AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

This study aims to investigate the potential effect of the water extract of fresh Rehmanniae Radix on hypercholesterolemia in mice that was induced by a high-fat and high-cholesterol diet and explore its possible mechanism from bile acid reabsorption. Male C57BL/6 mice were randomly assigned into the following groups: control, model, low-and high-dose(4 and 8 g·kg~(-1), respectively) fresh Rehmanniae Radix, and positive drug(simvastatin, 0.05 g·kg~(-1)). Other groups except the control group were fed with a high-fat and high-cholesterol diet for 6 consecutive weeks to induce hypercholesterolemia. From the 6th week, mice were administrated with corresponding drugs daily via gavage for additional 6 weeks, while continuing to be fed with a high-fat and high-cholesterol diet. Serum levels of total cholesterol(TC), triglycerides(TG), low density lipoprotein-cholesterol(LDL-c), high density lipoprotein-cholesterol(HDL-c), and total bile acid(TBA), as well as liver TC and TG levels and fecal TBA level, were determined by commercial assay kits. Hematoxylin-eosin(HE) staining, oil red O staining, and transmission electron microscopy were performed to observe the pathological changes in the liver. Three livers samples were randomly selected from each of the control, model, and high-dose fresh Rehmanniae Radix groups for high-throughput transcriptome sequencing. Differentially expressed genes were mined and KEGG pathway enrichment analysis was performed to predict the key pathways and target genes of the water extract of fresh Rehmanniae Radix in the treatment of hypercholesterolemia. RT-qPCR was employed to measure the mRNA levels of cholesterol 7α-hydroxylase(CYP7A1) and cholesterol 27α-hydroxylase(CYP27A1) in the liver. Western blot was employed to determine the protein levels of CYP7A1 and CYP27A1 in the liver as well as farnesoid X receptor(FXR), apical sodium-dependent bile acid transporter(ASBT), and ileum bile acid-binding protein(I-BABP) in the ileum. The results showed that the water extract of fresh Rehmanniae Radix significantly lowered the levels of TC and TG in the serum and liver, as well as the level of LDL-c in the serum. Conversely, it elevated the level of HDL-c in the serum and TBA in feces. No significant difference was observed in the level of TBA in the serum among groups. HE staining, oil red O staining, and transmission electron microscopy showed that the water extract reduced the accumulation of lipid droplets in the liver. Further mechanism studies revealed that the water extract of fresh Rehmanniae Radix significantly down-regulated the protein levels of FXR and bile acid reabsorption-related proteins ASBT and I-BABP. Additionally, it enhanced CYP7A1 and CYP27A1, the key enzymes involved in bile acid synthesis. Therefore, it is hypothesized that the water extract of fresh Rehmanniae Radix may exert an anti-hypercholesterolemic effect by regulating FXR/ASBT/I-BABP signaling, inhibiting bile acid reabsorption, and increasing bile acid excretion, thus facilitating the conversion of cholesterol to bile acids.
Animals ; Male ; Bile Acids and Salts/metabolism* ; Mice, Inbred C57BL ; Mice ; Diet, High-Fat/adverse effects* ; Cholesterol/metabolism* ; Drugs, Chinese Herbal/administration & dosage* ; Hypercholesterolemia/genetics* ; Receptors, Cytoplasmic and Nuclear/genetics* ; Rehmannia/chemistry* ; Liver/drug effects* ; Humans ; Cholesterol 7-alpha-Hydroxylase/genetics* ; Plant Extracts

This study aimed to investigate the effects of caffeoylquinic acids from Erigeron breviscapus(EBCQA) on cognitive impairment and mitochondrial dysfunction in Alzheimer's disease(AD), and to explore its underlying mechanisms. The impacts of EBCQA on paralysis, β-amyloid(Aβ) oligomerization, and mRNA expression of mitophagy-related genes [PTEN-induced putative kinase 1(PINK1) homolog-encoding gene pink-1, Parkin homolog-encoding gene pdr-1, Bcl-2 interacting coiled-coil protein 1(Beclin 1) homolog-encoding gene bec-1, microtubule-associated protein 1 light chain 3(LC3) homolog-encoding gene lgg-1, autophagic adapter protein 62(p62) homolog-encoding gene sqst-1] were examined in the AD Caenorhabditis elegans CL4176 model, along with mitochondrial functions including adenosine triphosphate(ATP) content, enzyme activities of mitochondrial respiratory chain complexes Ⅰ,Ⅲ, and Ⅳ, and mitochondrial membrane potential. Additionally, the effects of EBCQA on the green fluorescent protein(GFP)/red fluorescent protein from Discosoma sp.(DsRed) ratio, the expression of phosphatidylethanolamine-modified and GFP-labeled LGG-1(PE-GFP::LGG-1)/GFP-labeled LGG-1(GFP::LGG-1), and GFP-labeled SQST-1(GFP::SQST-1) proteins were investigated in transgenic C. elegans strains. The effect of EBCQA on paralysis was further evaluated after RNA interference(RNAi)-mediated suppression of the pink-1 and pdr-1 genes in CL4176 strain. An AD rat model was established through intraperitoneal injection of D-galactose and intragastric administration of aluminum trichloride. The effects of β-nicotinamide mononucleotide(NMN) and EBCQA on learning and memory ability, neuronal morphology, mitophagy occurrence, mitophagy-related protein expression(PINK1, Parkin, Beclin 1, LC3-Ⅱ/LC3-Ⅰ, p62), and mitochondrial functions(ATP content; enzyme activities of mitochondrial respiratory chain complexes Ⅰ, Ⅲ, and Ⅳ; mitochondrial membrane potential) were investigated in this AD rat model. The results showed that EBCQA delayed paralysis onset in the CL4176 strain, reduced Aβ oligomer formation, and upregulated the mRNA expression levels of lgg-1, bec-1, pink-1, and pdr-1, while downregulating sqst-1 mRNA expression. EBCQA also enhanced ATP content, mitochondrial membrane potential, and the activities of mitochondrial respiratory chain complexes Ⅰ, Ⅲ, and Ⅳ. Furthermore, EBCQA improved the PE-GFP::LGG-1/GFP::LGG-1 ratio, reduced GFP::SQST-1 expression, and decreased the GFP/DsRed ratio. Notably, the ability of EBCQA to delay paralysis was significantly reduced following RNAi-mediated suppression of pink-1 and pdr-1 in CL4176 strain. In AD rats, the administration of NMN or EBCQA significantly improved learning and memory, restored neuronal morphology in the hippocampus, increased autophagosome numbers, and upregulated the expression of PINK1, Parkin, Beclin 1, and the LC3-Ⅱ/LC3-Ⅰ ratio, while reducing p62 expression. Additionally, the treatment with NMN or EBCQA both elevated ATP content, mitochondrial respiratory chain complex Ⅰ, Ⅲ, and Ⅳ activities, and mitochondrial membrane potential in the hippocampus. The above findings indicate that EBCQA improves cognitive impairment and mitochondrial dysfunction in AD, possibly through activation of PINK1/Parkin-mediated mitophagy.
Animals ; Alzheimer Disease/psychology* ; Mitophagy/drug effects* ; Mitochondria/genetics* ; Caenorhabditis elegans/metabolism* ; Ubiquitin-Protein Ligases/genetics* ; Cognitive Dysfunction/physiopathology* ; Rats ; Protein Kinases/genetics* ; Humans ; Male ; Disease Models, Animal ; Caenorhabditis elegans Proteins/genetics* ; Drugs, Chinese Herbal/administration & dosage*

The precise and rapid monitoring of multiple organ dysfunction is crucial in drug discovery. Traditional methods, such as pathological analysis, are often time-consuming and inefficient. Here, we developed a multiplexed near-infrared window two (NIR-II) fluorescent bioimaging method that allows for real-time, rapid, and quantitative assessment of multiple organ dysfunctions. Given that existing probes did not fully meet requirements, we synthesized a range of NIR-II hemicyanine dyes (HDs) with varying absorption and emission wavelengths. By modifying these dyes, we achieved high spatial and temporal resolution imaging of the liver, kidneys, stomach, and intestines. This method was further applied to investigate disorders induced by cisplatin, a drug known to cause gastric emptying issues along with liver and kidney injuries. By monitoring the metabolic rate of the dyes in these organs, we accurately quantified multi-organ dysfunction, which was also confirmed by gold-standard pathological analysis. Additionally, we evaluated the effects of five aristolochic acids (AAs) on multiple organ dysfunction. For the first time, we identified that AA-I and AA-II could cause gastric emptying disorders, which was further validated through transcriptomics analysis. Our study introduces a novel approach for the simultaneous monitoring of multi-organ dysfunction, which may significantly enhance the evaluation of drug side effects.

Most patients with differentiated thyroid cancer have a good prognosis after radioiodine-131 therapy,but a small number of patients are insensitive to radioiodine-131 therapy and even continue to develop disease.At present,some targeted drugs can improve progression-free survival in patients with radioactive iodine-refractory differentiated thyroid cancer(RAIR-DTC),such as sorafenib and levatinib,have been approved for the treatment of RAIR-DTC.However,due to the presence of primary and acquired drug resistance,drug efficacy in these patients is unsatisfactory.This review introduces the acquired drug resistance mechanism of sorafenib in the regulation of mitogen-activated protein kinase(MAPK)and phosphatidylinositol-3-kinase(PI3K)pathways and proposes related treatment strategies,in order to provide a reference for similar drug resistance mechanism of sorafenib and effective treatment of RAIR-DTC.

Objective The purpose of this study was to investigate the bacterial communities of biting midges and ticks collected from three sites in the Poyang Lake area,namely,Qunlu Practice Base,Peach Blossom Garden,and Huangtong Animal Husbandry,and whether vectors carry any bacterial pathogens that may cause diseases to humans,to provide scientific basis for prospective pathogen discovery and disease prevention and control. Methods Using a metataxonomics approach in concert with full-length 16S rRNA gene sequencing and operational phylogenetic unit(OPU)analysis,we characterized the species-level microbial community structure of two important vector species,biting midges and ticks,including 33 arthropod samples comprising 3,885 individuals,collected around Poyang Lake. Results A total of 662 OPUs were classified in biting midges,including 195 known species and 373 potentially new species,and 618 OPUs were classified in ticks,including 217 known species and 326 potentially new species.Surprisingly,OPUs with potentially pathogenicity were detected in both arthropod vectors,with 66 known species of biting midges reported to carry potential pathogens,including Asaia lannensis and Rickettsia bellii,compared to 50 in ticks,such as Acinetobacter lwoffii and Staphylococcus sciuri.We found that Proteobacteria was the most dominant group in both midges and ticks.Furthermore,the outcomes demonstrated that the microbiota of midges and ticks tend to be governed by a few highly abundant bacteria.Pantoea sp7 was predominant in biting midges,while Coxiella sp1 was enriched in ticks.Meanwhile,Coxiella spp.,which may be essential for the survival of Haemaphysalis longicornis Neumann,were detected in all tick samples.The identification of dominant species and pathogens of biting midges and ticks in this study serves to broaden our knowledge associated to microbes of arthropod vectors. Conclusion Biting midges and ticks carry large numbers of known and potentially novel bacteria,and carry a wide range of potentially pathogenic bacteria,which may pose a risk of infection to humans and animals.The microbial communities of midges and ticks tend to be dominated by a few highly abundant bacteria.

italic>Salvia miltiorrhiza, a commonly used traditional Chinese medicine, has been widely recognized for its blood-activating and stasis-removing properties in the clinical treatment of cardiovascular and cerebrovascular diseases. The synthesis and regulatory mechanism of tanshinones, the key active constituents of Salvia miltiorrhiza, have been a hot topic of research. The paper summarized the research findings on the regulation of tanshinone biosynthesis by transcription factors such as AP2/ERF, bHLH, MYB, bZIP, and WRKY in recent years. The review identifies the existing issues in the transcriptional regulation studies of Salvia miltiorrhiza and discusses the research direction of transcription factors in the regulation of tanshinone biosynthesis, providing a theoretical basis for the further discovery and utilization of functional genes involved in the regulation of tanshinone bioactive constituents.

Objective:To investigate the clinical value immature granulocyte percentage(IG％)and other inflammatory indicators in the severity of acute appendicitis.Methods:A total of 201 pediatric patients undergoing appendicitis surgery admitted to Zhoukou Central Hospital from June 2022 to August 2023 were included.Patients with pathologically confirmed actue appendici-tis were divided two subgroups:actue simple appendicitis(ASA)group and actue complicated ap-pendicitis(ACA)group,The variables that included IG％,white blood cell(WBC)count,absolute neutrophil count(ANC),absolute lymphocyte count(ALC),neutrophil to lymphocyte ratio(NLR),pro-calcitonin(PCT),C-reactive protein(CRP),platelet to lymphocyte(PLR)and other indexes were ana-lyzed between ASA and ACA group.The logistic regression model for diagnosis of ACA was es-tablished,and the diagostic value of this model and other inflammtory indicators for ACA was evaluated by receiver operating characteristic(ROC)curve analysis.Results:The levels of IG％,WBC,ANC,ALC,NLR,PCT and PLR were higher and the level of ALC was lower in ACA group than those in ASA group(all P＜0.05).Logistic regression analysis showed that IG％,NLR and CRP were three diagnostic determinants of ACA(all P＜0.05).The AUC of the established logistic model and IG％,NLR,CRP were 0.868,0.821,0.691 and 0.790(all P＜0.001).The logistic model was vali-dated by independent cohorts,and the AUC was 0.872,the sensitivity was 90.0％and the speci-ficity was 75.6％.Conlusions:The IG％value can early indicator for pediatric ACA,and the es-tablished logistic regression model based on biomarkers including IG％,NLR and CRP has clinical value in diagnosing ACA in children.