ObjectiveTo investigate the mechanism of Xiezhuo Jiedu prescription in the treatment of ulcerative colitis （UC） by inhibiting ferroptosis and alleviating intestinal mucosal injury based on the nuclear factor E₂ related factor 2/solute carrier family 7 member/glutathione peroxidase 4 （Nrf2/SLC7A11/GPX4） signaling pathway. MethodsA total of 60 male SD rats were divided into a normal group， a model group， high- and low-dose Xiezhuo Jiedu prescription groups （26.64 and 13.32 g·kg^-1， respectively）， a ferroptosis inhibitor group （Ferrostatin-1， 0.005 g·kg^-1）， and a mesalazine group （0.27 g·kg^-1）， with 10 rats in each group. A UC rat model was established by intrarectal administration of trinitrobenzene sulfonic acid （TNBS）-ethanol. The normal group and the model group were intragastrically administered normal saline. The other groups were given intragastric administration according to the corresponding dosage for 7 d. The general condition， disease activity index （DAI） score， colon length， and mucosal injury index （CDMI） score were observed in each group. The pathological changes of colon tissue in each group were observed by hematoxylin-eosin （HE） staining. The intestinal mucosa and mitochondrial morphology in each group were observed by transmission electron microscopy. The expression levels of Occludin， Claudin-1， mucin 2 （MUC2）， and E-cadherin in intestinal tissue were detected by immunofluorescence （IF）. Enzyme-linked immunosorbent assay （ELISA） was used to detect the expression levels of serum tumor necrosis factor-α （TNF-α）， interleukin-6 （IL-6）， and interleukin-10 （IL-10） in each group， and a lactic acid assay kit or ELISA was employed to detect the expression levels of reactive oxygen species （ROS）， ferrous ions （Fe²⁺）， glutathione （GSH）， malondialdehyde （MDA）， 4-hydroxynonenal （4-HNE）， diamine oxidase （DAO）， and D-lactate （D-LA）. Real-time quantitative polymerase chain reaction （Real-time PCR） was applied to detect the mRNA expression levels of Nrf2， SLC7A11， GPX4， Occludin， Claudin-1， MUC2， and E-cadherin in each group， and Western blot was adopted to detect the protein expression levels of Nrf2， p-Nrf2， SLC7A11， and GPX4 in each group. ResultsCompared with the normal group， rats in the model group exhibited listlessness， sluggish response， and mucopurulent and bloody stools. The model group also showed significantly increased DAI score， colon length， CDMI score， and expression levels of TNF-α， IL-6， ROS， Fe²⁺， MDA， 4-HNE， DAO， and D-LA （P<0.01）. In addition， it presented significantly decreased IF values of Occludin， Claudin-1， MUC2， and E-cadherin and mRNA and protein expression levels of IL-10， GSH， Nrf2， p-Nrf2， SLC7A11， and GPX4 （P<0.01）. There were different degrees of improvement in each administration group after treatment， and the improvement was the most significant in the high-dose Xiezhuo Jiedu prescription group （P<0.01）. ConclusionXiezhuo Jiedu prescription may alleviate intestinal mucosal injury by inhibiting ferroptosis of intestinal epithelial cells via regulating the Nrf2/SLC7A11/GPX4 signaling pathway， thereby exhibiting efficacy in the treatment of UC.

This paper introduces a real-world cohort research model for community-acquired pneumonia （CAP） based on the Jiangsu Traditional Chinese Medicine （TCM） Dominant Diseases Diagnosis and Treatment Data Platform. Firstly， data cleaning is performed by standardizing diagnosis， symptoms， treatment and imaging， intelligently extracting unstructured information， and cleaning and constructing a standardized database. Secondly， for cohort establishment， CAP patients across the province are screened in accordance with CAP diagnostic criteria to build a high-quality disease-specific cohort. Lastly， in terms of protocol design， the characteristics of TCM research and the CAP disease profile are considered to determine appropriate inclusion and exclusion criteria， estimate sample size， define interventions， outcomes and economic evaluations， providing a reference for real-world TCM research on CAP.

This paper introduces a real-world cohort research model for community-acquired pneumonia （CAP） based on the Jiangsu Traditional Chinese Medicine （TCM） Dominant Diseases Diagnosis and Treatment Data Platform. Firstly， data cleaning is performed by standardizing diagnosis， symptoms， treatment and imaging， intelligently extracting unstructured information， and cleaning and constructing a standardized database. Secondly， for cohort establishment， CAP patients across the province are screened in accordance with CAP diagnostic criteria to build a high-quality disease-specific cohort. Lastly， in terms of protocol design， the characteristics of TCM research and the CAP disease profile are considered to determine appropriate inclusion and exclusion criteria， estimate sample size， define interventions， outcomes and economic evaluations， providing a reference for real-world TCM research on CAP.

AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

OBJECTIVE To conduct a clinical rapid evaluation of the marketed proprotein convertase subtilisin/kexin type 9 （PCSK9） inhibitors in China， including evolocumab， tafolecimab， recaticimab， ebronucimab， ongericimab and inclisiran. METHODS Based on the Rapid Guide for Drug Evaluation and Selection in Chinese Medical Institutions （second edition）， drug instructions， clinical diagnosis and treatment guidelines， and literature for six drugs were retrieved from CNKI， Wanfang Data， VIP， PubMed， Embase， Cochrane Library and related official websites. The clinical rapid evaluation was conducted from five aspects： pharmaceutical characteristics， effectiveness， safety， economy， and other attributes. RESULTS The pharmaceutical characteristics， effectiveness， safety， economy， other attributes， and total score of evolocumab scored 24， 27， 15.7， 10， 5.3， and 82 points， respectively. Tafolecimab scored 23.5， 23， 11.5， 9.97， 4.6， and 72.57 points， respectively. Recaticimab scored 20.5， 22， 15.5， 6.37， 3.5， and 67.87 points. Ebronucimab scored 20， 23， 11， 6.48， 3.5， and 63.98 points. Ongericimab scored 20.5， 23， 8.5， 4.83， 3.5， and 60.33 points. Inclisiran scored 25.5， 24， 13， 6.48， 5， and 73.98 points. CONCLUSIONS Evolocumab is the optimal choice for treating hypercholesterolemia and is recommended as the first-line option. Tafolecimab is the second-line option， and recaticimab is suitable for patients who are sensitive to drug adverse reactions. Inclisiran is suitable for patients with poor compliance. Ebronucimab and ongericimab are weakly recommended due to their later market introduction. Clinicians should make individualized drug selections based on factors such as patient risk level and compliance requirements.

With the accelerating trend of population aging, the number of elderly patients with lung cancer continues to rise, and the disease burden is becoming increasingly heavy. The clinical management of these patients faces severe challenges due to their decreased physiological reserve, complex comorbidities, and significant individual heterogeneity. Consequently, under traditional diagnosis and treatment models, doctors often struggle to identify the individualized risks of elderly patients in a timely and comprehensive manner, which can easily lead to decision biases such as undertreatment or overtreatment. In view of this, this study advocates for the establishment of an umbrella decision-making model specifically tailored for elderly lung cancer patients. Grounded in a multidisciplinary team (MDT) platform, this model deeply integrates oncological indicators with the comprehensive geriatric assessment (CGA) system. By holistically considering multidimensional variables including tumor burden, organ function, frailty index, cognitive status, and social support, the model establishes an operational mechanism characterized by "single entry, precise stratification, and targeted selection". Accordingly, patients can be scientifically triaged into distinct intervention tiers, such as active surveillance, minimally invasive surgery, drug therapy, radiotherapy, and best supportive care, thereby achieving real-time alignment between treatment intensity and patient fitness. This article elaborates on the construction logic and key operational procedures of this novel decision-making framework, aiming to guide clinical practice beyond the limitations of a tumor-centric perspective toward a holistic, dynamic, whole-course management strategy. This transition seeks to ensure optimal quality of life and clinical net benefit for elderly patients alongside survival prolongation.

Objective To explore the principle of antibacterial drug therapy and the strategy of program optimization in elderly patients with Helicobacter pylori（Hp）. Methods The common therapeutic regimen of Hp was summarized, and the better therapeutic regimen of elderly Hp patients was screened ultimately. Results Amoxicillin and cefuroxime were relatively safe compared with other recommended antibacterial drugs. Using other commonly antibiotics for Hp should pay attention to the disease of patients and current drug. Conclusion Elderly patients usually suffered from a variety of diseases and required multiple drugs. The application of therapeutic regimen for elderly patients with Hp should be supposed to fully weigh the risks and benefits.

[Objective] To analyze the loss rate of platelet donors and evaluate the strategies for establishing a platelet donor bank. [Methods] A total of 1 443 donors who joined the HLA and HPA gene donor bank for platelets in Henan Province from 2018 to 2020 were included in this study. Data on the total number of apheresis platelet donations, annual donation frequency, age at enrollment, donation habits (including the number of platelets donated per session and whether they had previously donated whole blood), and enrollment location were collected from the platelet donor information management system. Donor loss was determined based on the date of their last donation. The loss rates of different groups under various conditions were compared to assess the enrollment strategies. [Results] By the time the platelet bank was officially operational in 2022, 421 donors had been lost, resulting in an loss rate of 29% (421/1 443). By the end of 2023, the overall cumulative loss rate reached 52% (746/1 443). The loss rate was lower than the overall level in groups meeting any of the following conditions: total apheresis platelet donations exceeding 50, annual donation frequency of 10 or more, age at enrollment of 40 years or older, donation of more than a single therapeutic dose per session, or a history of whole blood donation two or more times. Additionally, loss rates varied across different enrollment locations, with higher enrollment numbers generally associated with higher loss rates. [Conclusion] Through a comprehensive analysis of donor loss, our center has adjusted its strategies for establishing the donor pool. These findings also provide valuable insights for other blood collection and supply institutions in building platelet donor banks.

ObjectiveTo explore the potential mechanism of Xiezhuo Jiedu prescription in regulating autophagy in the treatment of ulcerative colitis （UC） by bioinformatics and animal experiments. MethodsThe differentially expressed genes （DEGs） in the colonic mucosal tissue of UC patients was obtained from the Gene Expression Omnibus （GEO）， and those overlapped with autophagy genes were obtained as the differentially expressed autophagy-related genes （DEARGs）. DEARGs were imported into Metascape and STRING， respectively， for gene ontology/Kyoto Encyclopedia of Genes and Genomics （GO/KEGG） enrichment analysis and protein-protein interaction （PPI） analysis. Finally， 15 key DEARGs were obtained. The core DEARGs were obtained by least absolute shrinkage and selection operator （LASSO） regression and receiver operating characteristic curve （ROC） analysis. The CIBERSORT deconvolution algorithm was used to analyze the immunoinfiltration of UC patients and the correlations between core DEARGs and immune cells. C57BL/6J mice were assigned into a normal group and a modeling group. The mouse model of UC was established by free drinking of 2.5% dextran sulfate sodium. The modeled mice were assigned into low-， medium-， and high-dose Xiezhuo Jiedu prescription and mesalazine groups according to the random number table method and administrated with corresponding agents by gavage for 7 days. The colonic mucosal morphology was observed by hematoxylin-eosin staining. The protein and mRNA levels of cysteinyl aspartate-specific proteinase 1 （Caspase-1）， cathepsin B （CTSB）， C-C motif chemokine-2 （CCL2）， CXC motif receptor 4 （CXCR4）， and hypoxia-inducing factor-1α （HIF-1α） in the colon tissue were determined by Western blot and real-time fluorescence quantitative polymerase chain reaction， respectively. ResultsThe dataset GSE87466 was screened from GEO and interlaced with autophagy genes. After PPI analysis， LASSO regression， and ROC analysis， the core DEARGs （Caspase-1， CCL2， CTSB， and CXCR4） were obtained. The results of immunoinfiltration analysis showed that the counts of NK cells， M0 macrophages， M1 macrophages， and dendritic cells in the colonic mucosal tissue of UC patients had significant differences， and core DEARGs had significant correlations with these immune cells. This result， combined with the prediction results of network pharmacology， suggested that the HIF-1α signaling pathway may play a key role in the regulation of UC by Xiezhuo Jiedu prescription. The animal experiments showed that Xiezhuo Jiedu prescription significantly alleviated colonic mucosal inflammation in UC mice. Compared with the normal group， the model group showed up-regulated protein and mRNA levels of caspase-1， CCL2， CTSB， CXCR4， and HIF-1α， which were down-regulated after treatment with Xiezhuo Jiedu prescription or mesalazine. ConclusionCaspase-1， CCL2， CTSB， and CXCR4 are autophagy genes that are closely related to the onset of UC. Xiezhuo Jiedu prescription can down-regulate the expression of core autophagy genes to alleviate the inflammation in the colonic mucosa of mice.

OBJECTIVE: To investigate the protective effects of stir-fried Semen Armeniacae Amarum (SAA) against aristolochic acid I (AAI)-induced nephrotoxicity and DNA adducts and elucidate the underlying mechanism involved for ensuring the safe use of Asari Radix et Rhizoma. METHODS: In vitro, HEK293T cells overexpressing Flag-tagged multidrug resistance-associated protein 3 (MRP3) were constructed by Lentiviral transduction, and inhibitory effect of top 10 common pairs of medicinal herbs with Asari Radix et Rhizoma in clinic on MRP3 activity was verified using a self-constructed fluorescence screening system. The mRNA, protein expressions, and enzyme activity levels of NAD(P)H quinone dehydrogenase 1 (NQO1) and cytochrome P450 1A2 (CYP1A2) were measured in differentiated HepaRG cells. Hepatocyte toxicity after inhibition of AAI metabolite transport was detected using cell counting kit-8 assay. In vivo, C57BL/6 mice were randomly divided into 5 groups according to a random number table, including: control (1% sodium bicarbonate), AAI (10 mg/kg), stir-fried SAA (1.75 g/kg) and AAI + stir-fried SAA (1.75 and 8.75 g/kg) groups, 6 mice in each group. After 7 days of continuous gavage administration, liver and kidney damages were assessed, and the protein expressions and enzyme activity of liver metabolic enzymes NQO1 and CYP1A2 were determined simultaneously. RESULTS: In vivo, combination of 1.75 g/kg SAA and 10 mg/kg AAI suppressed AAI-induced nephrotoxicity and reduced dA-ALI formation by 26.7%, and these detoxification effects in a dose-dependent manner (P<0.01). Mechanistically, SAA inhibited MRP3 transport in vitro, downregulated NQO1 expression in vivo, increased CYP1A2 expression and enzymatic activity in vitro and in vivo, respectively (P<0.05 or P<0.01). Notably, SAA also reduced AAI-induced hepatotoxicity throughout the detoxification process, as indicated by a 41.3% reduction in the number of liver adducts (P<0.01). CONCLUSIONS Stir-fried SAA is a novel drug candidate for the suppression of AAI-induced liver and kidney damages. The protective mechanism may be closely related to the regulation of transporters and metabolic enzymes.
Aristolochic Acids/toxicity* ; Animals ; Humans ; NAD(P)H Dehydrogenase (Quinone)/genetics* ; HEK293 Cells ; Kidney/pathology* ; Cytochrome P-450 CYP1A2/genetics* ; Mice, Inbred C57BL ; DNA Adducts/drug effects* ; Male ; Kidney Diseases/drug therapy* ; Drugs, Chinese Herbal/therapeutic use* ; Mice ; Prunus armeniaca ; Plant Extracts