AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

Objective To explore the efficacy and safety of oral solution of magnesium sodium potassium sulfate in bowel preparation before colonoscopy. Methods Patients who planned to undergo colonoscopy at the digestive department of the Ninth People’s Hospital, affiliated to School of Medicine of Shanghai Jiao Tong University from January 2023 to August 2023 were selected and eligible subjects were divided into two groups: Group A took polyethylene glycol （PEG） and Group B took oral solution of magnesium sodium potassium sulfate （OSS）. The quality, drug tolerance, and safety of intestinal preparation were evaluated. The quality of bowel preparation was evaluated by the boston bowel preparation scale （BBPS）. Results The right colon BBPS score of Group B was (2.39±0.82) points, which was significantly higher than of Group A (2.11±0.43) points （P<0.05）. The overall score of Group B was higher than that of Group A （P<0.05）. OSS was easier to take than PEG, with a good taste and overall sensation. Patients were willing to use OSS to clean their bowels even when they were willing to undergo another examination （P<0.05）. There was a significant difference in nausea and vomiting symptoms between the two groups （P<0.05）, and there were no significant changes in renal function and electrolytes before and after medication in the two groups of patients. Conclusion OSS had a higher quality of bowel cleaning and was easier for patients to accept.

[Objective] To retrospectively analyse the serological characteristics of hemolytic transfusion reactions caused by Rh and Kidd antibodies, and to provide reference for safe, timely, and effective blood transfusion. [Methods] Two cases of patients with RhCcEe and Kidd blood type who experienced allogeneic transfusion at Dazhou Central Hospital were selected. A series of immunohematological tests were performed, including ABO, RhDCcEe and Kidd blood typing, unexpected antibody screening and identification, crossmatching, direct antiglobulin test, acid elution test, and capillary centrifugation to separate the patient's own red blood cells from donated red blood cells. [Results] Unexpected antibody screening, antibody identification, and direct antiglobulin test were positive in both patients. Case 1 had anti-Jk in the plasma, but no specific antibodies were found in the eluate. Case 2 had anti-c and E in the plasma, and anti-E was detected in the eluate. High-speed capillary centrifugation revealed corresponding antigen-positive erythrocytes at the distal end of the blood samples of both patients. [Conclusion] Case 1 received Kidd allogeneic red blood cells, and case 2 received RhCcEe allogeneic red blood cells, and both patients developed the corresponding unexpected antibodies, which led to the occurrence of immune haemolytic blood transfusion reaction.

ObjectiveTo observe the clinical efficacy and safety of Zhuyuwan in the treatment of hyperlipidemia. MethodsIn this study， hyperlipidemia patients treated in the Hospital of Chengdu University of Traditional Chinese Medicine （TCM） from September 2022 to December 2023 were randomly assigned into a control group and an observation group. Finally， 162 valid cases were included， encompassing 74 cases in the control group and 88 cases in the observation group. The control group was treated with atorvastatin calcium tablets， and the observation group with atorvastatin calcium tablets + Zhuyuwan extract granules. Both groups were treated for 8 weeks. The efficacy in terms of blood lipid level recovery， blood lipid levels， TCM syndrome distribution， efficacy in terms of TCM syndrome， and TCM symptom scores were compared between the two groups as well as between before and after treatment. Liver and kidney functions were monitored for safety assessment. ResultsIn terms of blood lipid level recovery， the total response rate in the observation group was 86.36% （76/88） and that in the control group was 86.49% （64/74）， with no statistically significant difference between the two groups. After treatment， both groups showed declines in levels of triglyceride （TG）， total cholesterol （TC）， and low-density lipoprotein cholesterol （LDL-C） （P<0.05） and elevations in the level of high-density lipoprotein cholesterol （HDL-C） （P<0.05）. Moreover， the observation group outperformed the control group in recovering the levels of TG， LDL-C， and HDL-C （P<0.05， P<0.01）. In terms of TCM syndrome， hyperlipidemia was mostly caused by phlegm turbidity and obstruction. The total response rate in terms of TCM syndrome in the observation group was 87.30% （55/63）， which was higher than that （63.46%， 33/52） in the control group （χ²=9.102， P<0.01）. After treatment， the scores of total TCM symptoms， primary symptoms， and secondary symptoms decreased in both groups （P<0.05）， and the observation group had lower scores than the control group （P<0.01）. The observation group was superior to the control group in alleviating obesity， chest tightness， and low food intake （P<0.05）. In terms of safety， the level of aminotransferase was slightly elevated in the control group， and no obvious adverse reaction was observed in the observation group， with no statistical significance in the incidence of adverse reactions. ConclusionZhuyuwan combined with atorvastatin can not only recover blood lipid levels and alleviate TCM symptoms but also reduce the occurrence of adverse reactions.

ObjectiveTo observe the clinical efficacy and safety of Zhuyuwan in the treatment of hyperlipidemia. MethodsIn this study， hyperlipidemia patients treated in the Hospital of Chengdu University of Traditional Chinese Medicine （TCM） from September 2022 to December 2023 were randomly assigned into a control group and an observation group. Finally， 162 valid cases were included， encompassing 74 cases in the control group and 88 cases in the observation group. The control group was treated with atorvastatin calcium tablets， and the observation group with atorvastatin calcium tablets + Zhuyuwan extract granules. Both groups were treated for 8 weeks. The efficacy in terms of blood lipid level recovery， blood lipid levels， TCM syndrome distribution， efficacy in terms of TCM syndrome， and TCM symptom scores were compared between the two groups as well as between before and after treatment. Liver and kidney functions were monitored for safety assessment. ResultsIn terms of blood lipid level recovery， the total response rate in the observation group was 86.36% （76/88） and that in the control group was 86.49% （64/74）， with no statistically significant difference between the two groups. After treatment， both groups showed declines in levels of triglyceride （TG）， total cholesterol （TC）， and low-density lipoprotein cholesterol （LDL-C） （P<0.05） and elevations in the level of high-density lipoprotein cholesterol （HDL-C） （P<0.05）. Moreover， the observation group outperformed the control group in recovering the levels of TG， LDL-C， and HDL-C （P<0.05， P<0.01）. In terms of TCM syndrome， hyperlipidemia was mostly caused by phlegm turbidity and obstruction. The total response rate in terms of TCM syndrome in the observation group was 87.30% （55/63）， which was higher than that （63.46%， 33/52） in the control group （χ²=9.102， P<0.01）. After treatment， the scores of total TCM symptoms， primary symptoms， and secondary symptoms decreased in both groups （P<0.05）， and the observation group had lower scores than the control group （P<0.01）. The observation group was superior to the control group in alleviating obesity， chest tightness， and low food intake （P<0.05）. In terms of safety， the level of aminotransferase was slightly elevated in the control group， and no obvious adverse reaction was observed in the observation group， with no statistical significance in the incidence of adverse reactions. ConclusionZhuyuwan combined with atorvastatin can not only recover blood lipid levels and alleviate TCM symptoms but also reduce the occurrence of adverse reactions.

Objective: To evaluate the feasibility of dynamic contrast-enhanced MRI (DCE-MRI) in differentiating tumor deposits (TDs) from metastatic lymph nodes (MLNs) in rectal cancer. Materials and Methods: A retrospective analysis was conducted on 70 patients with rectal cancer, including 168 lesions (70 TDs and 98 MLNs confirmed by histopathology), who underwent pretreatment MRI and subsequent surgery between March 2019 and December 2022. The morphological characteristics of TDs and MLNs, along with quantitative parameters derived from DCE-MRI (K trans , kep, and v e) and DWI (ADCmin, ADCmax, and ADCmean), were analyzed and compared between the two groups.Multivariable binary logistic regression and receiver operating characteristic (ROC) curve analyses were performed to assess the diagnostic performance of significant individual quantitative parameters and combined parameters in distinguishing TDs from MLNs. Results: All morphological features, including size, shape, border, and signal intensity, as well as all DCE-MRI parameters showed significant differences between TDs and MLNs (all P < 0.05). However, ADC values did not demonstrate significant differences (all P > 0.05). Among the single quantitative parameters, v e had the highest diagnostic accuracy, with an area under the ROC curve (AUC) of 0.772 for distinguishing TDs from MLNs. A multivariable logistic regression model incorporating short axis, border, v e, and ADC mean improved diagnostic performance, achieving an AUC of 0.833 (P = 0.027). Conclusion The combination of morphological features, DCE-MRI parameters, and ADC values can effectively aid in the preoperative differentiation of TDs from MLNs in rectal cancer.

Objective: To evaluate the feasibility of dynamic contrast-enhanced MRI (DCE-MRI) in differentiating tumor deposits (TDs) from metastatic lymph nodes (MLNs) in rectal cancer. Materials and Methods: A retrospective analysis was conducted on 70 patients with rectal cancer, including 168 lesions (70 TDs and 98 MLNs confirmed by histopathology), who underwent pretreatment MRI and subsequent surgery between March 2019 and December 2022. The morphological characteristics of TDs and MLNs, along with quantitative parameters derived from DCE-MRI (K trans , kep, and v e) and DWI (ADCmin, ADCmax, and ADCmean), were analyzed and compared between the two groups.Multivariable binary logistic regression and receiver operating characteristic (ROC) curve analyses were performed to assess the diagnostic performance of significant individual quantitative parameters and combined parameters in distinguishing TDs from MLNs. Results: All morphological features, including size, shape, border, and signal intensity, as well as all DCE-MRI parameters showed significant differences between TDs and MLNs (all P < 0.05). However, ADC values did not demonstrate significant differences (all P > 0.05). Among the single quantitative parameters, v e had the highest diagnostic accuracy, with an area under the ROC curve (AUC) of 0.772 for distinguishing TDs from MLNs. A multivariable logistic regression model incorporating short axis, border, v e, and ADC mean improved diagnostic performance, achieving an AUC of 0.833 (P = 0.027). Conclusion The combination of morphological features, DCE-MRI parameters, and ADC values can effectively aid in the preoperative differentiation of TDs from MLNs in rectal cancer.

Objective: To evaluate the feasibility of dynamic contrast-enhanced MRI (DCE-MRI) in differentiating tumor deposits (TDs) from metastatic lymph nodes (MLNs) in rectal cancer. Materials and Methods: A retrospective analysis was conducted on 70 patients with rectal cancer, including 168 lesions (70 TDs and 98 MLNs confirmed by histopathology), who underwent pretreatment MRI and subsequent surgery between March 2019 and December 2022. The morphological characteristics of TDs and MLNs, along with quantitative parameters derived from DCE-MRI (K trans , kep, and v e) and DWI (ADCmin, ADCmax, and ADCmean), were analyzed and compared between the two groups.Multivariable binary logistic regression and receiver operating characteristic (ROC) curve analyses were performed to assess the diagnostic performance of significant individual quantitative parameters and combined parameters in distinguishing TDs from MLNs. Results: All morphological features, including size, shape, border, and signal intensity, as well as all DCE-MRI parameters showed significant differences between TDs and MLNs (all P < 0.05). However, ADC values did not demonstrate significant differences (all P > 0.05). Among the single quantitative parameters, v e had the highest diagnostic accuracy, with an area under the ROC curve (AUC) of 0.772 for distinguishing TDs from MLNs. A multivariable logistic regression model incorporating short axis, border, v e, and ADC mean improved diagnostic performance, achieving an AUC of 0.833 (P = 0.027). Conclusion The combination of morphological features, DCE-MRI parameters, and ADC values can effectively aid in the preoperative differentiation of TDs from MLNs in rectal cancer.

Objective: To evaluate the feasibility of dynamic contrast-enhanced MRI (DCE-MRI) in differentiating tumor deposits (TDs) from metastatic lymph nodes (MLNs) in rectal cancer. Materials and Methods: A retrospective analysis was conducted on 70 patients with rectal cancer, including 168 lesions (70 TDs and 98 MLNs confirmed by histopathology), who underwent pretreatment MRI and subsequent surgery between March 2019 and December 2022. The morphological characteristics of TDs and MLNs, along with quantitative parameters derived from DCE-MRI (K trans , kep, and v e) and DWI (ADCmin, ADCmax, and ADCmean), were analyzed and compared between the two groups.Multivariable binary logistic regression and receiver operating characteristic (ROC) curve analyses were performed to assess the diagnostic performance of significant individual quantitative parameters and combined parameters in distinguishing TDs from MLNs. Results: All morphological features, including size, shape, border, and signal intensity, as well as all DCE-MRI parameters showed significant differences between TDs and MLNs (all P < 0.05). However, ADC values did not demonstrate significant differences (all P > 0.05). Among the single quantitative parameters, v e had the highest diagnostic accuracy, with an area under the ROC curve (AUC) of 0.772 for distinguishing TDs from MLNs. A multivariable logistic regression model incorporating short axis, border, v e, and ADC mean improved diagnostic performance, achieving an AUC of 0.833 (P = 0.027). Conclusion The combination of morphological features, DCE-MRI parameters, and ADC values can effectively aid in the preoperative differentiation of TDs from MLNs in rectal cancer.

Objective: To evaluate the feasibility of dynamic contrast-enhanced MRI (DCE-MRI) in differentiating tumor deposits (TDs) from metastatic lymph nodes (MLNs) in rectal cancer. Materials and Methods: A retrospective analysis was conducted on 70 patients with rectal cancer, including 168 lesions (70 TDs and 98 MLNs confirmed by histopathology), who underwent pretreatment MRI and subsequent surgery between March 2019 and December 2022. The morphological characteristics of TDs and MLNs, along with quantitative parameters derived from DCE-MRI (K trans , kep, and v e) and DWI (ADCmin, ADCmax, and ADCmean), were analyzed and compared between the two groups.Multivariable binary logistic regression and receiver operating characteristic (ROC) curve analyses were performed to assess the diagnostic performance of significant individual quantitative parameters and combined parameters in distinguishing TDs from MLNs. Results: All morphological features, including size, shape, border, and signal intensity, as well as all DCE-MRI parameters showed significant differences between TDs and MLNs (all P < 0.05). However, ADC values did not demonstrate significant differences (all P > 0.05). Among the single quantitative parameters, v e had the highest diagnostic accuracy, with an area under the ROC curve (AUC) of 0.772 for distinguishing TDs from MLNs. A multivariable logistic regression model incorporating short axis, border, v e, and ADC mean improved diagnostic performance, achieving an AUC of 0.833 (P = 0.027). Conclusion The combination of morphological features, DCE-MRI parameters, and ADC values can effectively aid in the preoperative differentiation of TDs from MLNs in rectal cancer.