AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

Objective To explore the efficacy and safety of oral solution of magnesium sodium potassium sulfate in bowel preparation before colonoscopy. Methods Patients who planned to undergo colonoscopy at the digestive department of the Ninth People’s Hospital, affiliated to School of Medicine of Shanghai Jiao Tong University from January 2023 to August 2023 were selected and eligible subjects were divided into two groups: Group A took polyethylene glycol （PEG） and Group B took oral solution of magnesium sodium potassium sulfate （OSS）. The quality, drug tolerance, and safety of intestinal preparation were evaluated. The quality of bowel preparation was evaluated by the boston bowel preparation scale （BBPS）. Results The right colon BBPS score of Group B was (2.39±0.82) points, which was significantly higher than of Group A (2.11±0.43) points （P<0.05）. The overall score of Group B was higher than that of Group A （P<0.05）. OSS was easier to take than PEG, with a good taste and overall sensation. Patients were willing to use OSS to clean their bowels even when they were willing to undergo another examination （P<0.05）. There was a significant difference in nausea and vomiting symptoms between the two groups （P<0.05）, and there were no significant changes in renal function and electrolytes before and after medication in the two groups of patients. Conclusion OSS had a higher quality of bowel cleaning and was easier for patients to accept.

ObjectiveTobacco-related diseases remain one of the leading preventable public health challenges worldwide and are among the primary causes of premature death. In recent years, accumulating evidence has supported the classification of nicotine addiction as a chronic brain disease, profoundly affecting both brain structure and function. Despite the urgency, effective diagnostic methods for smoking addiction remain lacking, posing significant challenges for early intervention and treatment. To address this issue and gain deeper insights into the neural mechanisms underlying nicotine dependence, this study proposes a novel graph neural network framework, termed TI-GNN. This model leverages functional magnetic resonance imaging (fMRI) data to identify complex and subtle abnormalities in brain connectivity patterns associated with smoking addiction. MethodsThe study utilizes fMRI data to construct functional connectivity matrices that represent interaction patterns among brain regions. These matrices are interpreted as graphs, where brain regions are nodes and the strength of functional connectivity between them serves as edges. The proposed TI-GNN model integrates a Transformer module to effectively capture global interactions across the entire brain network, enabling a comprehensive understanding of high-level connectivity patterns. Additionally, a spatial attention mechanism is employed to selectively focus on informative inter-regional connections while filtering out irrelevant or noisy features. This design enhances the model’s ability to learn meaningful neural representations crucial for classification tasks. A key innovation of TI-GNN lies in its built-in causal interpretation module, which aims to infer directional and potentially causal relationships among brain regions. This not only improves predictive performance but also enhances model interpretability—an essential attribute for clinical applications. The identification of causal links provides valuable insights into the neuropathological basis of addiction and contributes to the development of biologically plausible and trustworthy diagnostic tools. ResultsExperimental results demonstrate that the TI-GNN model achieves superior classification performance on the smoking addiction dataset, outperforming several state-of-the-art baseline models. Specifically, TI-GNN attains an accuracy of 0.91, an F1-score of 0.91, and a Matthews correlation coefficient (MCC) of 0.83, indicating strong robustness and reliability. Beyond performance metrics, TI-GNN identifies critical abnormal connectivity patterns in several brain regions implicated in addiction. Notably, it highlights dysregulations in the amygdala and the anterior cingulate cortex, consistent with prior clinical and neuroimaging findings. These regions are well known for their roles in emotional regulation, reward processing, and impulse control—functions that are frequently disrupted in nicotine dependence. ConclusionThe TI-GNN framework offers a powerful and interpretable tool for the objective diagnosis of smoking addiction. By integrating advanced graph learning techniques with causal inference capabilities, the model not only achieves high diagnostic accuracy but also elucidates the neurobiological underpinnings of addiction. The identification of specific abnormal brain networks and their causal interactions deepens our understanding of addiction pathophysiology and lays the groundwork for developing targeted intervention strategies and personalized treatment approaches in the future.

The purpose of the present study was to investigate the effects of resistance combined with aerobic chrono-exercise on the common carotid artery elasticity and hemodynamics. 24 healthy young men (21.96±0.43 years old) underwent a single acute resistance combined with aerobic exercise intervention at eight time periods (6, 8, 10, 12, 14, 16, 18, and 20 o'clock). The axial flow velocity and diameter waveforms of the common carotid artery were measured, and the hemodynamics were calculated using the classical hemodynamic theory before exercise, immediately after exercise, 10 min and 20 min after exercise. The results showed that during exercise recovery, systolic and mean pressures decreased more markedly after exercise at 8 o'clock (P < 0.05); At 20 min post-exercise, arterial stiffness index and pressure-strain elastic modulus after exercise at 6 o'clock were reduced compared with the resting state, but were significantly elevated after exercise at 20 o'clock (P < 0.05). Immediately after exercise, the pressure rise was higher after exercise at 6 o'clock and the mean wall shear stress was higher after exercise at 20 o'clock (P < 0.05). These results suggest that resistance combined with aerobic chrono-exercise produces different effects on common carotid artery hemodynamics in young men. A single acute session of resistance combined with aerobic exercise at 8 o'clock is more effective in lowering blood pressure. Exercise at 6 o'clock is beneficial to improve arterial elasticity but is not recommended for young male individuals with cardiovascular disease risks because of the excessive increase in blood pressure immediately after exercise. Exercise at 20 o'clock is more effective in improving wall shear stress but is accompanied by elevated arterial stiffness indices and pressure-strain elastic modulus. These results provide a scientific basis for healthy young men in choosing the time of exercise by exploring the common carotid artery elasticity and hemodynamic-related indices.
Humans ; Male ; Young Adult ; Exercise/physiology* ; Carotid Artery, Common/physiology* ; Hemodynamics/physiology* ; Vascular Stiffness/physiology* ; Elasticity ; Resistance Training ; Adult

Fermented traditional Chinese medicine(TCM) has a long history of medicinal use, such as Sojae Semen Praeparatum, Arisaema Cum Bile, Pinelliae Rhizoma Fermentata, red yeast rice, and Jianqu. Fermentation technology was recorded in the earliest TCM work, Shen Nong's Classic of the Materia Medica. Microorganisms are essential components of the fermentation process. However, the contamination of fermented TCM by toxigenic fungi and mycotoxins due to unstandardized fermentation processes seriously affects the quality of TCM and poses a threat to the life and health of consumers. In this paper, the characteristics, microbial composition, and mycotoxin profile of fermented TCM are systematically summarized to provide a theoretical basis for its quality and safety control.
Fermentation ; Mycotoxins/analysis* ; Drugs, Chinese Herbal/analysis* ; Fungi/classification* ; Bacteria/genetics* ; Drug Contamination ; Medicine, Chinese Traditional

The 95% ethanol extract of Stephania hernandifolia was isolated and purified by column chromatography on silica gel and Sephadex LH-20, RP-18 medium-pressure liquid chromatography, and semi-preparative high performance liquid chromatography. The chemical structures of the compounds were identified by NMR and high-resolution mass spectrometry. Four alkaloids were isolated and identified as(-)-8-oxo-2,3,4,10,11-pentamethoxyberberine(1),(-)-8-oxo-11-hydroxy-2,3,4,10-tetramethoxyberberine(2), N-trans-feruloyl tyramine(3), and N-cis-feruloyl tyramine(4). Compounds 1 and 2 were new protoberberine alkaloids, while compounds 3 and 4 were amide alkaloids. All the four compounds were separated from this plant for the first time. The inhibitory activities of compounds 1, 3, and 4 against α-glycosidase were measured by the enzymatic reaction in vitro with 4-nitrophenyl-α-D-glucopyranoside(PNPG) as the substrate. Compounds 3 and 4 showed inhibitory activities against α-glucosidase, with median inhibition concentration(IC_(50)) values of(7.09±0.42) and(31.25±1.14) μmol·L~(-1), respectively.
Berberine Alkaloids/isolation & purification* ; Stephania/chemistry* ; Drugs, Chinese Herbal/isolation & purification* ; Molecular Structure ; alpha-Glucosidases/metabolism* ; Chromatography, High Pressure Liquid ; Alkaloids/isolation & purification*

Metabonomics and proteomics were employed to investigate the mechanism of Yuzhi Zhixue Granules in treating polycystic ovary syndrome with insulin resistance(PCOS-IR). The disease model was established by feeding a high-fat diet and gavage of letrozole solution and it was then treated with different doses of Yuzhi Zhixue Granules. The therapeutic effect of Yuzhi Zhixue Granules was evaluated based on the body mass, homeostasis model assessment of insulin resistance and insulin sensitivity index, serum levels of adipokines, and histopathological changes of rats. Metabolomics and proteomics were employed to find the action pathways of Yuzhi Zhixue Granules. The results showed that Yuzhi Zhixue Granules reduced the body mass, improved the insulin sensitivity and aromatase activity, improved the levels of leptin, adiponectin and other adipokines, and alleviated insulin resistance, histopathological changes, and metabolic disorders in PCOS-IR rats. Metabolomics results revealed 14 metabolites with altered levels in the ovarian tissue, which were closely related to glutathione metabolism and pyruvate metabolism. Proteomics results showed that the therapeutic effect of Yuzhi Zhixue Granules was mainly related to the adipokine, adenosine 5'-monophosphate(AMP)-activated protein kinase(AMPK), phosphatidylinositol 3-kinase/protein kinase B(PI3K/Akt), forkhead box protein O(FoxO), and mechanistic target of rapamycin(mTOR) signaling pathways. Western blot results showed that compared with the model group, Yuzhi Zhixue Granules treatment decreased the p-AMPK/AMPK and p-FoxO1/FoxO1 levels, increased the p-mTOR/mTOR level, and up-regulated the expression level of recombinant glucose transporter 4(GLUT4). Yuzhi Zhixue Granules can balance amino acid metabolism and pyruvate metabolism by regulating the AMPK/mTOR/FoxO/GLUT pathway to maintain the homeostasis of the ovarian environment and alleviate insulin resistance, thus treating PCOS-IR.
Animals ; Female ; Insulin Resistance ; Polycystic Ovary Syndrome/genetics* ; Drugs, Chinese Herbal/administration & dosage* ; Rats ; Metabolomics ; Proteomics ; Rats, Sprague-Dawley ; Humans ; Ovary/metabolism* ; Signal Transduction/drug effects*

This study aimed to investigate the effects of Zhiwei Fuwei Pills on mitochondrial apoptosis in the rat model of precancerous lesions of gastric cancer(PLGC) based on the microRNA-21(miRNA-21)/B-cell lymphoma-2(Bcl-2) signaling pathway. Eighty-five 5-week-old male SPF-grade SD rats were selected, of which 75 were fed with N-methyl-N'-nitro-N-nitrosoguanidine(MNNG) for multifactorial modeling, and the PLGC model was established after 26 weeks. The rats were randomly grouped as follows: model, folic acid(0.002 g·kg~(-1)), low-dose(0.42 g·kg~(-1)) Zhiwei Fuwei Pills, medium-dose(0.84 g·kg~(-1)) Zhiwei Fuwei Pills, and high-dose(1.67 g·kg~(-1)) Zhiwei Fuwei Pills, with 15 rats in each group. Additionally, 10 rats were assigned to a blank group and administrated with an equivalent volume of normal saline by gavage. After four weeks of continuous drug administration, the gastric mucosal tissue was collected. Hematoxylin-eosin(HE) staining was performed to reveal the pathological changes in the gastric mucosa. Terminal deoxynucleotidyl transferase dUTP nick end labeling(TUNEL) was employed to detect apoptosis in gastric mucosal epithelial cells. RT-PCR was adopted to determine the mRNA levels of miRNA-21, phosphatase and tensin homolog(PTEN), Bcl-2, Bcl-2-associated X protein(Bax), and cysteinyl aspartate-specific protease 3(caspase-3). Western blot was employed to determine the protein levels of PTEN, Bcl-2, Bax, and caspase-3. Immunohistochemistry(IHC) was used to detect the positive expression of PTEN, Bcl-2, and Bax in the gastric mucosal tissue. Transmission electron microscopy(TEM) was employed to observe the morphological and structural changes in mitochondria. The results showed that compared with model group, the drug administration groups showed alleviated pathological changes, with increased apoptotic cells, down-regulated mRNA levels of miRNA-21 and Bcl-2, up-regulated mRNA and protein levels of PTEN, Bax, and caspase-3, and down-regulated protein level of Bcl-2. In addition, the drug administration groups exhibited mitochondrial swelling and rupture and reduction of cristae, which indicated mitochondrial apoptosis. These findings suggest that Zhiwei Fuwei Pills can effectively improve mitochondrial apoptosis in PLGC cells by regulating the miRNA-21/Bcl-2 signaling pathway.
Animals ; MicroRNAs/metabolism* ; Male ; Apoptosis/drug effects* ; Stomach Neoplasms/physiopathology* ; Proto-Oncogene Proteins c-bcl-2/genetics* ; Rats ; Rats, Sprague-Dawley ; Drugs, Chinese Herbal/administration & dosage* ; Mitochondria/genetics* ; Signal Transduction/drug effects* ; Precancerous Conditions/drug therapy* ; Humans ; PTEN Phosphohydrolase/genetics*

Sepsis is a systemic inflammatory response caused by severe infection or trauma, and is one of the common causes of acute lung injury(ALI) and acute respiratory distress syndrome(ARDS). Sepsis-acute lung injury(SALI) is a critical clinical condition with high morbidity and mortality. Its pathogenesis is complex and not yet fully understood, and there is currently a lack of targeted and effective treatment options. Pyroptosis, a novel form of programmed cell death, plays a key role in the pathological process of SALI by activating inflammasomes and releasing inflammatory factors, making it a potential therapeutic target. In recent years, the role of traditional Chinese medicine(TCM) in regulating signaling pathways related to pyroptosis through multi-components and multi-targets has attracted increasing attention. TCM may intervene in pyroptosis by inhibiting the activation of NLRP3 inflammasomes and regulating the expression of Caspase family proteins, thus alleviating inflammatory damage in lung tissues. This paper systematically reviews the molecular regulatory network of pyroptosis in SALI and explores the potential mechanisms and research progress on TCM intervention in cellular pyroptosis. The aim is to provide new ideas and theoretical support for basic research and clinical treatment strategies of TCM in SALI.
Pyroptosis/drug effects* ; Humans ; Sepsis/genetics* ; Acute Lung Injury/physiopathology* ; Animals ; Drugs, Chinese Herbal/therapeutic use* ; Medicine, Chinese Traditional ; Inflammasomes/metabolism* ; NLR Family, Pyrin Domain-Containing 3 Protein/genetics*

Subtype classification of age-related macular degeneration (AMD) based on optical coherence tomography (OCT) images serves as an effective auxiliary tool for clinicians in diagnosing disease progression and formulating treatment plans. To improve the classification accuracy of AMD subtypes, this study proposes a keypoint-based, attention-enhanced residual network (KPA-ResNet). The proposed architecture adopts a 50-layer residual network (ResNet-50) as the backbone, preceded by a keypoint localization module based on heatmap regression to outline critical lesion regions. A two-dimensional relative self-attention mechanism is incorporated into convolutional layers to enhance the representation of key lesion areas. Furthermore, the network depth is appropriately increased and an improved residual module, ConvNeXt, is introduced to enable comprehensive extraction of high-dimensional features and enrich the detail of lesion boundary contours, ultimately achieving higher classification accuracy of AMD subtypes. Experimental results demonstrate that KPA-ResNet achieves significant improvements in overall classification accuracy compared with conventional convolutional neural networks. Specifically, for the wet AMD subtypes, the classification accuracies for inactive choroidal neovascularization (CNV) and active CNV reach 92.8% and 95.2%, respectively, representing substantial improvement over ResNet-50. These findings validate the superior performance of KPA-ResNet in AMD subtype classification tasks. This work provides a high-accuracy, generalizable network architecture for OCT-based AMD subtype classification and offers new insights into integrating attention mechanisms with convolutional neural networks in ophthalmic image analysis.
Tomography, Optical Coherence/methods* ; Humans ; Macular Degeneration/diagnostic imaging* ; Neural Networks, Computer