving healthcare system and innovate care for tomorrow.
Artificial Intelligence
;
Humans
;
Delivery of Health Care
;
Hospitals
;
Cloud Computing
;
Robotics
;
Internet of Things
;
Data Science

Result Analysis
Print
Save
E-mail