OBJECTIVE To conduct a clinical rapid evaluation of the marketed proprotein convertase subtilisin/kexin type 9 （PCSK9） inhibitors in China， including evolocumab， tafolecimab， recaticimab， ebronucimab， ongericimab and inclisiran. METHODS Based on the Rapid Guide for Drug Evaluation and Selection in Chinese Medical Institutions （second edition）， drug instructions， clinical diagnosis and treatment guidelines， and literature for six drugs were retrieved from CNKI， Wanfang Data， VIP， PubMed， Embase， Cochrane Library and related official websites. The clinical rapid evaluation was conducted from five aspects： pharmaceutical characteristics， effectiveness， safety， economy， and other attributes. RESULTS The pharmaceutical characteristics， effectiveness， safety， economy， other attributes， and total score of evolocumab scored 24， 27， 15.7， 10， 5.3， and 82 points， respectively. Tafolecimab scored 23.5， 23， 11.5， 9.97， 4.6， and 72.57 points， respectively. Recaticimab scored 20.5， 22， 15.5， 6.37， 3.5， and 67.87 points. Ebronucimab scored 20， 23， 11， 6.48， 3.5， and 63.98 points. Ongericimab scored 20.5， 23， 8.5， 4.83， 3.5， and 60.33 points. Inclisiran scored 25.5， 24， 13， 6.48， 5， and 73.98 points. CONCLUSIONS Evolocumab is the optimal choice for treating hypercholesterolemia and is recommended as the first-line option. Tafolecimab is the second-line option， and recaticimab is suitable for patients who are sensitive to drug adverse reactions. Inclisiran is suitable for patients with poor compliance. Ebronucimab and ongericimab are weakly recommended due to their later market introduction. Clinicians should make individualized drug selections based on factors such as patient risk level and compliance requirements.

AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

ObjectiveTo investigate the mechanism of Xiezhuo Jiedu prescription in the treatment of ulcerative colitis （UC） by inhibiting ferroptosis and alleviating intestinal mucosal injury based on the nuclear factor E₂ related factor 2/solute carrier family 7 member/glutathione peroxidase 4 （Nrf2/SLC7A11/GPX4） signaling pathway. MethodsA total of 60 male SD rats were divided into a normal group， a model group， high- and low-dose Xiezhuo Jiedu prescription groups （26.64 and 13.32 g·kg^-1， respectively）， a ferroptosis inhibitor group （Ferrostatin-1， 0.005 g·kg^-1）， and a mesalazine group （0.27 g·kg^-1）， with 10 rats in each group. A UC rat model was established by intrarectal administration of trinitrobenzene sulfonic acid （TNBS）-ethanol. The normal group and the model group were intragastrically administered normal saline. The other groups were given intragastric administration according to the corresponding dosage for 7 d. The general condition， disease activity index （DAI） score， colon length， and mucosal injury index （CDMI） score were observed in each group. The pathological changes of colon tissue in each group were observed by hematoxylin-eosin （HE） staining. The intestinal mucosa and mitochondrial morphology in each group were observed by transmission electron microscopy. The expression levels of Occludin， Claudin-1， mucin 2 （MUC2）， and E-cadherin in intestinal tissue were detected by immunofluorescence （IF）. Enzyme-linked immunosorbent assay （ELISA） was used to detect the expression levels of serum tumor necrosis factor-α （TNF-α）， interleukin-6 （IL-6）， and interleukin-10 （IL-10） in each group， and a lactic acid assay kit or ELISA was employed to detect the expression levels of reactive oxygen species （ROS）， ferrous ions （Fe²⁺）， glutathione （GSH）， malondialdehyde （MDA）， 4-hydroxynonenal （4-HNE）， diamine oxidase （DAO）， and D-lactate （D-LA）. Real-time quantitative polymerase chain reaction （Real-time PCR） was applied to detect the mRNA expression levels of Nrf2， SLC7A11， GPX4， Occludin， Claudin-1， MUC2， and E-cadherin in each group， and Western blot was adopted to detect the protein expression levels of Nrf2， p-Nrf2， SLC7A11， and GPX4 in each group. ResultsCompared with the normal group， rats in the model group exhibited listlessness， sluggish response， and mucopurulent and bloody stools. The model group also showed significantly increased DAI score， colon length， CDMI score， and expression levels of TNF-α， IL-6， ROS， Fe²⁺， MDA， 4-HNE， DAO， and D-LA （P<0.01）. In addition， it presented significantly decreased IF values of Occludin， Claudin-1， MUC2， and E-cadherin and mRNA and protein expression levels of IL-10， GSH， Nrf2， p-Nrf2， SLC7A11， and GPX4 （P<0.01）. There were different degrees of improvement in each administration group after treatment， and the improvement was the most significant in the high-dose Xiezhuo Jiedu prescription group （P<0.01）. ConclusionXiezhuo Jiedu prescription may alleviate intestinal mucosal injury by inhibiting ferroptosis of intestinal epithelial cells via regulating the Nrf2/SLC7A11/GPX4 signaling pathway， thereby exhibiting efficacy in the treatment of UC.

This paper introduces a real-world cohort research model for community-acquired pneumonia （CAP） based on the Jiangsu Traditional Chinese Medicine （TCM） Dominant Diseases Diagnosis and Treatment Data Platform. Firstly， data cleaning is performed by standardizing diagnosis， symptoms， treatment and imaging， intelligently extracting unstructured information， and cleaning and constructing a standardized database. Secondly， for cohort establishment， CAP patients across the province are screened in accordance with CAP diagnostic criteria to build a high-quality disease-specific cohort. Lastly， in terms of protocol design， the characteristics of TCM research and the CAP disease profile are considered to determine appropriate inclusion and exclusion criteria， estimate sample size， define interventions， outcomes and economic evaluations， providing a reference for real-world TCM research on CAP.

This paper introduces a real-world cohort research model for community-acquired pneumonia （CAP） based on the Jiangsu Traditional Chinese Medicine （TCM） Dominant Diseases Diagnosis and Treatment Data Platform. Firstly， data cleaning is performed by standardizing diagnosis， symptoms， treatment and imaging， intelligently extracting unstructured information， and cleaning and constructing a standardized database. Secondly， for cohort establishment， CAP patients across the province are screened in accordance with CAP diagnostic criteria to build a high-quality disease-specific cohort. Lastly， in terms of protocol design， the characteristics of TCM research and the CAP disease profile are considered to determine appropriate inclusion and exclusion criteria， estimate sample size， define interventions， outcomes and economic evaluations， providing a reference for real-world TCM research on CAP.

With the accelerating trend of population aging, the number of elderly patients with lung cancer continues to rise, and the disease burden is becoming increasingly heavy. The clinical management of these patients faces severe challenges due to their decreased physiological reserve, complex comorbidities, and significant individual heterogeneity. Consequently, under traditional diagnosis and treatment models, doctors often struggle to identify the individualized risks of elderly patients in a timely and comprehensive manner, which can easily lead to decision biases such as undertreatment or overtreatment. In view of this, this study advocates for the establishment of an umbrella decision-making model specifically tailored for elderly lung cancer patients. Grounded in a multidisciplinary team (MDT) platform, this model deeply integrates oncological indicators with the comprehensive geriatric assessment (CGA) system. By holistically considering multidimensional variables including tumor burden, organ function, frailty index, cognitive status, and social support, the model establishes an operational mechanism characterized by "single entry, precise stratification, and targeted selection". Accordingly, patients can be scientifically triaged into distinct intervention tiers, such as active surveillance, minimally invasive surgery, drug therapy, radiotherapy, and best supportive care, thereby achieving real-time alignment between treatment intensity and patient fitness. This article elaborates on the construction logic and key operational procedures of this novel decision-making framework, aiming to guide clinical practice beyond the limitations of a tumor-centric perspective toward a holistic, dynamic, whole-course management strategy. This transition seeks to ensure optimal quality of life and clinical net benefit for elderly patients alongside survival prolongation.

Objective To explore the principle of antibacterial drug therapy and the strategy of program optimization in elderly patients with Helicobacter pylori（Hp）. Methods The common therapeutic regimen of Hp was summarized, and the better therapeutic regimen of elderly Hp patients was screened ultimately. Results Amoxicillin and cefuroxime were relatively safe compared with other recommended antibacterial drugs. Using other commonly antibiotics for Hp should pay attention to the disease of patients and current drug. Conclusion Elderly patients usually suffered from a variety of diseases and required multiple drugs. The application of therapeutic regimen for elderly patients with Hp should be supposed to fully weigh the risks and benefits.

Background: Visual impairment is increasingly prevalent, underscoring the need for effective prevention strategies. This study investigated the association between cardiovascular health and visual impairment using three progressively developed metrics: Life’s Simple 7 (LS7), a cardiovascular health score developed by the American Heart Association based on 7 components, including physical activity, smoking status, body mass index (BMI), diet, blood glucose, blood pressure, and total cholesterol; Life’s Essential 8(LE8), which adds sleep health as an additional component; and Life’s Crucial 9 (LC9), which further incorporates mental health. We aimed to evaluate whether these expanded metrics provide additional explanatory value and to inform future public health strategies. Objective: To investigate the associations among LS7, LE8, and LC9 cardiovascular health scores and visual impairment in National Health and Nutrition Examination Survey 2013 to 2018, assess the added value of sleep and mental health components, and identify key contributing subcomponents using regression and machine learning methods. Methods: We analyzed data from 9891 participants in the 2013 to 2018 National Health and Nutrition Examination Survey. Multivariable logistic regression, restricted cubic spline modeling, and subgroup analyses were conducted to evaluate the association between cardiovascular health and visual impairment. Machine learning methods, including Random Forest and SHapley Additive exPlanations, a model interpretation approach used to assess feature importance, were applied. The Boruta algorithm, a feature selection method, was used to identify key subcomponents of cardiovascular health. Results: Participants with visual impairment were older, had lower poverty-to-income ratios, and exhibited lower cardiovascular health scores (LS7, LE8, and LC9). Higher cardiovascular health scores were negatively associated with visual impairment. Each one standard deviation increase in LS7, LE8, and LC9 was associated with approximately 8%, 2%, and 3% lower odds of visual impairment, respectively. LS7 showed the strongest negative association, whereas LE8 and LC9 emerged as the most important predictors in the machine learning models. Key subcomponents such as blood glucose, blood pressure, and BMI, as well as mental health status, were strongly associated with visual impairment. Conclusion: Higher cardiovascular health scores were negatively associated with visual impairment. LS7 demonstrated the strongest statistical association, whereas LE8 and LC9 were the most influential features in the machine learning models. Blood glucose, blood pressure, BMI, and mental health status were important correlates of visual impairment. From the perspective of the “prevention and treatment of diseases” in traditional Chinese medicine and the holistic concept, the aforementioned research findings confirm that severe visual impairment is indeed an external manifestation of overall health imbalance (such as organ dysfunction and Qi deficiency and blood stasis). The prevention strategy lies in comprehensively adjusting lifestyle, emotional factors, and metabolic indicators (corresponding to the key factors in the study) to restore the body’s internal balance and achieve prevention before disease arises.

ObjectiveTo explore the mechanism by which Xianglian Huazhuo prescription ameliorates chronic atrophic gastritis （CAG） through regulating the Golgi protein 73 （GP73）/protein kinase R-like endoplasmic reticulum kinase （PERK）/activating transcription factor 4 （ATF4） signaling pathway and modulating endoplasmic reticulum stress （ERS）. MethodA mouse model of CAG was induced by multiple factors， including ranitidine， N-methyl-N′-nitro-N-nitrosoguanidine （MNNG）， and irregular feeding. The CAG mice were randomized into five groups： model， Morodan （2.0 g·kg^-1）， and high-dose， medium-dose， and low-dose （7.6， 3.8， 1.9 g·kg^-1， respectively） Xianglian Huazhuo prescription， with 10 mice in each group. At the same time， 10 mice in normal group were set up. The mice in the Morodan group and the high-dose， medium-dose， and low-dose groups of Xianglian Huazhuo prescription were administrated with corresponding agents by gavage， and those in the normal group and the model group were administrated with an equal volume of normal saline. All the mice were intervened once a day for 60 consecutive days. After the last administration， the overall morphological changes of the gastric tissue were observed. Hematoxylin-eosin （HE） staining and transmission electron microscopy （TEM） were used to evaluate the pathological morphology and the endoplasmic reticulum ultrastructure in the gastric tissue. The serum levels of pepsinogen Ⅰ （PGⅠ）， pepsinogen Ⅱ （PGⅡ）， gastrin-17 （G-17）， and GP73 were determined by enzyme-linked immunosorbent assay （ELISA）. The pepsinogen ratio （PGR， PGⅠ/PGⅡ） was calculated. The protein levels of GP73， PERK， phosphorylated （p）-PERK， glucose-regulated protein 78 （GRP78）， ATF4， CCAAT enhancer-binding protein homologous protein （CHOP）， cysteinyl aspartate-specific protease-12 （Caspase-12）， B-cell lymphoma-2 （Bcl-2）， and Bcl-2-associated X protein （Bax） were assessed by Western blot. The expression of GRP78 was detected by immunofluorescence （IF） assay， and the location of Bcl-2 and Bax by immunohistochemistry （IHC）. ResultsCompared with the normal group， the model group showed pale gastric mucosa with flattened folds and reduced and loosely arranged gastric mucosal glands， declined serum levels of PGI， PGR， G-17， and GP73 （P<0.01）. downregulated protein levels of GP73， p-PERK， ATF4， GRP78， CHOP， Caspase-12， and Bax in the gastric tissue， and upregulated protein level of Bcl-2 （P<0.01）. Compared with the model group， the Morodan group and each Xianglian Huazhuo prescription group exhibited red gastric mucosa with increased folds， alleviated pathological damage， swelling endoplasmic reticulum， elevated serum levels of PGI， G-17， and GP73 （P<0.05， P<0.01）， and upregulated protein levels of Caspase-12 and Bax and downregulated protein level of Bcl-2 in the gastric tissue （P<0.05， P<0.01）. The Morodan group and the high-dose and medium-dose Xianglian Huazhuo prescription groups exhibited increased serum level of PGR （P<0.05， P<0.01） and upregulated protein levels of GP73， p-PERK， ATF4， GRP78， and CHOP in the gastric tissue （P<0.05， P<0.01）. ConclusionXianglian Huazhuo prescription can activate the GP73/PERK/ATF4 signaling pathway and induce ERS-mediated apoptosis to alleviate the pathological damage of the gastric mucosa， thereby demonstrating a protective effect against CAG in mice.

ObjectiveTo explore the mechanism by which Xianglian Huazhuo prescription ameliorates chronic atrophic gastritis （CAG） through regulating the Golgi protein 73 （GP73）/protein kinase R-like endoplasmic reticulum kinase （PERK）/activating transcription factor 4 （ATF4） signaling pathway and modulating endoplasmic reticulum stress （ERS）. MethodA mouse model of CAG was induced by multiple factors， including ranitidine， N-methyl-N′-nitro-N-nitrosoguanidine （MNNG）， and irregular feeding. The CAG mice were randomized into five groups： model， Morodan （2.0 g·kg^-1）， and high-dose， medium-dose， and low-dose （7.6， 3.8， 1.9 g·kg^-1， respectively） Xianglian Huazhuo prescription， with 10 mice in each group. At the same time， 10 mice in normal group were set up. The mice in the Morodan group and the high-dose， medium-dose， and low-dose groups of Xianglian Huazhuo prescription were administrated with corresponding agents by gavage， and those in the normal group and the model group were administrated with an equal volume of normal saline. All the mice were intervened once a day for 60 consecutive days. After the last administration， the overall morphological changes of the gastric tissue were observed. Hematoxylin-eosin （HE） staining and transmission electron microscopy （TEM） were used to evaluate the pathological morphology and the endoplasmic reticulum ultrastructure in the gastric tissue. The serum levels of pepsinogen Ⅰ （PGⅠ）， pepsinogen Ⅱ （PGⅡ）， gastrin-17 （G-17）， and GP73 were determined by enzyme-linked immunosorbent assay （ELISA）. The pepsinogen ratio （PGR， PGⅠ/PGⅡ） was calculated. The protein levels of GP73， PERK， phosphorylated （p）-PERK， glucose-regulated protein 78 （GRP78）， ATF4， CCAAT enhancer-binding protein homologous protein （CHOP）， cysteinyl aspartate-specific protease-12 （Caspase-12）， B-cell lymphoma-2 （Bcl-2）， and Bcl-2-associated X protein （Bax） were assessed by Western blot. The expression of GRP78 was detected by immunofluorescence （IF） assay， and the location of Bcl-2 and Bax by immunohistochemistry （IHC）. ResultsCompared with the normal group， the model group showed pale gastric mucosa with flattened folds and reduced and loosely arranged gastric mucosal glands， declined serum levels of PGI， PGR， G-17， and GP73 （P<0.01）. downregulated protein levels of GP73， p-PERK， ATF4， GRP78， CHOP， Caspase-12， and Bax in the gastric tissue， and upregulated protein level of Bcl-2 （P<0.01）. Compared with the model group， the Morodan group and each Xianglian Huazhuo prescription group exhibited red gastric mucosa with increased folds， alleviated pathological damage， swelling endoplasmic reticulum， elevated serum levels of PGI， G-17， and GP73 （P<0.05， P<0.01）， and upregulated protein levels of Caspase-12 and Bax and downregulated protein level of Bcl-2 in the gastric tissue （P<0.05， P<0.01）. The Morodan group and the high-dose and medium-dose Xianglian Huazhuo prescription groups exhibited increased serum level of PGR （P<0.05， P<0.01） and upregulated protein levels of GP73， p-PERK， ATF4， GRP78， and CHOP in the gastric tissue （P<0.05， P<0.01）. ConclusionXianglian Huazhuo prescription can activate the GP73/PERK/ATF4 signaling pathway and induce ERS-mediated apoptosis to alleviate the pathological damage of the gastric mucosa， thereby demonstrating a protective effect against CAG in mice.