ObjectiveTo investigate the effect of quercetin on acute gouty arthritis （GA） in rats by inhibiting the reactive oxygen species （ROS）/NOD-like receptor protein 3 （NLRP3）/interleukin-1β （IL-1β） signaling pathway. MethodsSixty SPF-grade male SD rats were randomized into normal， model， colchicine （0.3 mg·kg^-1）， and low-， medium-， and high-dose （25， 50， 100 mg·kg^-1， respectively） quercetin groups （n=10）. The rats in the dosing groups were administrated with the corresponding drugs （10 mL·kg^-1） by gavage once a day for one week. An equal volume of normal saline was given by gavage to rats in normal and model groups. One hour after drug administration on day 5， an acute GA model was established in other groups except the control group via intra-articular injection of monosodium urate （MSU） suspension into the right posterior ankle joint cavity. The joint swelling and gait were scored at the time points of 6， 12， 24， 48 h after modeling. Histopathological alterations in the ankle joint tissue from each group were assessed by hematoxylin-eosin （HE） staining. Malondialdehyde （MDA）， xanthine oxidase （XOD）， and total superoxide dismutase （T-SOD） assay kits were used to assess the levels of MDA， XOD， and T-SOD in the serum. The levels of tumor interleukin-6 （IL-6）， necrosis factor-α （TNF-α）， and IL-1β in the rat serum， as well as ROS in the ankle joint tissue， were measured by enzyme-linked immunosorbent assay （ELISA）. Western blot was performed to determine the protein levels of NLRP3， thioredoxin-interacting protein （TXNIP）， apoptosis-associated speck-like protein containing a CARD domain （ASC）， precursor cysteinyl aspartate-specific proteinase-1 （pro-Caspase-1）， cleaved Caspase-1 （Caspase-1 p20）， and IL-1β in the ankle joint tissue. Real-time PCR was employed to assess the mRNA levels of TXNIP， NLRP3， ASC， IL-1β， and TNF-α in the ankle joint tissue. ResultsCompared with the normal group， the model group exhibited decreased spontaneous activity， mental fatigue， increased ankle joint swelling and gait scores （P<0.01）， aggravated synovial tissue edema and inflammatory cell infiltration （P<0.01）， elevated levels of XOD， MDA， TNF-α， IL-1β， and IL-6 in the serum and ROS in the joint tissue （P<0.01）， a declined level of T-SOD （P<0.01）， up-regulated protein levels of NLRP3， TXNIP， ASC， pro-Caspase-1， Caspase-1 p20， and IL-1β in the ankle joint tissue （P<0.01）， and up-regulated mRNA levels of NLRP3， TXNIP， ASC， IL-1β， and TNF-α in the ankle joint tissue （P<0.01）. Compared with the model group， the medium- and high-dose quercetin groups showed improved general conditions， decreased gait scores （P<0.05， P<0.01）， reduced joint swelling （P<0.01）， alleviated synovial tissue edema and inflammatory cell infiltration （P<0.05， P<0.01）， lowered levels of XOD， MDA， TNF-α， IL-1β， and IL-6 in the serum and ROS in the joint tissue （P<0.01）， increased levels of T-SOD （P<0.01）， down-regulated protein levels of TXNIP， NLRP3， ASC， pro-Caspase-1， Caspase-1 p20， and IL-1β in the ankle joint tissue （P<0.05， P<0.01）， and down-regulated mRNA levels of TXNIP， NLRP3， ASC， IL-1β， and TNF-α in the ankle joint tissue （P<0.01）. Low-dose quercetin also ameliorated some of the above parameters （P<0.05， P<0.01）. ConclusionQuercetin exerts anti-GA effects by blocking the ROS/NLRP3/IL-1β signaling pathway， downregulating NLRP3 inflammasome activation， and inhibiting the production of pro-inflammatory cytokines including TNF-α， IL-1β， and IL-6.

AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

ObjectiveTo investigate whether Huanglian Jiedutang （HLJD） and its major active constituents （geniposide， baicalin， and berberine） can inhibit the inflammatory response of BV2 cells under lipopolysaccharide （LPS） stimulation via the high-mobility group protein B1 （HMGB1）/Toll-like receptor 4 （TLR4）/nuclear factor-κB （NF-κB） signaling pathway， and to explore differences in therapeutic efficacy among the three monomers， their combined formula， and HLJD under equal content ratios. MethodsBV2 microglial cells were used as the primary experimental model. Cell viability was assessed using the cell counting kit-8 （CCK-8） method to examine the effects of different concentrations of dimethyl sulfoxide （DMSO， 0.8%， 0.4%， 0.2%， 0.1%， and 0.05%） on cell viability. IncuCyte was employed to monitor the growth of cells under different concentrations of HLJD （200， 100， 50， 25， 12.5， 6.25 mg·L^-1）. Nitric oxide （NO） assay was used to screen the optimal HLJD concentration. High-performance liquid chromatography （HPLC） determined the content of geniposide， baicalin， and berberine in HLJD， and experimental groups were subsequently established according to the relative proportions of these constituents. CCK-8 assay evaluated cell viability under different treatments. Enzyme-linked immunosorbent assay （ELISA） measured levels of inflammatory factors （TNF-α， IL-1β， IL-6， IL-10） in the supernatant. Flow cytometry assessed the effects of treatments on M1-type polarization of BV2 cells. Western blot determined the expression levels of HMGB1， TLR4， and NF-κB-related proteins. ResultsCompared with the blank group， DMSO at concentrations ≤0.2% did not affect cell viability within 48 h. BV2 cell growth plateaued at 24 h after treatment with 200 mg·L^-1 HLJD. Under stimulation with 2 mg·L^-1 LPS， this concentration of HLJD effectively reduced NO release， and 6 h pre-treatment had a stronger inhibitory effect on NO than direct administration. HPLC results showed that 1 mg of HLJD freeze-dried powder contained approximately 24 μg of geniposide， 15 μg of baicalin， and 30 μg of berberine. Based on these ratios， experimental groups were blank， LPS （2 mg·L^-1）， HLJD （200 mg·L^-1）， monomer combination， geniposide （4.8 mg·L^-1）， baicalin （3 mg·L^-1）， and berberine （6 mg·L^-1）. The monomer combination group consisted of all three active constituents dissolved together. LPS and HLJD or its active constituents did not affect cell viability compared with the blank group. LPS significantly increased TNF-α， IL-1β， IL-6， and IL-10 in the supernatant （P<0.01）. HLJD and its active constituents significantly reduced pro-inflammatory factors TNF-α， IL-1β， and IL-6 （P<0.05， P<0.01） while upregulating anti-inflammatory IL-10 （P<0.01）， with the monomer combination showing the strongest effect （P<0.05， P<0.01）. Compared with the blank group， LPS significantly increased the proportion of CD80⁺CD86⁺ （M1-type） BV2 cells （P<0.01）. HLJD and its constituents partially inhibited M1 polarization （P<0.05， P<0.01）， with the monomer combination exhibiting the most pronounced effect （P<0.05， P<0.01）. Compared with the blank group， LPS upregulated HMGB1， TLR4， and NF-κB-related proteins （P<0.01）， whereas HLJD and its active constituents significantly reduced their expression （P<0.05， P<0.01）， with the monomer combination having the strongest regulatory effect （P<0.05， P<0.01）. ConclusionHLJD and its major active constituents （geniposide， baicalin， berberine） can inhibit LPS-induced inflammatory responses in BV2 cells. The combination of the three active constituents demonstrates the most potent anti-inflammatory effect， significantly attenuating M1-type polarization of BV2 cells via the HMGB1/TLR4/NF-κB signaling pathway.

This study employed the drug affinity responsive target stability (DARTS) technique to investigate the molecular mechanism of the antipsychotic drug penfluridol against melanoma, revealing the biological pathway to exert its effect on the HSPA6/p53/p21 signaling axis. Experiments such as the methylthiazolyldiphenyl-tetrazolium bromide (MTT) assay and cell colony formation ability assay confirmed that penfluridol could significantly downregulate the expression of cyclin D1 and cyclin-dependent kinase 4 (CDK4) in melanoma A375 and B16 cells, induce cell cycle arrest in the G1 phase, and thus inhibit the proliferation of melanoma cells. Meanwhile, the results of Western blot, Hoechst 33342 staining and Annexin V-FITC/PI double staining experiments showed that penfluridol could significantly downregulate the expression of Bcl-2 and upregulate the expression of Bax and cleaved caspase-3, inducing cell apoptosis. Further, the DARTS technique was used to identify heat shock 70 kD protein 6 (HSPA6) as the key target bound by penfluridol. Penfluridol activates the p53/p21 pathway by upregulating HSPA6. Knocking down HSPA6 reverses not only the activation of the p53/p21 pathway mediated by penfluridol but also the associated cell cycle arrest and apoptosis. Animal experiments on tumor-bearing mice also confirmed that knocking down HSPA6 could reverse the in vivo anti-tumor activity of penfluridol. This study clarified that penfluridol can inhibit the progression of melanoma by targeting HSPA6 to activate the p53/p21 signaling axis, providing a new perspective for the repositioning of antipsychotic drugs in cancer treatment.

Objective: To explore the association between nap duration with anxiety and depressive symptoms among junior high school students, in order to provide evidence for mental health interventions for adolescents. Methods: From May to June 2022, a combination of convenience sampling and cluster sampling was used to select 2 491 students from 2 junior high schools in Haizhu District, Guangzhou City for questionnaire survey and physical examination. The questionnaire collected nap duration, night time sleep duration, bedtime, physical activity, and sedentary behavior. Anxiety and depressive symptoms were assessed using Patient Health Questionnaire-9 (PHQ-9) and Generalized Anxiety Disorder-7 (GAD-7), respectively. Log-binomial regression model was used to analyze the association of nap duration with anxiety and depressive symptoms, as well as comorbidity among junior high school students, and a restricted cubic spline (RCS) Log-binomial regression model was employed to analyze the non linear relationship after adjusting for covariates. Results: The detection rates of anxiety symptoms, depressive symptoms and comorbidity among junior high school students were 13.29%,14.65%,9.19%. After adjusting for covariates such as age, gender and nighttime sleep duration, compared with a school day nap duration of <30 min/d, a nap duration of 30-<60 min/d was associated with a reduced risk of anxiety symptoms ( APR =0.68, 95% CI =0.49-0.98) and comorbidity ( APR =0.56, 95% CI =0.39-0.87)(both P < 0.05 ). Compared with no napping on weekends, a nap duration of 30-<60 min/d was associated with a reduced risk of anxiety symptoms ( APR =0.62, 95% CI =0.41-0.88), depressive symptoms ( APR =0.52, 95% CI =0.34-0.75) and comorbidity ( APR = 0.52 , 95% CI =0.30-0.83)(all P <0.05). RCS curves showed a nonlinear relationship between weekend nap duration and the prevalence of anxiety, depressive symptoms and comorbidity among junior high school students(all P non linear <0.05); weekend nap duration of <120 min was associated with a lower risk of anxiety and depressive symptoms, and weekend nap duration of >180 min was associated with an increased risk. Conclusions Appropriate nap duration can help reduce the risk of anxiety, depressive symptoms, and the comorbidity among junior high school students. Adolescents should be guided to reasonably arrange nap duration for promoting physical and mental health.

Objective: To review the relationship between 24 hour movement behaviors and physical and mental health among college students, in order to provide evidence to support health promotion and further research in universities. Methods: Following the Joanna Briggs Institude(JBI) scoping review guidelines, relevant studies published in databases from inception date to December 26, 2025 were searched, including PubMed, Embase, Cochrane Library, Web of Science, China National Knowledge Infrastructure (CNKI) and Wanfang Data. For studies meeting the inclusion and exclusion criteria, a descriptive analysis was conducted to summarize the measurement tools used, adherence rates with guidelines, and the relationship between physical and mental health. Results: A total of 30 studies were included. Measurement tools exhibited a high heterogeneity, with questionnaires being the primary method. The rate of full adherence with 24 hour movement behaviors among college students was less than 30%. Moderate to vigorous physical activity and high quality sleep were associated with improvements in physical fitness, cardiopulmonary function, and mental health, while prolonged sitting was negatively associated with obesity and depression. Equivalent time substitution analysis indicated that increasing moderate to vigorous physical activity and reducing prolonged sitting could significantly improve health outcomes. Conclusions The adherence rate for 24 hour movement behaviors among college students is low and it is closely associated with physical and mental health. Future studies should standardize measurement tools, and implement targeted interventions based on the optimization of daily activity patterns.

ObjectiveTo explore the effect of presentation-assimilation-discussion (PAD) classroom model-based classroom-community collaborative teaching on course of sports rehabilitation therapy under the background of sports-medicine integration. MethodsFrom Febrary, 2024 to June, 2025, a total of 46 undergraduate students majoring in sports rehabilitation (Grade 2022, Capital University of Physical Education and Sports) were randomly divided into control group (n = 23) and experimental group (n = 23). The control group received routine lectures combined with laboratory practice, while the experimental group was taught using a classroom-community collaborative teaching based on PAD classroom structure. The two groups were compared in terms of excellent rate in practical assessment, achievement in higher-order dimensions of Bloom's Taxonomy, real-case rehabilitation scenario transformation ability and teaching satisfaction at the end of the semester. ResultsAt the end of the semester, the excellent rate in practical assessment was 60.87% in the experimental group, higher than 21.74% in the control group (χ² = 7.725, P < 0.05), while the scores in the analyse, evaluation and creation dimensions of Bloom's Taxonomy were significantly higher (t > 8.490, P < 0.001), real-case rehabilitation scenario transformation ability was better (t > 3.873, P < 0.001) and teaching satisfaction was higher (χ² = 8.576, P = 0.003). ConclusionPAD-based classroom-community collaborative teaching can effectively improve practical skills, higher-order cognitive abilities and practical application abilities among students majoring in sports rehabilitation.

ObjectivePancreatic ductal adenocarcinoma (PDAC) exhibits a limited response to current treatments due to its dense fibrotic stroma and highly immunosuppressive tumor microenvironment. In recent years, advancements in cellular immunotherapy, particularly chimeric antigen receptor macrophage (CAR-M) therapy, have offered new hope for pancreatic cancer treatment. Although CAR-M therapy demonstrates dual potential in directly killing tumor cells and remodeling the immune microenvironment, it still faces challenges such as complex in vitro preparation processes and low in vivo targeting and delivery efficiency. Therefore, developing strategies for efficient and targeted in vivo delivery of CAR genes has become crucial for overcoming current therapeutic limitations. This study aims to develop an orally administrable nano-gene delivery system for the targeted delivery of CAR genes to pancreatic tumor sites. MethodsCore nano-gene particles (PNP/pCAR) were constructed by loading plasmid DNA encoding CAR (pCAR) with cationic polypeptides (PNP). Subsequently, PNP/pCAR was surface-modified with β-glucan to prepare the targeted nanoparticles (βGlus-PNP/pCAR). The loading efficiency of PNP for pCAR was quantitatively assessed by gel retardation assay. The particle size, Zeta potential, morphology, and storage stability of PNP/pCAR were characterized using a Malvern particle size analyzer and transmission electron microscopy. At the cellular level, RAW 264.7 macrophages were selected. The cytotoxicity of PNP/pCAR was evaluated using the CCK-8 assay. The cellular uptake efficiency and lysosomal escape ability of the nanoparticles were assessed via flow cytometry and confocal microscopy. Transfection efficiency was quantitatively evaluated by detecting the expression of the reporter gene GFP using flow cytometry. At the in vivo level, an orthotopic pancreatic cancer mouse model was established. Cy7-labeled βGlus-PNP/pCAR nanoparticles were administered orally, and the fluorescence distribution in mice was dynamically monitored at 1, 2, 4, 8, and 16 h post-administration using a small animal in vivo imaging system. Forty-eight hours after oral gavage, the mice were euthanized, and pancreatic tumor tissues were collected for further analysis of intratumoral fluorescence signals using the imaging system. Additionally, βGlus-PNP/pCAR-GFP nanoparticles loaded with the reporter gene (GFP) were administered orally. Forty-eight hours post-administration, pancreatic tumor tissues were harvested to prepare frozen sections, and GFP expression was observed and analyzed under a fluorescence microscope. ResultsThe PNP carrier exhibited a high loading capacity for pCAR. The successfully prepared PNP/pCAR nanoparticles were regular spheres with a hydrodynamic diameter of approximately (120±10) nm and a Zeta potential of about +(6±1) mV. They maintained good structural stability after incubation in PBS buffer for 7 d. Cell experiments demonstrated that PNP/pCAR exhibited no significant cytotoxicity in RAW 264.7 cells while being efficiently internalized and effectively escaping lysosomal degradation. The transfection positive rate of PNP/pCAR-GFP in RAW 264.7 cells reached (25±3)%, surpassing that of Lipofectamine 2000-loaded pCAR-GFP (Lipo/pCAR-GFP), which was (20±1)%.In vivo experiments revealed that, compared to unmodified PNP/pCAR, βGlus-PNP/pCAR exhibited strongerin situ pancreatic tumor targeting ability after oral administration. Furthermore, oral administration of βGlus-PNP/pCAR-GFP resulted in significant GFP protein expression detectable within pancreatic tumor tissues. ConclusionThis study successfully constructed and validated an orally administrable, pancreatic cancer-targeting polypeptide-based nano-gene delivery system. It provides an important technological foundation in delivery systems and experimental basis for the subsequent development of in situ CAR-M-based therapeutic strategies for pancreatic cancer.

ObjectivePancreatic ductal adenocarcinoma (PDAC) exhibits a limited response to current treatments due to its dense fibrotic stroma and highly immunosuppressive tumor microenvironment. In recent years, advancements in cellular immunotherapy, particularly chimeric antigen receptor macrophage (CAR-M) therapy, have offered new hope for pancreatic cancer treatment. Although CAR-M therapy demonstrates dual potential in directly killing tumor cells and remodeling the immune microenvironment, it still faces challenges such as complex in vitro preparation processes and low in vivo targeting and delivery efficiency. Therefore, developing strategies for efficient and targeted in vivo delivery of CAR genes has become crucial for overcoming current therapeutic limitations. This study aims to develop an orally administrable nano-gene delivery system for the targeted delivery of CAR genes to pancreatic tumor sites. MethodsCore nano-gene particles (PNP/pCAR) were constructed by loading plasmid DNA encoding CAR (pCAR) with cationic polypeptides (PNP). Subsequently, PNP/pCAR was surface-modified with β-glucan to prepare the targeted nanoparticles (βGlus-PNP/pCAR). The loading efficiency of PNP for pCAR was quantitatively assessed by gel retardation assay. The particle size, Zeta potential, morphology, and storage stability of PNP/pCAR were characterized using a Malvern particle size analyzer and transmission electron microscopy. At the cellular level, RAW 264.7 macrophages were selected. The cytotoxicity of PNP/pCAR was evaluated using the CCK-8 assay. The cellular uptake efficiency and lysosomal escape ability of the nanoparticles were assessed via flow cytometry and confocal microscopy. Transfection efficiency was quantitatively evaluated by detecting the expression of the reporter gene GFP using flow cytometry. At the in vivo level, an orthotopic pancreatic cancer mouse model was established. Cy7-labeled βGlus-PNP/pCAR nanoparticles were administered orally, and the fluorescence distribution in mice was dynamically monitored at 1, 2, 4, 8, and 16 h post-administration using a small animal in vivo imaging system. Forty-eight hours after oral gavage, the mice were euthanized, and pancreatic tumor tissues were collected for further analysis of intratumoral fluorescence signals using the imaging system. Additionally, βGlus-PNP/pCAR-GFP nanoparticles loaded with the reporter gene (GFP) were administered orally. Forty-eight hours post-administration, pancreatic tumor tissues were harvested to prepare frozen sections, and GFP expression was observed and analyzed under a fluorescence microscope. ResultsThe PNP carrier exhibited a high loading capacity for pCAR. The successfully prepared PNP/pCAR nanoparticles were regular spheres with a hydrodynamic diameter of approximately (120±10) nm and a Zeta potential of about +(6±1) mV. They maintained good structural stability after incubation in PBS buffer for 7 d. Cell experiments demonstrated that PNP/pCAR exhibited no significant cytotoxicity in RAW 264.7 cells while being efficiently internalized and effectively escaping lysosomal degradation. The transfection positive rate of PNP/pCAR-GFP in RAW 264.7 cells reached (25±3)%, surpassing that of Lipofectamine 2000-loaded pCAR-GFP (Lipo/pCAR-GFP), which was (20±1)%.In vivo experiments revealed that, compared to unmodified PNP/pCAR, βGlus-PNP/pCAR exhibited strongerin situ pancreatic tumor targeting ability after oral administration. Furthermore, oral administration of βGlus-PNP/pCAR-GFP resulted in significant GFP protein expression detectable within pancreatic tumor tissues. ConclusionThis study successfully constructed and validated an orally administrable, pancreatic cancer-targeting polypeptide-based nano-gene delivery system. It provides an important technological foundation in delivery systems and experimental basis for the subsequent development of in situ CAR-M-based therapeutic strategies for pancreatic cancer.

Since its emergence in the 1980s, the human immunodeficiency virus (HIV) has caused a global pandemic, posing a severe threat to human life and health as well as social development. Although pre-exposure prophylaxis (PrEP) effectively curbs HIV transmission and antiretroviral therapy (ART) significantly extends the lifespan of patients, vaccines remain a pivotal tool for blocking transmission and ending the pandemic. The high genetic variability of HIV-1, the glycan shield of its envelope glycoproteins, and the long-term persistence of latent reservoirs have repeatedly led to bottlenecks in traditional vaccine strategies. In recent years, mRNA technology has offered a novel approach to addressing these challenges, leveraging advantages such as sequence programmability, short production cycles, native conformational expression of antigens, and self-adjuvant effects. In recent years, mRNA vaccine technology has emerged as a transformative solution to longstanding vaccinology challenges, characterized by its sequence programmability, rapid production cycles, native conformational antigen expression, and intrinsic self-adjuvanting properties. Unlike traditional platforms reliant on pathogen culture or recombinant proteins, mRNA vaccines can be expeditiously designed and updated based solely on viral genomic sequences. Lipid nanoparticle (LNP)-encapsulated mRNA facilitates endogenous antigen expression and presentation, simultaneously eliciting potent humoral and cellular immune responses. Within this landscape, self-amplifying mRNA (saRNA) further extends in vivo antigen expression to enhance the persistence of immune responses. Moreover, the LNP delivery system not only protects mRNA from degradation and mediates endosomal escape but also synergizes with mRNA to optimize immune activation via self-adjuvant effects. Importantly, mRNA platforms circumvent the pre-existing immunity associated with viral vectors and the genomic integration risks of DNA vaccines, positioning them as a cornerstone for global pandemic preparedness. This review systematically delineates recent advances in mRNA technology for HIV-1 vaccine development, focusing on four pivotal research frontiers. First, mRNA innovations building upon the RV144 trial optimize antigens through codon modification and multivalent designs to induce more durable and broad-spectrum immunity. Second, particulate mRNA vaccine strategies, utilizing virus-like particles (VLPs) and ferritin nanoparticles, achieve in situ antigen self-assembly, significantly enhancing B cell activation and reducing infection risks in non-human primate models. Third, germline-targeting mRNA vaccines address the low-affinity barrier of broadly neutralizing antibody (bNAp) precursors, efficiently activating rare precursor B cells and promoting affinity maturation. Fourth, therapeutic mRNA vaccines offer unique advantages for an HIV functional cure; combining immunogens with mRNA-encoded adjuvants potentiates cellular immunity, while LNP-mediated “shock-and-kill” strategies specifically activate latent reservoirs to guide immune clearance. Comparative analyses with traditional platforms reveal that mRNA technology redefines antigen production and presentation, simulating chronic infection through sustained expression and enabling dual-pathway presentation via endogenous synthesis. Furthermore, we explore the mechanistic innovations of mRNA vaccines in inducing bNAps: sustained in vivo production prolongs the activation window for precursor B cells and maintains germinal center (GC) reactions; endogenously expressed antigens adopt native conformations to expose conserved epitopes; and self-adjuvanting effects modulate the functions of antigen-presenting cells (APCs) and follicular helper T cells (Tfh), driving somatic hypermutation and affinity maturation. We also address critical clinical translation challenges, including immune durability, adaptability to special populations, and large-scale LNP manufacturing, while proposing targeted optimization strategies. In conclusion, this review establishes a theoretical framework for utilizing mRNA technology to overcome HIV-1 immune escape, transitioning from a descriptive paradigm to a problem-solving-based synthesis of evidence. By integrating preclinical and early clinical data, we bridge the gap between basic design and translational verification. mRNA technology is poised to become a central pillar inHIV-1 prevention and therapy, providing a robust toolset to achieve the global goal of ending the AIDS pandemic and offering a blueprint for vaccine development against other recalcitrant infectious diseases.