AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

Objective To explore the efficacy and safety of oral solution of magnesium sodium potassium sulfate in bowel preparation before colonoscopy. Methods Patients who planned to undergo colonoscopy at the digestive department of the Ninth People’s Hospital, affiliated to School of Medicine of Shanghai Jiao Tong University from January 2023 to August 2023 were selected and eligible subjects were divided into two groups: Group A took polyethylene glycol （PEG） and Group B took oral solution of magnesium sodium potassium sulfate （OSS）. The quality, drug tolerance, and safety of intestinal preparation were evaluated. The quality of bowel preparation was evaluated by the boston bowel preparation scale （BBPS）. Results The right colon BBPS score of Group B was (2.39±0.82) points, which was significantly higher than of Group A (2.11±0.43) points （P<0.05）. The overall score of Group B was higher than that of Group A （P<0.05）. OSS was easier to take than PEG, with a good taste and overall sensation. Patients were willing to use OSS to clean their bowels even when they were willing to undergo another examination （P<0.05）. There was a significant difference in nausea and vomiting symptoms between the two groups （P<0.05）, and there were no significant changes in renal function and electrolytes before and after medication in the two groups of patients. Conclusion OSS had a higher quality of bowel cleaning and was easier for patients to accept.

With the accelerating trend of population aging, the number of elderly patients with lung cancer continues to rise, and the disease burden is becoming increasingly heavy. The clinical management of these patients faces severe challenges due to their decreased physiological reserve, complex comorbidities, and significant individual heterogeneity. Consequently, under traditional diagnosis and treatment models, doctors often struggle to identify the individualized risks of elderly patients in a timely and comprehensive manner, which can easily lead to decision biases such as undertreatment or overtreatment. In view of this, this study advocates for the establishment of an umbrella decision-making model specifically tailored for elderly lung cancer patients. Grounded in a multidisciplinary team (MDT) platform, this model deeply integrates oncological indicators with the comprehensive geriatric assessment (CGA) system. By holistically considering multidimensional variables including tumor burden, organ function, frailty index, cognitive status, and social support, the model establishes an operational mechanism characterized by "single entry, precise stratification, and targeted selection". Accordingly, patients can be scientifically triaged into distinct intervention tiers, such as active surveillance, minimally invasive surgery, drug therapy, radiotherapy, and best supportive care, thereby achieving real-time alignment between treatment intensity and patient fitness. This article elaborates on the construction logic and key operational procedures of this novel decision-making framework, aiming to guide clinical practice beyond the limitations of a tumor-centric perspective toward a holistic, dynamic, whole-course management strategy. This transition seeks to ensure optimal quality of life and clinical net benefit for elderly patients alongside survival prolongation.

ObjectiveThe present study aimed to investigate alterations in white matter microstructure and spontaneous neural activity in male college smokers, and to further explore their associations with nicotine dependence. Given that adolescence and early adulthood represent critical periods for brain maturation, particularly for white matter development, understanding the neural correlates of smoking behavior during this stage is of substantial importance for both neuroscience and public health. MethodsA total of 115 male undergraduate students were initially recruited for this study. After quality control and exclusion procedures, 52 male college smokers and 42 demographically matched healthy non-smokers were included in the final analysis. All participants underwent multimodal magnetic resonance imaging (MRI), including diffusion tensor imaging (DTI) and resting-state functional MRI (rs-fMRI). White matter fiber tracts were reconstructed using the automated fiber quantification (AFQ) method, which enables precise identification and quantification of major fiber bundles. Eighteen major white matter tracts were segmented for each participant. Along the core trajectory of each tract, 100 equidistant nodes were sampled. Fractional anisotropy (FA) was calculated at each node to assess white matter microstructural integrity, while amplitude of low-frequency fluctuation (ALFF) was computed to evaluate spontaneous neural activity within white matter tracts. Between-group differences in FA and ALFF were assessed using two-sample t-tests, with appropriate corrections applied for multiple comparisons. Furthermore, Pearson correlation analyses were conducted to examine the relationships between imaging-derived metrics (FA and ALFF values in regions showing significant group differences) and nicotine dependence severity, as measured by the Fagerström test for nicotine dependence (FTND). ResultsCompared with healthy non-smokers, male college smokers exhibited significantly increased FA values in several white matter tracts, including the left thalamic radiation, right corticospinal tract, forceps major of the corpus callosum, left uncinate fasciculus, and right arcuate fasciculus. These findings suggest altered microstructural organization or increased directional coherence within these pathways. In addition, smokers demonstrated significantly elevated ALFF values in the forceps major, right uncinate fasciculus, and left arcuate fasciculus, indicating enhanced spontaneous neural activity in these white matter regions. Correlation analyses revealed that FA values in the left thalamic radiation and right corticospinal tract were negatively correlated with FTND scores, suggesting that higher levels of nicotine dependence were associated with reduced microstructural integrity or altered fiber organization in these regions. In contrast, ALFF values in the forceps major and right uncinate fasciculus were positively correlated with FTND scores, indicating that greater nicotine dependence was associated with increased spontaneous neural activity in specific white matter pathways. ConclusionThe present study provides evidence that male college smokers exhibit distinct alterations in both white matter microstructure and functional activity. These abnormalities are not uniformly distributed but rather localized to specific fiber tracts implicated in sensorimotor processing, interhemispheric communication, and higher-order cognitive and emotional regulation. Importantly, the observed associations between imaging metrics and nicotine dependence severity suggest that these structural and functional alterations may reflect neurobiological mechanisms underlying addiction. The combination of AFQ-based tract profiling and multimodal MRI offers a sensitive approach for detecting subtle changes along white matter pathways, highlighting its potential utility in identifying neuroimaging biomarkers of nicotine dependence. Overall, these findings indicate that smoking during early adulthood may disrupt ongoing white matter maturation, potentially leading to long-term consequences for brain function. This study provides novel insights into the neural basis of nicotine dependence and underscores the importance of early intervention and prevention strategies targeting young smokers.

To address the growing challenge of an increasing number of elderly lung cancer patients amidst China's aging population and to fill the gap in quality control standards for surgical treatment in this special population, this study aimed to develop a standardized surgical evaluation system for elderly lung cancer patients tailored to China's national conditions. The system was established through a literature review, integrated the pathophysiological characteristics of elderly patients, and was constructed following review, feedback, and revision by experts from multiple thoracic surgery centers. Employing a 100-point scoring system, it comprises three primary domains: physical infrastructure and geriatric adaptability foundational conditions (10 points); management level and perioperative care models (20 points); and technical proficiency and clinical outcomes (70 points). The system places a strong emphasis on geriatric adaptability, proposing specific, quantifiable indicators for age-friendly facility modifications, control of elderly-specific complications, multidisciplinary collaboration, and standardized perioperative management. It provides a convenient and measurable assessment tool for quality control in the surgical treatment of elderly lung cancer in China, which is expected to promote the standardization and homogenization of diagnosis and treatment.

Objective: To evaluate the feasibility of dynamic contrast-enhanced MRI (DCE-MRI) in differentiating tumor deposits (TDs) from metastatic lymph nodes (MLNs) in rectal cancer. Materials and Methods: A retrospective analysis was conducted on 70 patients with rectal cancer, including 168 lesions (70 TDs and 98 MLNs confirmed by histopathology), who underwent pretreatment MRI and subsequent surgery between March 2019 and December 2022. The morphological characteristics of TDs and MLNs, along with quantitative parameters derived from DCE-MRI (K trans , kep, and v e) and DWI (ADCmin, ADCmax, and ADCmean), were analyzed and compared between the two groups.Multivariable binary logistic regression and receiver operating characteristic (ROC) curve analyses were performed to assess the diagnostic performance of significant individual quantitative parameters and combined parameters in distinguishing TDs from MLNs. Results: All morphological features, including size, shape, border, and signal intensity, as well as all DCE-MRI parameters showed significant differences between TDs and MLNs (all P < 0.05). However, ADC values did not demonstrate significant differences (all P > 0.05). Among the single quantitative parameters, v e had the highest diagnostic accuracy, with an area under the ROC curve (AUC) of 0.772 for distinguishing TDs from MLNs. A multivariable logistic regression model incorporating short axis, border, v e, and ADC mean improved diagnostic performance, achieving an AUC of 0.833 (P = 0.027). Conclusion The combination of morphological features, DCE-MRI parameters, and ADC values can effectively aid in the preoperative differentiation of TDs from MLNs in rectal cancer.

Objective To explore the efficacy of vacuum-assisted minimally invasive gyrotomy for benign lesions in the lower quadrant of the breast.Methods From August 2022 to August 2023,90 patients with benign lesions in the lower quadrant of the breast were treated.According to the different surgical methods,they were divided into two groups:the traditional group included 45 cases,which underwent surgery through the trans-areolar incision;the minimally invasive group included 45 cases,which underwent surgery through the trans-mammary fold incision with vacuum-assisted minimally invasive technique.The surgical-related indicators,inflammatory response indicators,patient satisfaction,and safety were compared between the two groups.Results The operation time[(20.45±6.18)min],intraoperative bleeding[(7.78±2.23)ml],hospital stay[(4.37±1.05)d],scar length[(2.32±0.42)cm]and healing time[(3.46±1.08)d]in the minimally invasive group were significantly better than those in the traditional group[(34.52±9.46)min,(23.16±6.44)ml,(8.72±2.73)d,(19.14±4.18)cm and(7.37±2.16)d](P＜0.05).The levels of IL-6[(12.14±2.86)ng/L],IL-10[(14.33±3.74)pg/ml],CRP[(13.85±3.11)mg/L],Cor[(131.27±6.43)nmol/L]and NE[(82.55±8.44)in the minimally invasive group at 3 days after surgery ng/ml were increased and VEGF was decreased[(59.72±7.44)mg/L]than the traditional group[(17.23±3.38)ng/L,(19.62±4.88)pg/ml,(28.36±4.67)mg/L,(196.52±8.84)nmol/L,(117.62±7.14)ng/ml and(88.46±7.89)mg/L](P＜0.05).The satisfaction of patients in minimally invasive group(97.78％,44/45)was significantly higher than that in traditional group(82.22％,37/45)(P＜0.05).The incidence of adverse events in minimally invasive group(4.44％,2/45)was significantly lower than that in traditional group(22.22％,10/45)(P＜0.05).Conclusion Vacuum-assisted minimally invasive rotatory excision can optimize surgical indicators,improve serological indicators,enhance patient satisfaction and treatment safety compared to traditional areola incision surgery.

Objective:To investigate the clinical features and genetic etiology of a case of Kartagener syndrome with obstruc-tive azoospermia(KS-OAS).Methods:We collected the clinical data and results of examinations of a male infertility patient treated in the Women and Children's Hospital Affiliated to Xiamen University.We analyzed the genetic etiology of the patient by high-through-put sequencing and bioinformatics,verified the pathogenic variants of CCDC1 14 by Sanger sequencing of the family members,and de-termined the protein expression of CCDC114 in normal subjects by immunohistochemistry and immunofluorescence staining.Results:The patient was confirmed with KS-OAS,and found with biallelic variation of CCDC114(c.71-2A＞C,c.816_817insGCAG)by se-quencing,which were inherited from father and mother,respectively.According to the American College of Medical Genetics and Ge-nomics(ACMG)guidelines,the variants were pathogenic.Two offspring were obtained by intracytoplasmic sperm injection(ICSI).Conclusion:The above findings have broadened the variation spectrum of the CCDC114,and provided some new ideas for genetic and assisted reproduction counseling for patients with Kartagener syndrome.The variation of CCDC114 does not affect the pregnancy out-come of ICSI.

Objective To evaluate the predictive value of neutrophil/high-density lipoprotein cholesterol ratio(NHR)combined with monocyte/lymphocyte ratio(MLR)for early rebleeding after endoscopic treatment in patients with cirrhosis complicated by acute esophagogastric variceal bleeding(AEVB).Methods A total of 228 patients with cirrhosis complicated by AEVB were included in this study.According to the occurrence of early rebleeding,patients were divided into the rebleeding group(96 cases)and the non-rebleeding group(132 cases).General information and laboratory indicators of both groups were collected,and the End-Stage Liver Disease(MELD)score,Child-Turcotte-Pugh(CTP)score,Fibrosis-4(FIB-4)index,NHR,and MLR were calculated.Logistic regression analysis was used to identify the risk factors for early rebleeding in patients with cirrhosis complicated by AEVB.A nomogram model based on NHR and MLR was constructed to predict the risk of early rebleeding.The predictive performance and goodness of fit of the model were evaluated using receiver operating characteristic(ROC)curve,Hosmer-Lemeshow test,Net Reclassification Index(NRI)and Integrated Discrimination Improvement(IDI).Results Compared with the non-rebleeding group,systolic blood pressure,platelet count(PLT),albumin/globulin ratio(A/G)and low-density lipoprotein cholesterol(LDL-C)were decreased in the rebleeding group,while total bile acids(TBA),aspartate aminotransferase(AST),alanine aminotransferase(ALT),total bilirubin(TBIL),activated partial thromboplastin time(APTT),thrombin time(TT),international normalized ratio(INR),Fibrosis-4(FIB-4),NHR,MLR,MELD score and CTP score were increased(P＜0.05).NHR was positively correlated with AST,TBIL and INR(P＜0.05).MLR was negatively correlated with PLT,and positively correlated with AST,TBIL and FIB-4(P＜0.05).Logistic regression analysis results showed that prolonged TT,elevated NHR and MLR were independent risk factors for early rebleeding in patients with cirrhosis complicated by AEVB.The nomogram model based on NHR and MLR to predict early rebleeding had an area under the curve of 0.810(95%CI:0.754-0.866).The Hosmer-Lemeshow test suggested that the model fit well.IDI and NRI analyse showed that the combination of NHR and MLR had better predictive value for the early rebleeding than that of MELD score and CTP score.Conclusion NHR and MLR are effective indicators for predicting early rebleeding after endoscopic treatment in patients with cirrhosis complicated by AEVB.They are helpful in the early identification of high-risk patients and provide a reference for clinical intervention.

Aim To investigate the effect of p-AMPK activity on autophagy in different subtypes of MDA-MB-231(triple-negative breast cancer cells)and MCF-7(estrogen receptor-positive cells)and its regulatory mechanism.Methods MDA-MB-231 cells were trea-ted with EBSS,Baf-A1,and EBSS+Baf-A1 for four hours,and MCF-7 cells for eight hours.The effects of autophagy on cell proliferation and apoptosis were ob-served,mitochondrial morphology was examined,and the expression of autophagy markers LC3B,P62,LAMP1,TOM20,AMPK,p-AMPK,ULK1,and Bec-lin1/VPS34 proteins was detected.The autophagy pathway was validated by inhibiting AMPK activity.Results Breast cancer cells underwent autophagy af-ter starvation induction(EBSS),with inconsistent au-tophagy processes observed in different subtypes of breast cancer cells.Autophagy inhibited cell prolifera-tion.In MDA-MB-231 cells,autophagy led to an in-crease in p-AMPK levels and a decrease in ULK1 lev-els,initiating autophagy through p-AMPK activation of ULK1.In MCF-7 cells,both p-AMPK and ULK1 levels decreased after autophagy,suggesting that autophagy might not be mediated by p-AMPK activation.Conclu-sions MDA-MB-231 cells primarily initiate autophagy by directly activating ULK1 by p-AMPK,independent of the MTOR pathway.In MCF-7 cells autophagy might be triggered by inhibiting MTOR through AMPK activity or directly activating MTOR through other up-stream factors.Regulating p-AMPK activity based on the autophagy pathways in different cell subtypes could enable more precise targeting and treatment of different types of breast cancer.