Objective To explore the efficacy and safety of oral solution of magnesium sodium potassium sulfate in bowel preparation before colonoscopy. Methods Patients who planned to undergo colonoscopy at the digestive department of the Ninth People’s Hospital, affiliated to School of Medicine of Shanghai Jiao Tong University from January 2023 to August 2023 were selected and eligible subjects were divided into two groups: Group A took polyethylene glycol （PEG） and Group B took oral solution of magnesium sodium potassium sulfate （OSS）. The quality, drug tolerance, and safety of intestinal preparation were evaluated. The quality of bowel preparation was evaluated by the boston bowel preparation scale （BBPS）. Results The right colon BBPS score of Group B was (2.39±0.82) points, which was significantly higher than of Group A (2.11±0.43) points （P<0.05）. The overall score of Group B was higher than that of Group A （P<0.05）. OSS was easier to take than PEG, with a good taste and overall sensation. Patients were willing to use OSS to clean their bowels even when they were willing to undergo another examination （P<0.05）. There was a significant difference in nausea and vomiting symptoms between the two groups （P<0.05）, and there were no significant changes in renal function and electrolytes before and after medication in the two groups of patients. Conclusion OSS had a higher quality of bowel cleaning and was easier for patients to accept.

AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

With the accelerating trend of population aging, the number of elderly patients with lung cancer continues to rise, and the disease burden is becoming increasingly heavy. The clinical management of these patients faces severe challenges due to their decreased physiological reserve, complex comorbidities, and significant individual heterogeneity. Consequently, under traditional diagnosis and treatment models, doctors often struggle to identify the individualized risks of elderly patients in a timely and comprehensive manner, which can easily lead to decision biases such as undertreatment or overtreatment. In view of this, this study advocates for the establishment of an umbrella decision-making model specifically tailored for elderly lung cancer patients. Grounded in a multidisciplinary team (MDT) platform, this model deeply integrates oncological indicators with the comprehensive geriatric assessment (CGA) system. By holistically considering multidimensional variables including tumor burden, organ function, frailty index, cognitive status, and social support, the model establishes an operational mechanism characterized by "single entry, precise stratification, and targeted selection". Accordingly, patients can be scientifically triaged into distinct intervention tiers, such as active surveillance, minimally invasive surgery, drug therapy, radiotherapy, and best supportive care, thereby achieving real-time alignment between treatment intensity and patient fitness. This article elaborates on the construction logic and key operational procedures of this novel decision-making framework, aiming to guide clinical practice beyond the limitations of a tumor-centric perspective toward a holistic, dynamic, whole-course management strategy. This transition seeks to ensure optimal quality of life and clinical net benefit for elderly patients alongside survival prolongation.

ObjectiveThe present study aimed to investigate alterations in white matter microstructure and spontaneous neural activity in male college smokers, and to further explore their associations with nicotine dependence. Given that adolescence and early adulthood represent critical periods for brain maturation, particularly for white matter development, understanding the neural correlates of smoking behavior during this stage is of substantial importance for both neuroscience and public health. MethodsA total of 115 male undergraduate students were initially recruited for this study. After quality control and exclusion procedures, 52 male college smokers and 42 demographically matched healthy non-smokers were included in the final analysis. All participants underwent multimodal magnetic resonance imaging (MRI), including diffusion tensor imaging (DTI) and resting-state functional MRI (rs-fMRI). White matter fiber tracts were reconstructed using the automated fiber quantification (AFQ) method, which enables precise identification and quantification of major fiber bundles. Eighteen major white matter tracts were segmented for each participant. Along the core trajectory of each tract, 100 equidistant nodes were sampled. Fractional anisotropy (FA) was calculated at each node to assess white matter microstructural integrity, while amplitude of low-frequency fluctuation (ALFF) was computed to evaluate spontaneous neural activity within white matter tracts. Between-group differences in FA and ALFF were assessed using two-sample t-tests, with appropriate corrections applied for multiple comparisons. Furthermore, Pearson correlation analyses were conducted to examine the relationships between imaging-derived metrics (FA and ALFF values in regions showing significant group differences) and nicotine dependence severity, as measured by the Fagerström test for nicotine dependence (FTND). ResultsCompared with healthy non-smokers, male college smokers exhibited significantly increased FA values in several white matter tracts, including the left thalamic radiation, right corticospinal tract, forceps major of the corpus callosum, left uncinate fasciculus, and right arcuate fasciculus. These findings suggest altered microstructural organization or increased directional coherence within these pathways. In addition, smokers demonstrated significantly elevated ALFF values in the forceps major, right uncinate fasciculus, and left arcuate fasciculus, indicating enhanced spontaneous neural activity in these white matter regions. Correlation analyses revealed that FA values in the left thalamic radiation and right corticospinal tract were negatively correlated with FTND scores, suggesting that higher levels of nicotine dependence were associated with reduced microstructural integrity or altered fiber organization in these regions. In contrast, ALFF values in the forceps major and right uncinate fasciculus were positively correlated with FTND scores, indicating that greater nicotine dependence was associated with increased spontaneous neural activity in specific white matter pathways. ConclusionThe present study provides evidence that male college smokers exhibit distinct alterations in both white matter microstructure and functional activity. These abnormalities are not uniformly distributed but rather localized to specific fiber tracts implicated in sensorimotor processing, interhemispheric communication, and higher-order cognitive and emotional regulation. Importantly, the observed associations between imaging metrics and nicotine dependence severity suggest that these structural and functional alterations may reflect neurobiological mechanisms underlying addiction. The combination of AFQ-based tract profiling and multimodal MRI offers a sensitive approach for detecting subtle changes along white matter pathways, highlighting its potential utility in identifying neuroimaging biomarkers of nicotine dependence. Overall, these findings indicate that smoking during early adulthood may disrupt ongoing white matter maturation, potentially leading to long-term consequences for brain function. This study provides novel insights into the neural basis of nicotine dependence and underscores the importance of early intervention and prevention strategies targeting young smokers.

To address the growing challenge of an increasing number of elderly lung cancer patients amidst China's aging population and to fill the gap in quality control standards for surgical treatment in this special population, this study aimed to develop a standardized surgical evaluation system for elderly lung cancer patients tailored to China's national conditions. The system was established through a literature review, integrated the pathophysiological characteristics of elderly patients, and was constructed following review, feedback, and revision by experts from multiple thoracic surgery centers. Employing a 100-point scoring system, it comprises three primary domains: physical infrastructure and geriatric adaptability foundational conditions (10 points); management level and perioperative care models (20 points); and technical proficiency and clinical outcomes (70 points). The system places a strong emphasis on geriatric adaptability, proposing specific, quantifiable indicators for age-friendly facility modifications, control of elderly-specific complications, multidisciplinary collaboration, and standardized perioperative management. It provides a convenient and measurable assessment tool for quality control in the surgical treatment of elderly lung cancer in China, which is expected to promote the standardization and homogenization of diagnosis and treatment.

Objective To investigate the etiology and treatment of dysuria shortly after holmium laser enucleation of the prostate (HoLEP) for benign prostatic hyperplasia (BPH), so as to improve the therapeutic efficacy. Methods A retrospective analysis was conducted on 1361 BPH patients who received HoLEP at our hospital during Mar. 2018 and Mar. 2025. All patients underwent ultrasound, computed tomography (CT), urethral probing or radiography, cystourethroscopy, and urodynamic testing. The causes, treatments and prognosis of dysuria after operation were summarized. Results ninety-eight patients (7.2%) experienced dysuria within 3 months after surgery, and all patients received initial urethral dilation. Among the 62 cases with urethral stricture, 28 were treated with urethral dilation (average of 8 sessions), 16 underwent external urethral incision, 8 underwent anterior urethroplasty, and 10 underwent transurethral plasma incision for urethral stricture. Of the 12 cases with residual prostate tissue, 5 underwent urethral plasma prostatectomy and 7 received medication. All of the 12 cases with bladder neck contracture underwent transurethral plasma incision of the bladder neck and local drug injection. Five cases with intravesical blood clots underwent urethral blood clot irrigation, 2 of which developed active bleeding and then underwent electrocoagulation. Four cases with detrusor dysfunction had catheters re-indwelled for one week followed by medication. Two cases with stone and one case with tissue fragment impacted in the urethra underwent urethral holmium lithotripsy and cystoscopic removal. All patients underwent reoperation successfully and experienced complete resolution or significant improvement of urinary difficulties. Conclusion A certain proportion of patients experience dysuria after HoLEP, with diverse etiologies. The combination of prevention and treatment can reduce the incidence of dysuria.

Under the background of new-era technological development and the implementation of national strategies, an increasing number of national major scientific and technological infrastructures led by universities have come into operation. How to take the advantages of national facilities to serve major scientific researches while fostering innovative graduates has become an important issue in recent studies. Taking Shanghai Jiao Tong University as an example and building upon the first National Facility for Translational Medicine (Shanghai), this paper focuses on the cultivation of graduates' innovative research and practical abilities, constructs a three-dimensional collaborative education system of "institutional empowerment-knowledge transfer-capability forging, " and explores the implementation pathway through which national major scientific and technological infrastructures empower innovative talent development. Practice has demonstrated that converting the research and technological advantages of national major scientific and technological infrastructures into high-quality educational resources yields remarkable outcomes in empowering innovative talent development, offering a replicable paradigm for universities to enhance the quality of innovative talent cultivation through national multidisciplinary cross-cutting science and technology platforms such as national major scientific and technological infrastructures.

[Objective] To analyze the effects of different factors and red blood cell transfusion thresholds on the efficacy of neonatal red blood cell (RBC) transfusion, in order to provide more references for neonatal transfusions to better achieve rational and effective blood use. [Methods] A retrospective collection of data from 282 neonates who received RBC transfusions at our hospital from 2022 to 2023 was conducted, including birth weight, gestational age, number of blood transfusions, length of hospital stay, assisted ventilation during RBC transfusion, and laboratory test results before and after transfusion. SPSS software was used for statistical analysis to comprehensively analyze the impact of different factors on the efficacy of RBC transfusion in neonates. [Results] The results showed that the gestational age and weight of newborns at birth were negatively correlated with their length of hospital stay and the number of RBC transfusions during hospitalization. Newborns with younger gestational age and lower weight had longer hospital stays and more RBC transfusions during hospitalization. After administering RBCs according to the standard of 15 mL/kg, there was a statistically significant difference in the efficacy of RBC transfusion at different transfusion thresholds. In non-critical situations, RBC transfusions were ineffective when the pre-transfusion hemoglobin (Hb) level was >120 g/L. When the pre-transfusion Hb level was ≤70 g/L, RBC transfusions achieved higher efficacy in both critical and non-critical situations. [Conclusion] In critical situations, the group with pre-transfusion Hb values ≤ 70 g/L has the best RBC transfusion effect, while in non-critical situations, the group with pre-transfusion Hb levels between 81 and 90 g/L has the best RBC transfusion effect. Overall, the efficacy of RBC transfusion in non-critical situations is higher than that in critical situations.

Objective To explore the difference in clinical efficacy of sacubitril valsartan(SV)and enalapril in the treatment of elderly patients with chronic heart failure with reduced ejection frac-tion(HFrEF).Methods A total of 126 elderly patients with chronic HFrEF admitted in our de-partment between January 2020 and January 2023 were prospectively recruited and randomly di-vided into control group(enalapril treatment,63 cases)and observation group(SV treatment,63 cases).After 3 months of treatment,the improvement rate of NYHA cardiac function grade,and changes in cardiac function indicators[6-minute walking distance(6MWD),NT-proBNP,LVEDD,LVEF],and echocardiographic indicators[left ventricular myocardial work(Tei)index,stroke volume,cardiac output(CO)]before and after treatment,adverse reactions during treat-ment and prognosis were compared between the two groups.Results The improvement rate of NYHA grade was significantly higher in the observation group than the control group(80.95％vs 65.08％,P＜0.05).The results of 6MWD,LVEF,stroke volume and CO were obviously higher in both groups after treatment than before treatment(P＜0.05).The results of 6MWD,LVEF,stroke volume and CO were notably higher in the observation group than the control group(P＜0.01).The SBP,DBP,NT-proBNP,heart rate,LVEDD and LV Tei index were decreased after treatment in both groups,and those in the observation group were even lower than those in the control group(P＜0.05,P＜0.01).As of April 2024,the readmission rates due to HF was re-markably lower in the observation group than the control group(7.94％vs 20.63％,P＜0.05),but no statistical difference was seen in the mortality or the incidence of adverse reactions be-tween them(P＞0.05).Conclusion SV is superior to enalapril in improving the efficacy,cardiac function and cardiac load of elderly HFrEF patients,with advantages of reducing the incidence of readmission but not increasing adverse reactions.

Objective To explore the genetic test results after confirmation and analyze misdiagnoses of prenatal ultrasound of fetal hypospadias.Methods Totally 206 fetuses with prenatal ultrasound suspected hypospadias were retrospectively enrolled,and the outcomes were followed up.For confirmed cases of hypospadias,prenatal ultrasound showed or did not show other abnormalities,with or without chromosomal and genetic abnormalities were collected,while maternal age≥35 years and the presence of other abnormalities detected by prenatal ultrasound related to the risk of chromosomal or genetic abnormalities were conducted.Results Hypospadias was confirmed postpartum in 159 cases,yielding a positive predictive value of 77.18％ (159/206)for prenatal ultrasound.The common prenatal ultrasound manifestations of hypospadias included blunt tip,small penis,ventral curvature and tulip sign.Associated anomalies frequently observed on prenatal ultrasound included cryptorchidism,ventricular septal defect and fetal growth restriction.Maternal age≥35 years and presence of additional abnormalities on prenatal ultrasound were both independent predictors of chromosomal or genetic abnormalities in fetuses with hypospadias(both P＜0.05).Isolated small penis with ventral curvature,congenital adrenal hyperplasia or isolated labia minora hypertrophy in female fetus might lead to misdiagnosis of prenatal ultrasound for fetal hypospadias.Conclusion Prenatal ultrasound had relatively high positive predictive value for diagnosing fetal hypospadias.Maternal age≥35 years and presence of other abnormalities on prenatal ultrasound suggested increased risk of chromosomal or genetic abnormalities.