AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

Objective To explore the efficacy and safety of oral solution of magnesium sodium potassium sulfate in bowel preparation before colonoscopy. Methods Patients who planned to undergo colonoscopy at the digestive department of the Ninth People’s Hospital, affiliated to School of Medicine of Shanghai Jiao Tong University from January 2023 to August 2023 were selected and eligible subjects were divided into two groups: Group A took polyethylene glycol （PEG） and Group B took oral solution of magnesium sodium potassium sulfate （OSS）. The quality, drug tolerance, and safety of intestinal preparation were evaluated. The quality of bowel preparation was evaluated by the boston bowel preparation scale （BBPS）. Results The right colon BBPS score of Group B was (2.39±0.82) points, which was significantly higher than of Group A (2.11±0.43) points （P<0.05）. The overall score of Group B was higher than that of Group A （P<0.05）. OSS was easier to take than PEG, with a good taste and overall sensation. Patients were willing to use OSS to clean their bowels even when they were willing to undergo another examination （P<0.05）. There was a significant difference in nausea and vomiting symptoms between the two groups （P<0.05）, and there were no significant changes in renal function and electrolytes before and after medication in the two groups of patients. Conclusion OSS had a higher quality of bowel cleaning and was easier for patients to accept.

ObjectiveFor prepubertal and urgently treated malignant tumor patients, ovarian tissue cryopreservation and transplantation represent more appropriate fertility preservation methods. Current clinical practices often involve freezing ovarian tissue with high concentrations of cryoprotectants (CPAs) and thawing with water baths. These processes lead to varying degrees of toxicity and devitrification damage to ovarian tissue. Therefore, this paper proposes optimized methods for vitrification of ovarian tissues based on sodium alginate hydrogel encapsulation and magnetic induction nanowarming technology. MethodsFirstly, the study investigated the effects of sodium alginate concentration, the sequence of hydrogel encapsulation and CPAs loading on vitrification efficiency of encapsulated ovarian tissue. Additionally, the capability of sodium alginate hydrogel encapsulation to reduce the required concentration of CPAs was validated. Secondly, a platform combining water bath and magnetic induction nanowarming was established to rewarm ovarian tissue under various concentrations of magnetic nanoparticles and magnetic field strengths. The post-warming follicle survival rate, antioxidant capacity, and ovarian tissue integrity were evaluated to assess the efficacy of the method. ResultsThe study found that ovarian tissue encapsulated with 2% sodium alginate hydrogel exhibited the highest follicle survival rate after vitrification. The method of loading CPAs prior to encapsulation proved more suitable for ovarian tissue cryopreservation, effectively reducing the required concentration of CPAs by 50%. A combination of 8 g/L Fe₃O₄ nanoparticles and an alternating magnetic field of 300 Gs showed optimal warming effectiveness for ovarian tissue. Combining water bath rewarming with magnetic induction nanowarming yielded the highest follicle survival rate, enhanced antioxidant capacity, and preserved tissue morphology. ConclusionSodium alginate hydrogel encapsulation of ovarian tissue reduces the concentration of CPAs required during the freezing process. The combination of magnetic induction nanowarming with water bath provides an efficient method ovarian tissue rewarming. This study offers novel approaches to optimize ovarian tissues vitrification.

Intraoperative cell salvage (IOCS) has been widely applied as an important blood conservation measure in surgical operations. However, there is currently a lack of clinical practice guidelines for the implementation of IOCS in patients with malignant tumors. This report aims to provide clinicians with recommendations on the use of IOCS in patients with malignant tumors based on the review and assessment of the existed evidence. Data were derived from databases such as PubMed, Embase, the Cochrane Library and Wanfang. The guideline development team formulated recommendations based on the quality of evidence, balance of benefits and harms, patient preferences, and health economic assessments. This study constructed seven major clinical questions. The main conclusions of this guideline are as follows: 1) Compared with no perioperative allogeneic blood transfusion (NPABT), perioperative allogeneic blood transfusion (PABT) leads to a more unfavorable prognosis in cancer patients (Recommended); 2) Compared with the transfusion of allogeneic blood or no transfusion, IOCS does not lead to a more unfavorable prognosis in cancer patients (Recommended); 3) The implementation of IOCS in cancer patients is economically feasible (Recommended); 4) Leukocyte depletion filters (LDF) should be used when implementing IOCS in cancer patients (Strongly Recommended); 5) Irradiation treatment of autologous blood to be reinfused can be used when implementing IOCS in cancer patients (Recommended); 6) A careful assessment of the condition of cancer patients (meeting indications and excluding contraindications) should be conducted before implementing IOCS (Strongly Recommended); 7) Informed consent from cancer patients should be obtained when implementing IOCS, with a thorough pre-assessment of the patient's condition and the likelihood of blood loss, adherence to standardized internally audited management procedures, meeting corresponding conditions, and obtaining corresponding qualifications (Recommended). In brief, current evidence indicates that IOCS can be implemented for some malignant tumor patients who need allogeneic blood transfusion after physician full evaluation, and LDF or irradiation should be used during the implementation process.

ObjectiveTobacco-related diseases remain one of the leading preventable public health challenges worldwide and are among the primary causes of premature death. In recent years, accumulating evidence has supported the classification of nicotine addiction as a chronic brain disease, profoundly affecting both brain structure and function. Despite the urgency, effective diagnostic methods for smoking addiction remain lacking, posing significant challenges for early intervention and treatment. To address this issue and gain deeper insights into the neural mechanisms underlying nicotine dependence, this study proposes a novel graph neural network framework, termed TI-GNN. This model leverages functional magnetic resonance imaging (fMRI) data to identify complex and subtle abnormalities in brain connectivity patterns associated with smoking addiction. MethodsThe study utilizes fMRI data to construct functional connectivity matrices that represent interaction patterns among brain regions. These matrices are interpreted as graphs, where brain regions are nodes and the strength of functional connectivity between them serves as edges. The proposed TI-GNN model integrates a Transformer module to effectively capture global interactions across the entire brain network, enabling a comprehensive understanding of high-level connectivity patterns. Additionally, a spatial attention mechanism is employed to selectively focus on informative inter-regional connections while filtering out irrelevant or noisy features. This design enhances the model’s ability to learn meaningful neural representations crucial for classification tasks. A key innovation of TI-GNN lies in its built-in causal interpretation module, which aims to infer directional and potentially causal relationships among brain regions. This not only improves predictive performance but also enhances model interpretability—an essential attribute for clinical applications. The identification of causal links provides valuable insights into the neuropathological basis of addiction and contributes to the development of biologically plausible and trustworthy diagnostic tools. ResultsExperimental results demonstrate that the TI-GNN model achieves superior classification performance on the smoking addiction dataset, outperforming several state-of-the-art baseline models. Specifically, TI-GNN attains an accuracy of 0.91, an F1-score of 0.91, and a Matthews correlation coefficient (MCC) of 0.83, indicating strong robustness and reliability. Beyond performance metrics, TI-GNN identifies critical abnormal connectivity patterns in several brain regions implicated in addiction. Notably, it highlights dysregulations in the amygdala and the anterior cingulate cortex, consistent with prior clinical and neuroimaging findings. These regions are well known for their roles in emotional regulation, reward processing, and impulse control—functions that are frequently disrupted in nicotine dependence. ConclusionThe TI-GNN framework offers a powerful and interpretable tool for the objective diagnosis of smoking addiction. By integrating advanced graph learning techniques with causal inference capabilities, the model not only achieves high diagnostic accuracy but also elucidates the neurobiological underpinnings of addiction. The identification of specific abnormal brain networks and their causal interactions deepens our understanding of addiction pathophysiology and lays the groundwork for developing targeted intervention strategies and personalized treatment approaches in the future.

Patients with Noonan syndrome (NS) are born with normal or slightly lower body length and weight compared to the normal ranges. However, their height gradually falls behind that of the general population, leading to growth retardation and delayed puberty. In China, the incidence of short stature in patients with NS is approximately 65%. Short stature in these patients arises from multiple causes, including feeding difficulties in infancy, comorbidities such as congenital heart disease, genetic heterogeneity, and disorders of the growth hormone/insulin-like growth factor-1 axis. Growth hormone is commonly used to alleviate symptoms of short stature. This article reviews the growth and development patterns at different stages of NS, analyzes the causes of short stature, and summarizes the latest advances in treatment to provide new insights for the diagnosis and management of short stature in patients with NS.
Noonan Syndrome/complications* ; Humans ; Body Height ; Growth Disorders/therapy*

The patient, assigned female at birth and aged 1 year and 7 months, presented with clinical manifestations of 46,XY disorders of sex development. The external genitalia exhibited a severely undermasculinized phenotype. Laboratory tests and gonadal biopsy indicated poor Leydig cell function and good Sertoli cell function. Genetic testing revealed compound heterozygous mutations of c.867-2A>C and c.547G>A (p.G183R) in the LHCGR gene. The patient was ultimately diagnosed with type II Leydig cell hypoplasia. Type II Leydig cell hypoplasia presents a broad spectrum of clinical phenotypes, characterized by a lack of parallel function between Leydig cells and Sertoli cells, and significant individual variability in spermatogenesis and gender assignment. This condition should be considered when there is poor Leydig cell function but good development of Wolffian duct derivatives.
Female ; Humans ; Infant ; Disorder of Sex Development, 46,XY/genetics* ; Leydig Cells/pathology* ; Mutation ; Receptors, LH/genetics* ; Testis/abnormalities*

OBJECTIVES: To assess the preliminary efficacy and safety of a dose-intensified C5VD regimen (cisplatin, 5-fluorouracil, vincristine, and doxorubicin) in children with locally advanced hepatoblastoma. METHODS: This prospective study enrolled 24 children with newly diagnosed, locally advanced hepatoblastoma who received the dose-intensified C5VD regimen at Shanghai Children's Medical Center, Shanghai Jiao Tong University School of Medicine, and Shanghai Children's Hospital between January 2020 and December 2023. Clinical characteristics, treatment outcomes, and chemotherapy-related toxicities were analyzed. RESULTS: Of the 24 patients, 13 were male and 11 were female, with a median age at diagnosis of 18.7 months (range: 3.5-79.4 months). All patients achieved complete macroscopic resection of hepatic lesions without liver transplantation. Serum alpha-fetoprotein levels decreased significantly after two chemotherapy cycles. During a median follow-up of 38.4 months (range: 15.8-50.7 months), all patients maintained continuous complete remission, with 3-year event-free survival and overall survival rates of 100%. Across 144 chemotherapy cycles, the incidence rates of grade 3-4 neutropenia, thrombocytopenia, and infections were 97%, 77%, and 71%, respectively; no treatment-related deaths occurred. Notably, 5 patients (21%) developed Brock grade ≥3 hearing loss, of whom 1 required a hearing aid. CONCLUSIONS The dose-intensified C5VD regimen demonstrates significant efficacy with an overall favorable safety profile in the treatment of newly diagnosed, locally advanced pediatric hepatoblastoma. Grade 3-4 myelosuppression and infection are the predominant toxicities. However, high‑dose cisplatin-induced ototoxicity remains a concern, highlighting the need for improved otoprotective strategies.
Humans ; Hepatoblastoma/pathology* ; Male ; Female ; Infant ; Liver Neoplasms/pathology* ; Antineoplastic Combined Chemotherapy Protocols/therapeutic use* ; Child, Preschool ; Prospective Studies ; Doxorubicin/adverse effects* ; Child ; Cisplatin/adverse effects* ; Vincristine/adverse effects* ; Fluorouracil/adverse effects*

OBJECTIVES: To study genotype-phenotype correlations in children with FGFR3 variants and to improve clinical recognition of related disorders. METHODS: Clinical data of 95 patients aged 0-18 years harboring FGFR3 variants, confirmed by whole‑exome sequencing at Shanghai Children's Medical Center from January 2012 to December 2023, were retrospectively reviewed. Detailed phenotypic characterization was performed for 22 patients with achondroplasia (ACH) and 10 with hypochondroplasia (HCH). RESULTS: Among the 95 patients, 52 (55%) had ACH, 24 (25%) had HCH, 9 (9%) had thanatophoric dysplasia, 3 (3%) had syndromic skeletal dysplasia, 2 (2%) had severe achondroplasia with developmental delay and acanthosis nigricans, and 5 (5%) remained unclassified. A previously unreported FGFR3 variant, c.1663G>T, was identified. All 22 ACH patients presented with disproportionate short stature accompanied by limb dysplasia, commonly with macrocephaly, a depressed nasal bridge, bowed legs, and frontal bossing; complications were present in 17 (77%). The 10 HCH patients predominantly exhibited disproportionate short stature with limb dysplasia and depressed nasal bridge. CONCLUSIONS ACH is the most frequent phenotype associated with FGFR3 variants, and missense variants constitute the predominant variant type. The degree of FGFR3 activation appears to correlate with the clinical severity of skeletal dysplasia.
Humans ; Receptor, Fibroblast Growth Factor, Type 3/genetics* ; Child ; Male ; Child, Preschool ; Female ; Infant ; Adolescent ; Dwarfism/genetics* ; Achondroplasia/genetics* ; Lordosis/genetics* ; Infant, Newborn ; Retrospective Studies ; Genetic Association Studies ; Bone and Bones/abnormalities* ; Phenotype ; Limb Deformities, Congenital

T cell exhaustion plays an immunosuppressive role in malignant tumors. Continuous tumor antigen stimulation, the presence of suppressive immune cells and cytokines in the tumor microenvironment, the up regulation of inhibitory receptor expression on the surface of T cells, changes in T cell related transcription factors, and metabolites in the tumor microenvironment may lead to T cell exhaustion. Reversing the exhaustion of T cells in tumor patients is a promising strategy for tumor immunotherapy. This article will review the latest research progress on T cell exhaustion status, pathogenesis, reversal methods, and clinical applications in hematological tumors.
Humans ; Hematologic Neoplasms/immunology* ; T-Lymphocytes/immunology* ; Tumor Microenvironment ; Immunotherapy ; T-Cell Exhaustion