1.Related research on pathogenic candidate genes for familial blepharophimosis-ptosis-epicanthus inversus syndrome
Xin TAN ; Linan JIAO ; Xianfang PU ; Yunqin LI ; Yue ZOU ; Jianshu KANG
International Eye Science 2026;26(1):142-147
AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.
2.Awareness of knowledge about hepatitis C prevention and control among outpatients in Ningbo City
TAN Shiwen ; SHI Hongbo ; JIANG Haibo ; CHU Kun ; YE Zehao ; YANG Jianhui ; ZHOU Xin
Journal of Preventive Medicine 2025;37(2):192-196
Objective:
To investigate the awareness of knowledge about hepatitis C prevention and control among outpatients in Ningbo City, Zhejiang Province, and its influencing factors, so as to provide the evidence for strengthening health education on hepatitis C prevention and control.
Methods:
Based on sentinel surveillance of hepatitis C, the outpatients aged 15 to 65 years at seven hospitals in Yinzhou District, Cixi City and Xiangshan County of Ningbo City were selected using the convenient sampling method from April to June during 2020 and 2022. Demographic information, knowledge and behaviors related to hepatitis C prevention and control were collected through questionnaire surveys. The influencing factors for knowledge about hepatitis C prevention and control were analyzed using a multivariable logistic regression model.
Results:
A total of 2 792 participants were surveyed, including 1 157 males (41.44%) and 1 635 females (58.56%). The awareness rate of knowledge about hepatitis C prevention and control was 56.23%, and was lower in knowledge about hepatitis C vaccine and treatment. The awareness rates of knowledge about hepatitis C prevention and control among outpatients from 2020 to 2022 were 47.11%, 53.22% and 70.65%, respectively, showing an upward trend (P<0.05). Multivariable logistic regression analysis showed that participants aged 25 to <50 years (OR=1.358, 95%CI: 1.073-1.719), with an educational level of high school or junior college (OR=1.431, 95%CI: 1.134-1.806) or above junior college (OR=3.728, 95%CI: 2.958-4.699), with household monthly income per capita of 3 000 to <5 000 yuan (OR=1.828, 95%CI: 1.344-2.486) or ≥5 000 yuan (OR=1.858, 95%CI: 1.366-2.526), without a history of invasive treatments such as pedicure in public places (OR=1.287, 95%CI: 1.024-1.618), without a history of contact with family members' blood-contaminated items (OR=2.050, 95%CI: 1.552-2.707), and always using condoms during sexual contacts (OR=1.740, 95%CI: 1.273-2.378) had higher awareness of knowledge about hepatitis C prevention and control.
Conclusions
The awareness of knowledge about hepatitis C vaccine and treatment among outpatients in Ningbo City needs to be improved. Age, educational level, household monthly income per capita, history of invasive treatments such as pedicure in public places, history of contact with family members' blood-contaminated items and frequency of condom use during sexual contacts are associated with outpatients' awareness of knowledge about hepatitis C prevention and control.
3.Application of shape memory alloys in assistive devices and rehabilitation equipment
Xin TAN ; Hongyue ZHANG ; Yuchan ZHAO ; Chun QIN ; Shuogui XU
Chinese Journal of Tissue Engineering Research 2025;29(10):2113-2123
BACKGROUND:With the continuous progress of science and technology,the introduction of new technologies and methods will bring more possibilities and new breakthroughs for the application of shape memory alloys in the fields of assistive and rehabilitation. OBJECTIVE:To review the application status of shape memory alloys in assistive and rehabilitation equipment,discuss their main methods,techniques and results,summarize and put forward suggestions,hoping that shape memory alloys can be continuously optimized and bring more new changes for the development of assistive and rehabilitation equipment. METHODS:WanFang,PubMed,and Web of Science databases were searched by computer."Shape memory alloys,application progress,orthodontics,orthopedic,prosthesis,rehabilitation,properties,implantation,mechanical properties,nickel-titanium memory alloys,actuation"were used as Chinese search terms."Shape memory alloys,application,orthodontics,orthopedic,prosthetics,rehabilitation,properties,implant,drive,progress,prostheses"were used as English search terms.Finally,91 articles were included for review. RESULTS AND CONCLUSION:(1)Shape memory alloy has the characteristics of corrosion resistance,wear resistance,biocompatibility,fatigue resistance,kink resistance and other properties.Compared with other traditional materials(stainless steel,titanium alloy,cobalt-chromium alloy,etc.),shape memory alloy has lower elastic modulus and no biological toxicity,which is suitable for long-term implantation as an implant prosthesis.Due to its shape memory effect and excellent mechanical properties,it is mainly used as a driving element or as a bridge connecting the device and the human body in artificial limbs,orthoses and rehabilitation equipment.(2)The use of shape memory alloy drive elements can reduce the weight of the device,eliminate noise,easy to operate,easy to carry,better assist joint movement;compared with the use of pneumatic,hydraulic,and electrical drive methods of the device,it has obvious advantages.(3)In addition,shape memory alloy can produce permanent and stable stress during deformation.Compared with stainless steel,titanium alloy and aluminum alloy,shape memory alloy has a higher material recovery rate and does not need to be replaced and adjusted frequently,so it is more practical in the correction of deformity.(4)At present,shape memory alloy is most commonly used in orthosis,and the best clinical application effect is in stapes prosthesis.However,due to the limitations of technology and cost,shape memory alloys are rarely used in artificial limbs and rehabilitation equipment,and there is a lack of large sample size studies on the application effect.(5)Although shape memory alloys have been developed in the field of auxiliary and rehabilitation,there are still many problems:it is difficult to accurately control the shape memory alloys;the cooling speed of shape memory alloy is slow;the deformation speed of shape memory alloy cannot be controlled;there is a lack of comparative research and expert consensus on shape memory alloys with different properties;shape memory alloys are costly and expensive.(6)In the future,attention should be paid to the development of new shape memory alloys,increase comparative research,and use new technologies and methods(such as 4D printing)to solve the existing problems,so as to develop high-performance assistive devices and rehabilitation equipment.
4.Chemical constituents of bulbs of Narcissus tazetta var. chinensis.
Ling-Xia XU ; Xin-Xin HUANG ; Ji-Cheng SHU ; Ting TAN ; Yun LUO
China Journal of Chinese Materia Medica 2025;50(9):2404-2410
The 95% ethanol extract from bulbs of Narcissus tazetta var. chinensis(BNTC) was eluted with 30%, 60%, and pure methanol on D-101 macroporous resin. The elution fractions were isolated and purified by silica gel column chromatography, thin layer chromatography, D-101 macroporous resin, semi-preparative high performance liquid chromatography(HPLC), and HPLC. The purified compounds were identified using one-dimensional and two-dimensional spectroscopy, high-resolution mass spectrometry, and other techniques. A total of 15 compounds were isolated and identified as 5-(4-hydroxy-3-methoxyphenyl)-3-(4-hydroxyphenyl)-N-methyl-3,6-dihydropyridine-2(1H)-one(1), 3,5-di(hydroxyphenyl)-N-methyl-3,6-dihydropyridine-2(1H)-one(2), protocatechualdehyde(3), protocatechuic acid(4), 3,4-dihydroxyacetophenone(5), syringic acid(6), vanillic acid(7), p-hydroxybenzoic acid(8),(2S)-4'-hydroxy-7-methoxyflavan(9), 2,4,6-trimethoxyacetophenone(10), N-trans-ferulic acid p-hydroxyphenylethylamine(11), N-cis-p-coumaroyltyramine(12), N-trans-p-coumaroyltyramine(13), piscidic acid(14), 5-hydroxymethylfurfural(15). Compounds 1 and 2 are new compounds with similar structure that have not been reported yet, named narcissus A and narcissus B. Compounds 8-13 were isolated and identified from the genus Narcissus for the first time, and compounds 14 and 15 were isolated from BNTC for the first time. Compounds 1 and 2 inhibited the release of NO from RAW264.7 cells induced by lipopolysaccharide(LPS)(P<0.001), with compound 1 having an IC_(50) value of(72.76±2.97) μmol·L~(-1) and compound 2 having an IC_(50) value of(63.59±0.96) μmol·L~(-1).
Mice
;
Animals
;
Narcissus/chemistry*
;
Drugs, Chinese Herbal/isolation & purification*
;
Plant Roots/chemistry*
;
Chromatography, High Pressure Liquid
;
Macrophages/immunology*
;
RAW 264.7 Cells
5.Deciphering the significant impact of natural glycosylation on human insulin.
Yaohao LI ; Wenqiang LIU ; Dan LIU ; Ruihan WANG ; Yajing ZHANG ; Xin LI ; Jinyuan GONG ; Shiying SHANG ; Zhongping TAN
Acta Pharmaceutica Sinica B 2025;15(11):5880-5890
In the century-long evolution of insulin pharmaceuticals, each transformative advancement in this drug class has been closely tied to the ability to obtain new insulin isoforms for research. Despite this, the recently discovered naturally occurring isoforms of glycosylated human insulin have remained largely unattainable for proper characterization. Herein, we demonstrate for the first time that total chemical synthesis can be used to generate all isoforms. This achievement required maintaining the correct positions of the interchain disulfide bonds while effectively removing protecting groups on complex glycans. Notably, the availability of seven glycoforms reveals the important effects of natural sialylated glycans in suppressing insulin self-association and enhancing its solubility, surpassing the performance of currently employed rapid-acting insulin drugs. This work not only offers a readily adaptable platform for exploring natural O-glycosylation in other therapeutic proteins and peptides but also lays the groundwork for further research into harnessing natural glycosylation for therapeutic applications.
6.Polygonatum Sibiricum Polysaccharides Improve Colonic Injury in a Mouse Model of Chronic Obstructive Pulmonary Disease by Regulating Bile Acid Metabolism in the Colon
Wanrong LI ; Mengting TAO ; Yuanfeng ZOU ; Dan HE ; Nengyuan TANG ; Xin TAN ; Lixia LI ; Dandan CHEN
Journal of Sun Yat-sen University(Medical Sciences) 2025;46(3):431-443
ObjectiveTo investigate the effect and mechanism of Polygonatum neutral polysaccharides from sibiricum (PSP-NP) on colon injury in mice with chronic obstructive pulmonary disease (COPD). MethodsMale C57BL/6J mice were randomly divided into a control group, a COPD model group, and a PSP-NP group. The COPD model was established using smoke exposure combined with intranasal LPS administration. The PSP-NP group was simultaneously treated daily with 200 mg/kg of PSP-NP via intragastric gavage, while the other groups received an equal volume of saline. HE staining was used to observe the pathological changes in the colon. ELISA was employed to detect the levels of LPS in serum and the expressions of ZO-1, Occludin, IL-6, and TNF-α in colon tissue. UPLC-MS was used to detect the types and contents of bile acids in colonic content, and to screen for differential bile acids. Differential microbial flora were identified using 16S rRNA gene sequencing, and correlation analysis was conducted with differential bile acids. PSP-NP was combined with the differential bile acids cholic acid (CA), and deoxycholic acid (DCA) in vitro to analyze the binding capacity of PSP-NP for CA and DCA. PSP-NP was applied to NCM460 normal colonic epithelial cells cultured in CA and DCA. Cell migration ability was assessed using the scratch assay, and the mRNA expression levels of inflammatory cytokines TNF-α, IL-6, and NF-κB were measured by RT-qPCR. ResultsPSP-NP effectively improved colonic damage in COPD model mice, enhanced mechanical barrier function, alleviated inflammatory response, and regulated abnormal changes in colonic flora and bile acid metabolism. Correlation analysis further revealed that PSP-NP regulated colonic bile acid metabolism and reduced the redundancy of secondary bile acids by increasing the relative abundance of Bacteroidota, Verrucomicrobiota, Bacteroides, and Akkermansia, while decreasing the relative abundance of Lactobacillus and Bifidobacterium. Notably, in vitro binding assays demonstrated that PSP-NP bound to differential bile acids DCA and CA, with the strongest binding capacity for DCA at 58.2%. In cellular functional studies, DCA inhibited the migration ability of colonic epithelial cells NCM460 and significantly increased the relative mRNA expression levels of inflammatory factors TNF-α, IL-6, and NF-κB. Importantly, co-treatment with PSP-NP significantly ameliorated the impact of DCA on NCM460 cells. ConclusionsPSP-NP may significantly improve colonic damage in COPD model mice. The mechanism may involve the regulation of colonic bile acid metabolism and bile acid profiles through both microbial modulation and direct binding, thereby reducing the damage caused by secondary bile acids such as DCA to colonic epithelial cells.
7.Prevalence of impostor phenomenon and burnout in a Singapore health system.
Jun Hui TAN ; Ke Xin EH ; Zheng Jye LING
Singapore medical journal 2025;66(10):540-544
INTRODUCTION:
Impostor phenomenon (IP) is a set of feelings encountered by individuals of being incompetent, despite experiencing successes. IP affects not only individuals on a personal level, but also organisations where the leadership diversity decreases due to employees' self-doubt. We aim to investigate the prevalence of IP and burnout among employees in the National University Health System (NUHS).
METHODS:
All permanently employed full-time NUHS employees aged 21 years and above were invited to participate in this self-administered cross-sectional study between April 2021 and August 2021. Mass emails with the embedded study link were sent every 2-3 weeks to the employees' corporate email accounts.
RESULTS:
In our study, 61% of our study respondents reported having IP experiences and 97% reported having burnout. The associations of IP with ethnicity and age group were significant. Post hoc tests, however, showed that the association was statistically significant only in the 21-29 years age group.
CONCLUSION
We found that there was no statistical significance between gender and the Maslach Burnout Inventory (MBI) profile types. However, we found that IP was significantly associated with individuals in the 21-29 years age group. This could be because younger individuals who just entered workforce may feel uncomfortable with their newfound independence and responsibility. Workplace support, such as workshops, and emotional support were found to be useful in helping individuals cope with IP. Future studies could be done post coronavirus disease 2019 (COVID-19) pandemic among healthcare workers to have a larger sample size to determine true IP and burnout prevalence.
Humans
;
Singapore/epidemiology*
;
Adult
;
Male
;
Female
;
Burnout, Professional/psychology*
;
Cross-Sectional Studies
;
Prevalence
;
Middle Aged
;
Young Adult
;
Surveys and Questionnaires
;
COVID-19/epidemiology*
;
Workplace/psychology*
8.Awareness and attitudes of elderly Southeast Asian adults towards telehealth during the COVID-19 pandemic: a qualitative study.
Ryan Eyn Kidd MAN ; Aricia Xin Yi HO ; Ester Pei Xuan LEE ; Eva Katie Diana FENWICK ; Amudha ARAVINDHAN ; Kam Chun HO ; Gavin Siew Wei TAN ; Daniel Shu Wei TING ; Tien Yin WONG ; Khung Keong YEO ; Su-Yen GOH ; Preeti GUPTA ; Ecosse Luc LAMOUREUX
Singapore medical journal 2025;66(5):256-264
INTRODUCTION:
We aimed to understand the awareness and attitudes of elderly Southeast Asians towards telehealth services during the coronavirus disease 2019 (COVID-19) pandemic in this study.
METHODS:
In this qualitative study, 78 individuals from Singapore (51.3% female, mean age 73.0 ± 7.6 years) were interviewed via telephone between 13 May 2020 and 9 June 2020 during Singapore's first COVID-19 'circuit breaker'. Participants were asked to describe their understanding of telehealth, their experience of and willingness to utilise these services, and the barriers and facilitators underlying their decision. Transcripts were analysed using thematic analysis, guided by the United Theory of Acceptance Use of Technology framework.
RESULTS:
Of the 78 participants, 24 (30.8%) were able to describe the range of telehealth services available and 15 (19.2%) had previously utilised these services. Conversely, 14 (17.9%) participants thought that telehealth comprised solely home medication delivery and 50 (51.3%) participants did not know about telehealth. Despite the advantages offered by telehealth services, participants preferred in-person consultations due to a perceived lack of human interaction and accuracy of diagnoses, poor digital literacy and a lack of access to telehealth-capable devices.
CONCLUSION
Our results showed poor overall awareness of the range of telehealth services available among elderly Asian individuals, with many harbouring erroneous views regarding their use. These data suggest that public health education campaigns are needed to improve awareness of and correct negative perceptions towards telehealth services in elderly Asians.
Humans
;
COVID-19/epidemiology*
;
Female
;
Telemedicine
;
Aged
;
Male
;
Singapore/epidemiology*
;
Qualitative Research
;
Health Knowledge, Attitudes, Practice
;
SARS-CoV-2
;
Aged, 80 and over
;
Middle Aged
;
Pandemics
;
Awareness
;
Asian People
;
Southeast Asian People
9.Building an artificial intelligence and digital ecosystem: a smart hospital's data-driven path to healthcare excellence.
Weien CHOW ; Narayan VENKATARAMAN ; Hong Choon OH ; Sandhiya RAMANATHAN ; Srinath SRIDHARAN ; Sulaiman Mohamed ARISH ; Kok Cheong WONG ; Karen Kai Xin HAY ; Jong Fong HOO ; Wan Har Lydia TAN ; Charlene Jin Yee LIEW
Singapore medical journal 2025;66(Suppl 1):S75-S83
Hospitals worldwide recognise the importance of data and digital transformation in healthcare. We traced a smart hospital's data-driven journey to build an artificial intelligence and digital ecosystem (AIDE) to achieve healthcare excellence. We measured the impact of data and digital transformation on patient care and hospital operations, identifying key success factors, challenges, and opportunities. The use of data analytics and data science, robotic process automation, AI, cloud computing, Medical Internet of Things and robotics were stand-out areas for a hospital's data-driven journey. In the future, the adoption of a robust AI governance framework, enterprise risk management system, AI assurance and AI literacy are critical for success. Hospitals must adopt a digital-ready, digital-first strategy to build a thriving healthcare system and innovate care for tomorrow.
Artificial Intelligence
;
Humans
;
Delivery of Health Care
;
Hospitals
;
Cloud Computing
;
Robotics
;
Internet of Things
;
Data Science


Result Analysis
Print
Save
E-mail