BACKGROUND:3D-printed bone tissue engineering scaffolds have obvious advantages in the research and clinical treatment of bone defect repair.As one of the important raw materials for 3D printed bone scaffolds,poly-L-lactic acid has a great potential for application in performing bone defect repair,but clinical patients with different bone defect causative factors have different requirements for the comprehensive performance of poly-L-lactic acid bone scaffolds.OBJECTIVE:To summarize and review the development of 3D printing technology and poly-L-lactic acid scaffolds and the design strategies chosen for scaffolds for bone repair in the setting of bone diseases such as osteomyelitis,bone tumor,osteonecrosis,and osteoporosis.METHODS:Literature from CNKI,WanFang,PubMed,Science Direct,and Web of Science databases were searched and screened from 1994 to 2024.Search terms were"3D printing,polylactic acid,bone tissue engineering scaffold,osteomyelitis,bone tumor,osteonecrosis,osteoporosis,bone defect"in Chinese and English.The screened 62 articles were systematically summarized and analyzed.RESULTS AND CONCLUSION:(1)Poly-L-lactic acid is considered to be an ideal raw material for artificial bone scaffold design due to its non-toxicity,processability,biocompatibility,and ability to self-degrade in the human environment.The application of 3D printing technology has enabled poly-L-lactic acid bone scaffolds to meet the multilayered and porous structural design requirements of biomimetic artificial bone repair materials,and to optimize the mechanical properties for better bone repair.(2)According to different bone disease microenvironments,timely adjustment of the functional design of poly-L-lactic acid scaffolds is important for the comprehensive osteogenic efficacy of the scaffolds.The article discusses the application of poly-L-lactic acid scaffolds in bone disease environments such as osteomyelitis,bone tumor,osteonecrosis,and osteoporosis,and highlights the importance of rationally grasping the timing of bone disease treatment and bone tissue regeneration for bone defects caused by different bone diseases.(3)Although poly-L-lactic acid scaffolds show potential in bone repair,there are still some problems,such as the need to further optimize the structural design of the scaffolds to fit new bone regeneration,enhance the bioactivity of the scaffolds,and take into account other functions(e.g.,antimicrobial,anti-tumor,and anti-osteoporosis)in order to adapt to the needs of bone tissue repair in different pathological environments.

BACKGROUND:Age-related macular degeneration and deep vein thrombosis may share common pathophysiological mechanisms,but there is a lack of direct evidence regarding their relationship.Traditional studies are confounded by confounding factors and reverse causation.OBJECTIVE:To investigate the causal relationship between age-related macular degeneration and deep vein thrombosis based on Mendelian randomization design.METHODS:Through a two-way Mendelian randomization analysis,single nucleotide polymorphisms of exposure and outcomes were obtained from publicly available genome-wide association studies,with deep vein thrombosis data from the FinnGen database in a European population with a sample size of 363 612 and 1 048 575 single nucleotide polymorphisms.In addition,we obtained data on age-related macular degeneration from the IEUOpenGWAS project,also from a European population sample of 105 248 cases covering 11 304 110 single nucleotide polymorphisms.In R4.4.1,we used the TwoSampleMR package(version 0.6.8)to explore the causal effects of exposure factors on outcomes.At the same time,we also conducted a sensitivity analysis via MR-Egger regression,weighted median,weighted model and simple model methods to ensure that the assessment results were robust and reliable.In addition,we used the"heterogeneity"function to test for heterogeneity,and the"horizontal pleiotropy"function and the MR-PRESSO test to further assess horizontal pleotropy.The Cochran's Q test was used to determine whether there was statistical heterogeneity between single nucleotide polymorphisms,and the leave-one-out method was used to assess whether single nucleotide polymorphisms would significantly interfere with Mendelian randomization analysis.Funnel plots were drawn to assess the potential bias of single nucleotide polymorphisms.Forest plots were plotted to show the effect estimates of single nucleotide polymorphisms on exposure and outcomes,and their confidence intervals were plotted.Scatter plots were plotted to evaluate the relationship between the potency of single nucleotide polymorphisms and their causal effect size on outcome estimates.RESULTS AND CONCLUSION:Both forward and reverse studies showed that there was no causal association between age-related macular degeneration and the occurrence of deep vein thrombosis(P＞0.05).Sensitivity analysis showed that the main analysis results were reliable and robust,with no outliers,heterogeneity,and horizontal pleiotropy,and no single nucleotide polymorphism significantly affected the overall effect estimate.Although it is based on European population data,it has methodological reference value for Chinese biomedical research on complex disease associations.In this field,China can carry out multi-center large-sample studies,accurately analyze the internal links between Chinese population-related diseases,and provide a basis for prevention and treatment strategies and clinical practice.

BACKGROUND:The incidence rate of chronic non-specific neck pain is high and the etiology is unknown.Myofascial pain and deep cervical flexor atrophy are the key factors.Extracorporeal shockwave therapy can improve microcirculation,relieve local pain,and delay the degenerative development of the cervical spine,while motion control training can significantly improve neck muscle strength and endurance and reduce neck pain.However,both methods have limited effectiveness when applied individually.OBJECTIVE:To explore the therapeutic efficacy of extracorporeal shock wave intervention combined with motion control training at the upper trapezius muscle on chronic non-specific neck pain.METHODS:Forty-two patients with chronic non-specific neck pain recruited from Shenyang Sport University were randomly divided into three groups:a shock wave group(n=14),in which extracorporeal shockwave intervention at the upper trapezius muscle was given for 10-15 minutes,once a week for 4 weeks;a training group(n=14),in which motion control training was given for 40-50 minutes,three times a week for 4 weeks;and a combination group(n=14),in which extracorporeal shockwave intervention at the upper trapezius muscle combined with motion control training was performed for 4 weeks.Patients were assessed for pain intensity,cervical spine function,upper trapezius muscle thickness,hemodynamic parameters,and serum interleukin 6 and tumor necrosis factor α levels before intervention,1 week and 4 weeks after intervention.RESULTS AND CONCLUSION:(1)Compared with the pre-intervention period,the visual analogue scale scores and neck disability index in the three groups were lower after 1 and 4 weeks of intervention(P＜0.05),and the visual analogue scale scores and neck disability index in the combination group were lower than those of the shock wave group and the training group(P＜0.05).(2)Compared with the pre-intervention period,the upper trapezius thickness increased in the training group and the combination group after 4 weeks of intervention(P＜0.05);the upper trapezius thickness was greater in the combination group than in the shock wave group and the training group after 4 weeks of intervention(P＜0.05).(3)The shock wave group and the combination group had an increase in the peak systolic velocity of the ascending segment of the transverse carotid artery(P＜0.05)and a decrease in the resistance index(P＜0.05)after 1 and 4 weeks of intervention,while the training group showed an increase in the peak systolic velocity of the ascending segment of the transverse carotid artery(P＜0.05)and a decrease in the resistance index(P＜0.05)after 4 weeks of intervention.The peak systolic velocity of the ascending segment of the transverse carotid artery in the combination group was higher(P＜0.05)and the resistance index was lower(P＜0.05)than those in the shockwave group and the training group after 1 and 4 weeks of intervention.(4)Compared with the pre-intervention period,the levels of interleukin 6 and tumor necrosis factor α were reduced in the shock wave and combination groups after 1 and 4 weeks of intervention(P＜0.05),and in the training group after 4 weeks of intervention(P＜0.05).After 1 and 4 weeks of intervention,the levels of interleukin 6 and tumor necrosis factor α were lower in the combination group than in the shock wave group and the training group(P＜0.05).To conclude,extracorporeal shock wave combined with motion control training for chronic non-specific neck pain significantly reduces pain and improves neck function,and the mechanism of action may be to promote the blood flow velocity at the trigger point,reduce blood flow resistance,reduce the serum levels of interleukin 6 and tumor necrosis factor α,and increase the thickness of the upper trapezius muscle.

ObjectiveTo investigate the effect of quercetin on acute gouty arthritis （GA） in rats by inhibiting the reactive oxygen species （ROS）/NOD-like receptor protein 3 （NLRP3）/interleukin-1β （IL-1β） signaling pathway. MethodsSixty SPF-grade male SD rats were randomized into normal， model， colchicine （0.3 mg·kg^-1）， and low-， medium-， and high-dose （25， 50， 100 mg·kg^-1， respectively） quercetin groups （n=10）. The rats in the dosing groups were administrated with the corresponding drugs （10 mL·kg^-1） by gavage once a day for one week. An equal volume of normal saline was given by gavage to rats in normal and model groups. One hour after drug administration on day 5， an acute GA model was established in other groups except the control group via intra-articular injection of monosodium urate （MSU） suspension into the right posterior ankle joint cavity. The joint swelling and gait were scored at the time points of 6， 12， 24， 48 h after modeling. Histopathological alterations in the ankle joint tissue from each group were assessed by hematoxylin-eosin （HE） staining. Malondialdehyde （MDA）， xanthine oxidase （XOD）， and total superoxide dismutase （T-SOD） assay kits were used to assess the levels of MDA， XOD， and T-SOD in the serum. The levels of tumor interleukin-6 （IL-6）， necrosis factor-α （TNF-α）， and IL-1β in the rat serum， as well as ROS in the ankle joint tissue， were measured by enzyme-linked immunosorbent assay （ELISA）. Western blot was performed to determine the protein levels of NLRP3， thioredoxin-interacting protein （TXNIP）， apoptosis-associated speck-like protein containing a CARD domain （ASC）， precursor cysteinyl aspartate-specific proteinase-1 （pro-Caspase-1）， cleaved Caspase-1 （Caspase-1 p20）， and IL-1β in the ankle joint tissue. Real-time PCR was employed to assess the mRNA levels of TXNIP， NLRP3， ASC， IL-1β， and TNF-α in the ankle joint tissue. ResultsCompared with the normal group， the model group exhibited decreased spontaneous activity， mental fatigue， increased ankle joint swelling and gait scores （P<0.01）， aggravated synovial tissue edema and inflammatory cell infiltration （P<0.01）， elevated levels of XOD， MDA， TNF-α， IL-1β， and IL-6 in the serum and ROS in the joint tissue （P<0.01）， a declined level of T-SOD （P<0.01）， up-regulated protein levels of NLRP3， TXNIP， ASC， pro-Caspase-1， Caspase-1 p20， and IL-1β in the ankle joint tissue （P<0.01）， and up-regulated mRNA levels of NLRP3， TXNIP， ASC， IL-1β， and TNF-α in the ankle joint tissue （P<0.01）. Compared with the model group， the medium- and high-dose quercetin groups showed improved general conditions， decreased gait scores （P<0.05， P<0.01）， reduced joint swelling （P<0.01）， alleviated synovial tissue edema and inflammatory cell infiltration （P<0.05， P<0.01）， lowered levels of XOD， MDA， TNF-α， IL-1β， and IL-6 in the serum and ROS in the joint tissue （P<0.01）， increased levels of T-SOD （P<0.01）， down-regulated protein levels of TXNIP， NLRP3， ASC， pro-Caspase-1， Caspase-1 p20， and IL-1β in the ankle joint tissue （P<0.05， P<0.01）， and down-regulated mRNA levels of TXNIP， NLRP3， ASC， IL-1β， and TNF-α in the ankle joint tissue （P<0.01）. Low-dose quercetin also ameliorated some of the above parameters （P<0.05， P<0.01）. ConclusionQuercetin exerts anti-GA effects by blocking the ROS/NLRP3/IL-1β signaling pathway， downregulating NLRP3 inflammasome activation， and inhibiting the production of pro-inflammatory cytokines including TNF-α， IL-1β， and IL-6.

AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

ObjectiveTo explore the effects of Yimei Baijiang formula （YMBJF） on colitis-associated colorectal cancer （CAC） and the nuclear factor kappaB （NF-κB） signaling pathway in mice. MethodsSixty male Balb/c mice of 4-6 weeks old were randomized into 6 groups： Normal， model， capecitabine （0.83 g·kg^-1）， and low-， medium-， and high-dose （4.63， 9.25， 18.50 g·kg^-1， respectively） YMBJF. The mouse model of CAC was established by combining azoxymethane （AOM， 10 mg·kg^-1） and dextran sulfate sodium （DSS， 2%）. At the 5^th week after the start of modeling， the capecitabine group and the YMBJF groups were respectively administrated with the corresponding doses of drugs by gavage once a day for a total of 6 weeks. The body weights and general conditions of mice were measured and observed， and the disease activity index （DAI） was scored. The tumors in the colorectal tissue were counted， and the colorectal length was measured. The histological features of the colorectal tissue in each group of mice were observed by hematoxylin-eosin （HE） staining. The levels of inflammatory cytokines including interleukin-6 （IL-6）， interleukin-1β （IL-1β）， and tumor necrosis factor-α （TNF-α） in the serum were determined by enzyme-linked immunosorbent assay （ELISA）. The expression and localization of proliferating cell nuclear antigen-67 （Ki67）， proliferating cell nuclear antigen （PCNA）， and phosphorylated nuclear transcription factor-κB p65 （p-NF-κB p65） proteins were observed by immunohistochemistry （IHC）. The apoptosis of tumor cells was observed by the TUNEL assay. The mRNA levels of IL-6，IL-1β， TNF-α， nuclear transcription factor-κB p65 （NF-κB p65）， NF-κB inhibitor alpha （IκBα）， B-cell lymphoma-2 （Bcl-2）， and Bcl-2-associated X protein （Bax） in the colorectal tissue were quantified by Real-time polymerase chain reaction（Real-time PCR）. The protein levels of NF-κB p65， phosphorylated （p）-NF-κB p65， IκBα， p-IκBα， Bcl-2， and Bax in the colorectal tissue were determined by Western blot. ResultsCompared with the model group， each YMBJF group showed decreases in DAI and tumor number （P0.01）， and the medium-dose and high-dose YMBJF groups showed increases in colorectal length （P0.05）. In addition， each YMBJF group showed alleviated colorectal mucosal pathological injury， declined levels of IL-6， IL-1β， and TNF-α in the serum （P0.05）， reduced expression of Ki67 and PCNA （P0.01）， and down-regulated expression of p-NF-κB p65 （P0.05）. The apoptosis in the medium-dose and high-dose YMBJF groups increased （P0.01）. Each YMBJF group and the capecitabine group showed down-regulated mRNA levels of IL-1β， TNF-α， IL-6， NF-κB p65， and Bcl-2 （P0.05） and up-regulated mRNA levels of IκBα and Bax （P0.05）. The mRNA level of IκBα was up-regulated， and that of Bcl-2 was down-regulated （P0.05） in the high-dose YMBJF group. The protein levels of p-IκBα and Bcl-2 were down-regulated （P0.05） in each YMBJF group. The protein levels of IκBα and Bax were up-regulated in the medium-dose and high-dose YMBJF groups （P0.01）， while those of NF-κB p65 and p-NF-κB p65 were down-regulated （P0.05）. ConclusionYMBJF can reduce the number of tumors， reduce the levels of inflammatory factors， promote tumor cell apoptosis， and inhibit tumor cell proliferation by regulating the direct effector molecules of the NF-κB signaling pathway in the mouse model of CRC.

Chronic obstructive pulmonary disease （COPD） is a chronic respiratory disease that poses a significant threat to global health， exhibiting high morbidity， disability and mortality rate， with its prevention and treatment situation becoming increasingly critical. The pathogenesis of COPD is complex， and the underlying cellular and molecular biological mechanisms remain incompletely elucidated. Programmed cell death （PCD） is the process wherein cells actively undergo demise to maintain internal environmental stability in response to certain signals or specific stimuli. Contemporary medical research indicates that the dysregulation of PCD patterns such as apoptosis， necroptosis， pyroptosis， autophagy， and ferroptosis is closely related to the onset and progression of COPD. Clarifying the molecular mechanisms of PCD in COPD may provide novel perspectives for in-depth understanding and prevention of the disease. Traditional Chinese medicine （TCM） is characterized by holistic regulation. In recent years， extensive research has been conducted in the TCM field focusing on modulating apoptosis， necroptosis， pyroptosis， autophagy， and ferroptosis for the treatment of COPD， yielding remarkable achievements. Therefore， this study systematically explored the molecular mechanism of PCD in COPD and reviewed the potential mechanisms and intervention status of TCM targeting PCD in COPD， aiming to provide insights and references for the clinical prevention， treatment and in-depth research of COPD.

ObjectiveTo explore the effects of Yimei Baijiang formula （YMBJF） on colitis-associated colorectal cancer （CAC） and the nuclear factor kappaB （NF-κB） signaling pathway in mice. MethodsSixty male Balb/c mice of 4-6 weeks old were randomized into 6 groups： Normal， model， capecitabine （0.83 g·kg^-1）， and low-， medium-， and high-dose （4.63， 9.25， 18.50 g·kg^-1， respectively） YMBJF. The mouse model of CAC was established by combining azoxymethane （AOM， 10 mg·kg^-1） and dextran sulfate sodium （DSS， 2%）. At the 5^th week after the start of modeling， the capecitabine group and the YMBJF groups were respectively administrated with the corresponding doses of drugs by gavage once a day for a total of 6 weeks. The body weights and general conditions of mice were measured and observed， and the disease activity index （DAI） was scored. The tumors in the colorectal tissue were counted， and the colorectal length was measured. The histological features of the colorectal tissue in each group of mice were observed by hematoxylin-eosin （HE） staining. The levels of inflammatory cytokines including interleukin-6 （IL-6）， interleukin-1β （IL-1β）， and tumor necrosis factor-α （TNF-α） in the serum were determined by enzyme-linked immunosorbent assay （ELISA）. The expression and localization of proliferating cell nuclear antigen-67 （Ki67）， proliferating cell nuclear antigen （PCNA）， and phosphorylated nuclear transcription factor-κB p65 （p-NF-κB p65） proteins were observed by immunohistochemistry （IHC）. The apoptosis of tumor cells was observed by the TUNEL assay. The mRNA levels of IL-6，IL-1β， TNF-α， nuclear transcription factor-κB p65 （NF-κB p65）， NF-κB inhibitor alpha （IκBα）， B-cell lymphoma-2 （Bcl-2）， and Bcl-2-associated X protein （Bax） in the colorectal tissue were quantified by Real-time polymerase chain reaction（Real-time PCR）. The protein levels of NF-κB p65， phosphorylated （p）-NF-κB p65， IκBα， p-IκBα， Bcl-2， and Bax in the colorectal tissue were determined by Western blot. ResultsCompared with the model group， each YMBJF group showed decreases in DAI and tumor number （P0.01）， and the medium-dose and high-dose YMBJF groups showed increases in colorectal length （P0.05）. In addition， each YMBJF group showed alleviated colorectal mucosal pathological injury， declined levels of IL-6， IL-1β， and TNF-α in the serum （P0.05）， reduced expression of Ki67 and PCNA （P0.01）， and down-regulated expression of p-NF-κB p65 （P0.05）. The apoptosis in the medium-dose and high-dose YMBJF groups increased （P0.01）. Each YMBJF group and the capecitabine group showed down-regulated mRNA levels of IL-1β， TNF-α， IL-6， NF-κB p65， and Bcl-2 （P0.05） and up-regulated mRNA levels of IκBα and Bax （P0.05）. The mRNA level of IκBα was up-regulated， and that of Bcl-2 was down-regulated （P0.05） in the high-dose YMBJF group. The protein levels of p-IκBα and Bcl-2 were down-regulated （P0.05） in each YMBJF group. The protein levels of IκBα and Bax were up-regulated in the medium-dose and high-dose YMBJF groups （P0.01）， while those of NF-κB p65 and p-NF-κB p65 were down-regulated （P0.05）. ConclusionYMBJF can reduce the number of tumors， reduce the levels of inflammatory factors， promote tumor cell apoptosis， and inhibit tumor cell proliferation by regulating the direct effector molecules of the NF-κB signaling pathway in the mouse model of CRC.

Chronic obstructive pulmonary disease （COPD） is a chronic respiratory disease that poses a significant threat to global health， exhibiting high morbidity， disability and mortality rate， with its prevention and treatment situation becoming increasingly critical. The pathogenesis of COPD is complex， and the underlying cellular and molecular biological mechanisms remain incompletely elucidated. Programmed cell death （PCD） is the process wherein cells actively undergo demise to maintain internal environmental stability in response to certain signals or specific stimuli. Contemporary medical research indicates that the dysregulation of PCD patterns such as apoptosis， necroptosis， pyroptosis， autophagy， and ferroptosis is closely related to the onset and progression of COPD. Clarifying the molecular mechanisms of PCD in COPD may provide novel perspectives for in-depth understanding and prevention of the disease. Traditional Chinese medicine （TCM） is characterized by holistic regulation. In recent years， extensive research has been conducted in the TCM field focusing on modulating apoptosis， necroptosis， pyroptosis， autophagy， and ferroptosis for the treatment of COPD， yielding remarkable achievements. Therefore， this study systematically explored the molecular mechanism of PCD in COPD and reviewed the potential mechanisms and intervention status of TCM targeting PCD in COPD， aiming to provide insights and references for the clinical prevention， treatment and in-depth research of COPD.

Objective To evaluate the predictive value of different machine learning models constructed in a multicenter environment for potential organ donors and verify their clinical application feasibility. Methods The study included 2 000 inpatients admitted to five domestic tertiary hospitals from January 2020 to December 2023, who met the criteria for potential organ donation assessment. They were randomly divided into a training set and an internal validation set (7∶3). Another 300 similar patients admitted to the First Affiliated Hospital of Harbin Medical University from January 2024 to April 2025 were included as an external validation set. The area under the curve (AUC), sensitivity, specificity, accuracy and F1-score of three models were compared, and the consistency of the potential organ donor determination process was tested. Multivariate logistic regression analysis was used to identify predictive factors of potential organ donors. Decision curve analysis (DCA) was employed to verify the resource efficiency of each model, and the threshold interval and intervention balance point were assessed. Results Apart from age, there were no significant differences in other basic characteristics among the centers (all P>0.05). The consistency of the potential organ donor determination process among researchers in each center was good [all 95% confidence interval (CI) lower limits >0]. In the internal validation set, the XGBoost model had the best predictive performance (AUC=0.92, 95% CI 0.89-0.94) and the best calibration (P=0.441, Brier score 0.099). In the external validation set, the XGBoost model also had the best predictive performance (AUC=0.91, 95% CI 0.88-0.94), outperforming logistic regression and random forest models. Multivariate logistic regression showed that mechanical ventilation had the greatest impact (odds ratio=2.06, 95% CI 1.54-2.76, P<0.001). DCA indicated that the XGBoost model had the highest net benefit in the threshold interval of 0.2-0.6. The “treat all” strategy only had a slight advantage at extremely low thresholds. The recommended threshold interval, which balances intervention costs and clinical benefits, considers ≥50% positive predictive value (PPV) and ≤50 referrals per 100 high-risk patients. Conclusions The XGBoost model established in a multicenter environment is accurate and well-calibrated in predicting potential organ donors. Combined with DCA, it may effectively guide the timing of clinical interventions and resource allocation, providing new ideas for the assessment and management of organ donation after brain death.