ObjectiveTo investigate the effect of quercetin on acute gouty arthritis （GA） in rats by inhibiting the reactive oxygen species （ROS）/NOD-like receptor protein 3 （NLRP3）/interleukin-1β （IL-1β） signaling pathway. MethodsSixty SPF-grade male SD rats were randomized into normal， model， colchicine （0.3 mg·kg^-1）， and low-， medium-， and high-dose （25， 50， 100 mg·kg^-1， respectively） quercetin groups （n=10）. The rats in the dosing groups were administrated with the corresponding drugs （10 mL·kg^-1） by gavage once a day for one week. An equal volume of normal saline was given by gavage to rats in normal and model groups. One hour after drug administration on day 5， an acute GA model was established in other groups except the control group via intra-articular injection of monosodium urate （MSU） suspension into the right posterior ankle joint cavity. The joint swelling and gait were scored at the time points of 6， 12， 24， 48 h after modeling. Histopathological alterations in the ankle joint tissue from each group were assessed by hematoxylin-eosin （HE） staining. Malondialdehyde （MDA）， xanthine oxidase （XOD）， and total superoxide dismutase （T-SOD） assay kits were used to assess the levels of MDA， XOD， and T-SOD in the serum. The levels of tumor interleukin-6 （IL-6）， necrosis factor-α （TNF-α）， and IL-1β in the rat serum， as well as ROS in the ankle joint tissue， were measured by enzyme-linked immunosorbent assay （ELISA）. Western blot was performed to determine the protein levels of NLRP3， thioredoxin-interacting protein （TXNIP）， apoptosis-associated speck-like protein containing a CARD domain （ASC）， precursor cysteinyl aspartate-specific proteinase-1 （pro-Caspase-1）， cleaved Caspase-1 （Caspase-1 p20）， and IL-1β in the ankle joint tissue. Real-time PCR was employed to assess the mRNA levels of TXNIP， NLRP3， ASC， IL-1β， and TNF-α in the ankle joint tissue. ResultsCompared with the normal group， the model group exhibited decreased spontaneous activity， mental fatigue， increased ankle joint swelling and gait scores （P<0.01）， aggravated synovial tissue edema and inflammatory cell infiltration （P<0.01）， elevated levels of XOD， MDA， TNF-α， IL-1β， and IL-6 in the serum and ROS in the joint tissue （P<0.01）， a declined level of T-SOD （P<0.01）， up-regulated protein levels of NLRP3， TXNIP， ASC， pro-Caspase-1， Caspase-1 p20， and IL-1β in the ankle joint tissue （P<0.01）， and up-regulated mRNA levels of NLRP3， TXNIP， ASC， IL-1β， and TNF-α in the ankle joint tissue （P<0.01）. Compared with the model group， the medium- and high-dose quercetin groups showed improved general conditions， decreased gait scores （P<0.05， P<0.01）， reduced joint swelling （P<0.01）， alleviated synovial tissue edema and inflammatory cell infiltration （P<0.05， P<0.01）， lowered levels of XOD， MDA， TNF-α， IL-1β， and IL-6 in the serum and ROS in the joint tissue （P<0.01）， increased levels of T-SOD （P<0.01）， down-regulated protein levels of TXNIP， NLRP3， ASC， pro-Caspase-1， Caspase-1 p20， and IL-1β in the ankle joint tissue （P<0.05， P<0.01）， and down-regulated mRNA levels of TXNIP， NLRP3， ASC， IL-1β， and TNF-α in the ankle joint tissue （P<0.01）. Low-dose quercetin also ameliorated some of the above parameters （P<0.05， P<0.01）. ConclusionQuercetin exerts anti-GA effects by blocking the ROS/NLRP3/IL-1β signaling pathway， downregulating NLRP3 inflammasome activation， and inhibiting the production of pro-inflammatory cytokines including TNF-α， IL-1β， and IL-6.

AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

ObjectiveTo explore the effects of Yimei Baijiang formula （YMBJF） on colitis-associated colorectal cancer （CAC） and the nuclear factor kappaB （NF-κB） signaling pathway in mice. MethodsSixty male Balb/c mice of 4-6 weeks old were randomized into 6 groups： Normal， model， capecitabine （0.83 g·kg^-1）， and low-， medium-， and high-dose （4.63， 9.25， 18.50 g·kg^-1， respectively） YMBJF. The mouse model of CAC was established by combining azoxymethane （AOM， 10 mg·kg^-1） and dextran sulfate sodium （DSS， 2%）. At the 5^th week after the start of modeling， the capecitabine group and the YMBJF groups were respectively administrated with the corresponding doses of drugs by gavage once a day for a total of 6 weeks. The body weights and general conditions of mice were measured and observed， and the disease activity index （DAI） was scored. The tumors in the colorectal tissue were counted， and the colorectal length was measured. The histological features of the colorectal tissue in each group of mice were observed by hematoxylin-eosin （HE） staining. The levels of inflammatory cytokines including interleukin-6 （IL-6）， interleukin-1β （IL-1β）， and tumor necrosis factor-α （TNF-α） in the serum were determined by enzyme-linked immunosorbent assay （ELISA）. The expression and localization of proliferating cell nuclear antigen-67 （Ki67）， proliferating cell nuclear antigen （PCNA）， and phosphorylated nuclear transcription factor-κB p65 （p-NF-κB p65） proteins were observed by immunohistochemistry （IHC）. The apoptosis of tumor cells was observed by the TUNEL assay. The mRNA levels of IL-6，IL-1β， TNF-α， nuclear transcription factor-κB p65 （NF-κB p65）， NF-κB inhibitor alpha （IκBα）， B-cell lymphoma-2 （Bcl-2）， and Bcl-2-associated X protein （Bax） in the colorectal tissue were quantified by Real-time polymerase chain reaction（Real-time PCR）. The protein levels of NF-κB p65， phosphorylated （p）-NF-κB p65， IκBα， p-IκBα， Bcl-2， and Bax in the colorectal tissue were determined by Western blot. ResultsCompared with the model group， each YMBJF group showed decreases in DAI and tumor number （P0.01）， and the medium-dose and high-dose YMBJF groups showed increases in colorectal length （P0.05）. In addition， each YMBJF group showed alleviated colorectal mucosal pathological injury， declined levels of IL-6， IL-1β， and TNF-α in the serum （P0.05）， reduced expression of Ki67 and PCNA （P0.01）， and down-regulated expression of p-NF-κB p65 （P0.05）. The apoptosis in the medium-dose and high-dose YMBJF groups increased （P0.01）. Each YMBJF group and the capecitabine group showed down-regulated mRNA levels of IL-1β， TNF-α， IL-6， NF-κB p65， and Bcl-2 （P0.05） and up-regulated mRNA levels of IκBα and Bax （P0.05）. The mRNA level of IκBα was up-regulated， and that of Bcl-2 was down-regulated （P0.05） in the high-dose YMBJF group. The protein levels of p-IκBα and Bcl-2 were down-regulated （P0.05） in each YMBJF group. The protein levels of IκBα and Bax were up-regulated in the medium-dose and high-dose YMBJF groups （P0.01）， while those of NF-κB p65 and p-NF-κB p65 were down-regulated （P0.05）. ConclusionYMBJF can reduce the number of tumors， reduce the levels of inflammatory factors， promote tumor cell apoptosis， and inhibit tumor cell proliferation by regulating the direct effector molecules of the NF-κB signaling pathway in the mouse model of CRC.

Chronic obstructive pulmonary disease （COPD） is a chronic respiratory disease that poses a significant threat to global health， exhibiting high morbidity， disability and mortality rate， with its prevention and treatment situation becoming increasingly critical. The pathogenesis of COPD is complex， and the underlying cellular and molecular biological mechanisms remain incompletely elucidated. Programmed cell death （PCD） is the process wherein cells actively undergo demise to maintain internal environmental stability in response to certain signals or specific stimuli. Contemporary medical research indicates that the dysregulation of PCD patterns such as apoptosis， necroptosis， pyroptosis， autophagy， and ferroptosis is closely related to the onset and progression of COPD. Clarifying the molecular mechanisms of PCD in COPD may provide novel perspectives for in-depth understanding and prevention of the disease. Traditional Chinese medicine （TCM） is characterized by holistic regulation. In recent years， extensive research has been conducted in the TCM field focusing on modulating apoptosis， necroptosis， pyroptosis， autophagy， and ferroptosis for the treatment of COPD， yielding remarkable achievements. Therefore， this study systematically explored the molecular mechanism of PCD in COPD and reviewed the potential mechanisms and intervention status of TCM targeting PCD in COPD， aiming to provide insights and references for the clinical prevention， treatment and in-depth research of COPD.

ObjectiveTo explore the effects of Yimei Baijiang formula （YMBJF） on colitis-associated colorectal cancer （CAC） and the nuclear factor kappaB （NF-κB） signaling pathway in mice. MethodsSixty male Balb/c mice of 4-6 weeks old were randomized into 6 groups： Normal， model， capecitabine （0.83 g·kg^-1）， and low-， medium-， and high-dose （4.63， 9.25， 18.50 g·kg^-1， respectively） YMBJF. The mouse model of CAC was established by combining azoxymethane （AOM， 10 mg·kg^-1） and dextran sulfate sodium （DSS， 2%）. At the 5^th week after the start of modeling， the capecitabine group and the YMBJF groups were respectively administrated with the corresponding doses of drugs by gavage once a day for a total of 6 weeks. The body weights and general conditions of mice were measured and observed， and the disease activity index （DAI） was scored. The tumors in the colorectal tissue were counted， and the colorectal length was measured. The histological features of the colorectal tissue in each group of mice were observed by hematoxylin-eosin （HE） staining. The levels of inflammatory cytokines including interleukin-6 （IL-6）， interleukin-1β （IL-1β）， and tumor necrosis factor-α （TNF-α） in the serum were determined by enzyme-linked immunosorbent assay （ELISA）. The expression and localization of proliferating cell nuclear antigen-67 （Ki67）， proliferating cell nuclear antigen （PCNA）， and phosphorylated nuclear transcription factor-κB p65 （p-NF-κB p65） proteins were observed by immunohistochemistry （IHC）. The apoptosis of tumor cells was observed by the TUNEL assay. The mRNA levels of IL-6，IL-1β， TNF-α， nuclear transcription factor-κB p65 （NF-κB p65）， NF-κB inhibitor alpha （IκBα）， B-cell lymphoma-2 （Bcl-2）， and Bcl-2-associated X protein （Bax） in the colorectal tissue were quantified by Real-time polymerase chain reaction（Real-time PCR）. The protein levels of NF-κB p65， phosphorylated （p）-NF-κB p65， IκBα， p-IκBα， Bcl-2， and Bax in the colorectal tissue were determined by Western blot. ResultsCompared with the model group， each YMBJF group showed decreases in DAI and tumor number （P0.01）， and the medium-dose and high-dose YMBJF groups showed increases in colorectal length （P0.05）. In addition， each YMBJF group showed alleviated colorectal mucosal pathological injury， declined levels of IL-6， IL-1β， and TNF-α in the serum （P0.05）， reduced expression of Ki67 and PCNA （P0.01）， and down-regulated expression of p-NF-κB p65 （P0.05）. The apoptosis in the medium-dose and high-dose YMBJF groups increased （P0.01）. Each YMBJF group and the capecitabine group showed down-regulated mRNA levels of IL-1β， TNF-α， IL-6， NF-κB p65， and Bcl-2 （P0.05） and up-regulated mRNA levels of IκBα and Bax （P0.05）. The mRNA level of IκBα was up-regulated， and that of Bcl-2 was down-regulated （P0.05） in the high-dose YMBJF group. The protein levels of p-IκBα and Bcl-2 were down-regulated （P0.05） in each YMBJF group. The protein levels of IκBα and Bax were up-regulated in the medium-dose and high-dose YMBJF groups （P0.01）， while those of NF-κB p65 and p-NF-κB p65 were down-regulated （P0.05）. ConclusionYMBJF can reduce the number of tumors， reduce the levels of inflammatory factors， promote tumor cell apoptosis， and inhibit tumor cell proliferation by regulating the direct effector molecules of the NF-κB signaling pathway in the mouse model of CRC.

Chronic obstructive pulmonary disease （COPD） is a chronic respiratory disease that poses a significant threat to global health， exhibiting high morbidity， disability and mortality rate， with its prevention and treatment situation becoming increasingly critical. The pathogenesis of COPD is complex， and the underlying cellular and molecular biological mechanisms remain incompletely elucidated. Programmed cell death （PCD） is the process wherein cells actively undergo demise to maintain internal environmental stability in response to certain signals or specific stimuli. Contemporary medical research indicates that the dysregulation of PCD patterns such as apoptosis， necroptosis， pyroptosis， autophagy， and ferroptosis is closely related to the onset and progression of COPD. Clarifying the molecular mechanisms of PCD in COPD may provide novel perspectives for in-depth understanding and prevention of the disease. Traditional Chinese medicine （TCM） is characterized by holistic regulation. In recent years， extensive research has been conducted in the TCM field focusing on modulating apoptosis， necroptosis， pyroptosis， autophagy， and ferroptosis for the treatment of COPD， yielding remarkable achievements. Therefore， this study systematically explored the molecular mechanism of PCD in COPD and reviewed the potential mechanisms and intervention status of TCM targeting PCD in COPD， aiming to provide insights and references for the clinical prevention， treatment and in-depth research of COPD.

Objective To evaluate the predictive value of different machine learning models constructed in a multicenter environment for potential organ donors and verify their clinical application feasibility. Methods The study included 2 000 inpatients admitted to five domestic tertiary hospitals from January 2020 to December 2023, who met the criteria for potential organ donation assessment. They were randomly divided into a training set and an internal validation set (7∶3). Another 300 similar patients admitted to the First Affiliated Hospital of Harbin Medical University from January 2024 to April 2025 were included as an external validation set. The area under the curve (AUC), sensitivity, specificity, accuracy and F1-score of three models were compared, and the consistency of the potential organ donor determination process was tested. Multivariate logistic regression analysis was used to identify predictive factors of potential organ donors. Decision curve analysis (DCA) was employed to verify the resource efficiency of each model, and the threshold interval and intervention balance point were assessed. Results Apart from age, there were no significant differences in other basic characteristics among the centers (all P>0.05). The consistency of the potential organ donor determination process among researchers in each center was good [all 95% confidence interval (CI) lower limits >0]. In the internal validation set, the XGBoost model had the best predictive performance (AUC=0.92, 95% CI 0.89-0.94) and the best calibration (P=0.441, Brier score 0.099). In the external validation set, the XGBoost model also had the best predictive performance (AUC=0.91, 95% CI 0.88-0.94), outperforming logistic regression and random forest models. Multivariate logistic regression showed that mechanical ventilation had the greatest impact (odds ratio=2.06, 95% CI 1.54-2.76, P<0.001). DCA indicated that the XGBoost model had the highest net benefit in the threshold interval of 0.2-0.6. The “treat all” strategy only had a slight advantage at extremely low thresholds. The recommended threshold interval, which balances intervention costs and clinical benefits, considers ≥50% positive predictive value (PPV) and ≤50 referrals per 100 high-risk patients. Conclusions The XGBoost model established in a multicenter environment is accurate and well-calibrated in predicting potential organ donors. Combined with DCA, it may effectively guide the timing of clinical interventions and resource allocation, providing new ideas for the assessment and management of organ donation after brain death.

Objective: To analyze the factors related to dual use of traditional cigarettes and e-cigarettes among middle school students in Beijing, in order to provide a scientific basis for adapting to the new situation and carrying out tobacco control among adolescents. Methods: A multi stage cluster random sampling method was used to select 15 688 and 13 607 junior and senior middle school students from 16 districts in Beijing from April to June in 2019 and 2023, respectively. Online self administered questionnaires among middle school students in Beijing were completed, including use of traditional cigarettes and e-cigarettes, exposure to second hand smoke, attitudes and perceptions towards tobacco, etc. The Chi-square test was used to compare rates, and a multiple factors Logistic regression model was used to analyze related factors of traditional cigarettes and e-cigarettes dual use among middle school students. Results: The dual use rate of traditional cigarettes and e-cigarettes in 2023 had decreased to 2.46% from 4.88% in 2019 among middle school students in Beijing. The results of the multiple Logistic regression model analysis showed that among middle school students, tobacco control anywhere at home (boys: OR =0.47, girls: OR =0.34), without anyone smoking on campus in the past month (boys: OR =0.43, girls: OR =0.26) had lower risks of dual use ( P <0.05); and middle school students strongly or slightly agreeing that smoking could bring happiness (boys: OR =4.11, 2.22, girls: OR =5.32, 3.87), believing that smoking could increase attractiveness of young people (boys: OR =3.13, girls: OR =5.81), smoking cigarettes handed over by good friends (boys: OR =4.24, girls: OR =7.21), thinking smoking in the next year (boys: OR =5.77, girls: OR =7.74) had higher risks of dual use ( P <0.05).Among boys, junior middle school students ( OR =0.50), excellent academic performance ( OR =0.36), no acceptance of free tobacco products from tobacco companies ( OR =0.38), believing that smoking couldn t refresh oneself ( OR =0.37) and smoking still could pose a health hazard though not yet addictive ( OR =0.32) had lower risks of dual use ( P <0.05);and boys with a history of secondhand smoke exposure indoor outside home ( OR =2.19), believing that quitting smoking without difficulty ( OR =2.57),smoking e-cigarettes handed over by good friends ( OR =11.27) had higher risks of dual use ( P <0.05). Among girls, no acceptance of using tobacco product labeled items ( OR =0.28) had lower risks of dual use ( P <0.05); and girls whose parents both smoke ( OR =5.53), believing that quitting smoking might not be difficult ( OR =4.44) had higher risks of dual use ( P < 0.05 ). Conclusions The dual use rate of traditional cigarettes and e-cigarettes among middle school students in Beijing has decreased. It is recommended to take the construction of smoke free families as the starting point, so as to reduce indoor second hand smoke exposure and control tobacco promotions, and promote the formation of correct tobacco control culture and moral constraints among secondary school students.

BACKGROUND:Early exercise treatment is the main prevention way for traumatic joint contracture and is also a research focus.Swimming may be a potential intervention for joint contracture due to the special physical properties of water. OBJECTIVE:To explore the effects of swimming on the development of joint contracture in a rat model and study its mechanisms. METHODS:Twenty-four Sprague-Dawley rats were randomly divided into a blank control group(n=8)and a joint contracture group(n=16).After the surgical operation of knee joint contracture rat models,the joint contracture group was randomly subdivided into a surgical control group(n=8)and a swimming treatment group(n=8).Swimming started in the swimming treatment group in the second week after surgery and lasted for a total of 5 weeks.At the 6th week after surgery,the body mass,knee joint range of motion,and quadriceps diameter were tested,and the diameter/body mass index was calculated.Hematoxylin-eosin staining was performed to detect the pathological changes in the knee joint capsule and quadriceps muscle,and Masson staining was used to observe fibrotic changes in the knee joint capsule.Furthermore,the protein expression of transforming growth factor β1 and type I collagen in the knee joint capsule was quantified by immunohistochemical assay and western blot was performed to detect the protein expression of MuRF1 in the quadriceps femoris. RESULTS AND CONCLUSION:Compared with the blank control group,the knee range of motion decreased in the surgical control and swimming treatment groups(P<0.01),and knee extension deficit and arthrogenic extension deficit were significantly increased(P<0.01),the diameter of the quadriceps muscle was decreased(P<0.01),the joint capsule showed significant fibrosis,the quadriceps muscle was atrophied,and the diameter/body mass index was decreased(P<0.01).Compared with the surgical control group,the swimming treatment group showed a significant increase in knee joint range of motion and quadriceps diameter(P<0.01),and significant improvement in joint capsule fibrosis and quadriceps atrophy.Compared with the blank control group,collagen fiber content and expression of transforming growth factor β1 and type I collagen were increased in the joint capsule of rats in both the surgical control group and the swimming treatment group(P<0.01).Compared with the surgical control group,collagen fiber content and expression of transforming growth factor β1 and type I collagen protein in the joint capsule were decreased in the swimming treatment group.Compared with the blank control group,the expression of MuRF1 protein in the quadriceps muscle of rats in the surgical control group and the swimming treatment group was increased(P<0.05).Compared with the surgical control group,the expression of MuRF1 protein in the quadriceps muscle of rats in the swimming treatment group was decreased(P<0.05).To conclude,early swimming intervention reduces transforming growth factor β1 and type I collagen expression in the joint capsule of traumatic joint contracture rats,decreases MuRF1 expression in the quadriceps muscle,and increases joint range of motion and quadriceps diameter,thereby inhibiting the development of joint contracture.

OBJECTIVE:Anterior cervical decompression and fusion is a classic surgical method for the treatment of degenerative cervical spondylosis.The use of nail plates increases the fusion rate and stability and indirectly leads to adjacent vertebral degeneration and postoperative dysphagia.In this paper,the clinical results and complications of ROI-CTM self-locking system and traditional cage combined with screw-plate internal fixation in the treatment of degenerative cervical spondylosis were compared by meta-analysis to provide evidence-based support for the selection of internal fixation methods in anterior cervical decompression and fusion. METHODS:CNKI,WanFang,VIP,PubMed,Cochrane Library,Web of Science,and Embase databases were searched for Chinese and English literature on the application of ROI-CTM self-locking system and fusion cage combined with screw plate internal fixation in the treatment of degenerative cervical spondylosis.The retrieval time range was from inception to July 2023.Two researchers selected the literature strictly according to the inclusion and exclusion criteria.The Cochrane bias risk tool was used to evaluate the quality of randomized controlled trials.Newcastle-Ottawa Scale was used to assess the quality of cohort studies.Meta-analysis was performed using RevMan 5.4 software.Outcome indicators included operation time,intraoperative blood loss,Japanese Orthopaedic Association score,Neck Disability Index,C2-C7 Cobb angle,fusion rate,incidence of adjacent vertebral degeneration,cage subsidence rate,and incidence of dysphagia. RESULTS:Thirteen articles were included,including eleven retrospective cohort studies and two randomized controlled trials,with 1 136 patients,569 in the ROI-C group,and 567 in the cage combined with the nail plate group.Meta-analysis results showed that the operation time(MD=-15.52,95%CI:-18.62 to-12.42,P<0.000 01)and intraoperative blood loss(MD=-24.53,95%CI:-32.46 to-16.61,P<0.000 01)in the ROI-C group and the fusion device combined with nail plate group.Postoperative adjacent segment degeneration rate(RR=0.40,95%CI:0.27-0.60,P<0.000 01)and postoperative total dysphagia rate(RR=0.18,95%CI:0.13-0.26),P<0.000 01)were statistically different.The two groups had no significant difference in Japanese Orthopaedic Association score,Neck Disability Index,C2-C7 Cobb angle,fusion rate,or cage subsidence rate(P≥0.05). CONCLUSION:Applying an ROI-CTM self-locking system and traditional cage combined with plate internal fixation in anterior cervical decompression and fusion can achieve satisfactory clinical results in treating degenerative cervical spondylosis.The operation of the ROI-CTM self-locking system is more straightforward.Compared with a cage combined with plate internal fixation,the ROI-CTM self-locking system can significantly reduce the operation time and intraoperative blood loss and has obvious advantages in reducing the incidence of postoperative dysphagia and adjacent segment degeneration.The ROI-CTM self-locking system is recommended for patients with skip cervical spondylosis and adjacent vertebral disease.However,given its possible high settlement rate,using a fusion cage combined with screw-plate internal fixation is still recommended for patients with degenerative cervical spondylosis with multiple segments and high-risk factors of fusion cage settlement,such as osteoporosis and vertebral endplate damage.