Objective: To explore the early effects of birth weight at different gestational ages on blood pressure trajectory among primary school students, so as to provide evidence for incorporating gestational age birth weight into individualized early warning and intervention strategies for childhood hypertension. Methods: From May to November 2023, a purposeful sampling method was used to recruit 1 676 students in grade 1-3 from three primary schools in a certain urban district of Chongqing. Follow up assessments were conducted in May 2024(T1), November 2024(T2), and May 2025(T3). General demographic and birth related information were collected via self administered questionnaires, while height, weight and blood pressure were obtained through physical examinations. Linear mixed effects model was used to analyze the associations between birth weight at different gestational ages and blood pressure trajectories. Results: During the T1-T3 period, the systolic blood pressure of boys were 98.5 (93.0, 104.5 ),98.5 (93.5, 105.0), and 97.5 (92.5, 103.5)mmHg, respectively, while the diastolic blood pressure were 60.5 (56.5, 65.0), 61.5 ( 57.0 , 65.5), and 60.0 (56.0, 64.0)mmHg, respectively. For girls, the systolic blood pressure were 95.5 (90.0, 102.0),95.5 (90.5, 101.5), and 96.0 (90.5, 101.5)mmHg, respectively, and the diastolic blood pressure were 60.5 (56.0, 64.5 ),61.5 (57.5, 65.5), and 59.5 (56.0, 63.0)mmHg, respectively. Through Friedman test within both boys and girls, diostolic blood pressure were statistically significant across three measurements( χ 2=48.85，81.54，both P <0.01). The proportion of normal blood pressure increased , and the proportion of prehypertension and hypertension decreased with time( χ 2=39.72，25.62，both P < 0.01 ). Linear mixed effects model analysis revealed that after adjusting for age, sex, household income monthly, parental education, family history of hypertension and maternal pregnancy complications, large for gestational age had significantly higher trajectories of systolic ( β = 1.50) and diastolic( β =0.94) blood pressure compared to appropriate for gestational age(both P <0.01). Conclusion Large for gestational age is associated with elevated blood pressure trajectories during school age, and it may be considered as an early indicator for individualized screening and intervention for childhood hypertension.

Objective To gain insights into the biological characteristics of different populations of Culex tritaeniorhynchus within and around the Yellow Sea wetland from the perspective of the occurrence of resistance, we investigated the levels of resistance to deltamethrin and kdr gene mutation in the wetland and its peripheral areas. Methods Specimens were collected from Cx. tritaeniorhynchus populations at two monitoring sites in the Rare Bird National Nature Reserve and Tiaozi Ni Wetland Scenic Area, and also from two populations in Yancheng City and the Liuhe District of Nanjing, and the resistance of these mosquitoes to deltamethrin was determined using the CDC biotest bottle method. For each concentration of deltamethrin assessed, a random subset of exposed specimens was selected for amplification of the kdr gene fragment, followed by Sanger sequencing to identify and analyze resistance-associated mutations. Results The LC50 levels of deltamethrin among mosquitoes from the four populations in Luhe, Yancheng, the Rare Bird National Nature Reserve and the Tiaozi Ni Wetland Scenic Area were 2.048 5, 7.798 2, 3.473 3, and 17.695 5 mg/mL, respectively, with corresponding concentrations of deltamethrin ranging from 0.005 to 5.000,0.050 to 50.000,0.050 to 25.000 and 0.050 to 50.000 mg/mL, respectively. Furthermore, the ranges of the KT50 values were 11.76-107.43, 67.05-216.30,29.77-107.43 and 28.40-329.51 min; the 1-h knockdown rates were 34.58%-99.15%, 9.52%-43.80%, 55.09%-73.01%, and 10.09%-68.07%; and the 24-h mortality rates were 12.15%-67.52%,9.52%-79.56%,13.17%-82.21%, and 11.01%-78.99%, respectively. With respect to kdr gene mutation, we assayed a total of 63,70,59, and 57 mosquitoes for the four populations, for which we detected L1014F mutation frequencies of 14.29%, 35.00%, 20.34%, and 31.58%, respectively, with a majority of these mutations being heterozygous for resistance. In addition, five adult mosquitoes were identified has having synonymous mutations at site 1011[i. e. , AAT(asparagine)mutation to AAC(asparagine)]. Conclusions Our findings revealed the clear resistance of Cx. tritaeniorhynchus to deltamethrin in the Yancheng region of the Yellow Sea wetland, and the resistance phenotype and kdr frequency of Cx. tritaeniorhynchus in the wetland environment were comparable to those of Cx. tritaeniorhynchus in the wetland environment, thereby indicating that the resistance of different populations of Cx. tritaeniorhynchus was homogeneous under the pressure of different insecticide selection within and around the wetland. However, the underlying mechanisms need to be further studied.

Xanthine oxidase (XO) is an important therapeutic target for the treatment of hyperuricemia and gout. Based on the previously identified potent XO inhibitor 1, seventeen oxadiazoles and their ring-opening analogues were designed and synthesized via the bioisostere replacement strategy. Among them, compounds 2l, 2n, and 3b showed obvious XO inhibitory activity at the concentration of 10 μmol·L^-1, and compound 3b exhibited an IC₅₀ value of 1.45 μmol·L^-1.

Objective To investigate the clinical characteristics and management strategies of spinal infarction(SCI)combined with hypoxic-ischemic encephalopathy(HIE).Methods We report a case of SCI induced by cardiopulmonary arrest in a patient admitted to the General Hospital of Southern Theater Command in June 2021.A review of the relevant literature published in PubMed and CNKI from January 2014 to March 2024,was conducted to summarize the etiology,features,and treatment approaches for SCI.Results The patient presented with clinical features of quadriplegia accompanied by paresthesia,lumbar and cervical pain with paresthesia,dysphagia,dysphonia,and urinary and fecal incontinence.Spinal MRI revealed abnormal signals in the anterior and lateral columns at the C2-T1 spinal level,with no enhancement observed in contrast-enhanced scan.The patient was diagnosed as SCI combined with HIE,and was treated with antiplatelet therapy and rehabilitation.Literature review revealed that SCI is a rare central nervous system disease with multiple causes,often related to aortic surgery or pathology,presenting with segmental sensory disturbances among other clinical manifestations.MRI plays a significant role in its diagnosis,and there is currently no specific effective treatment available.Conclusions SCI has a sudden onset and is often insidious,frequently accompanying other diseases,leading to a high risk of misdiagnosis.In this case,SCI was considered to be caused by low blood pressure and vertebral artery tenuity.Clinical manifestations include paraplegia at the lesion level along with back/neck pain or limb paresthesia.Diagnosis primarily relies on MRI imaging while treatment involves secondary stroke prevention measures,rehabilitation training,complication prevention strategies as well as hyperbaric oxygen therapy.

Postoperative infection of internal fixation of closed fractures the lower limbs in adults represents a devastating complication, characterized by diagnostic challenges, prolonged treatment duration and high disability rates. Current management of these infections faces multiple challenges, such as difficulties in early accurate diagnosis, and various controversies about the treatment plan, leading to poor overall diagnosis and treatment results. To address these issues, based on evidence-based medicine and principles with emphasis on scientific rigor, clinical applicability and innovation, the Trauma Branch of the Chinese Medical Association, Orthopedic Branch of the Chinese Medical Doctor Association, Orthopedics Branch of the Chinese Medical Association, and Trauma Orthopedics and Polytrauma Group of the Resuscitation and Emergency Committee of the Chinese Medical Doctor Association have collaboratively organized a panel of relevant experts to develop the Guideline for diagnosis and treatment of infection after internal fixation of closed lower limb fractures in adults ( version 2025). The guideline proposed 10 recommendations, aiming to provide a foundation for standardized diagnosis and treatment of postoperative infection in adults with closed lower limb fractures.

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVES: To construct a Z-score regression model for coronary artery diameter based on echocardiographic data from children in Sichuan Province and to establish a Z-score calculation formula. METHODS: A total of 744 healthy children who underwent physical examinations at Sichuan Provincial People's Hospital from January 2020 to December 2022 were selected as the modeling group, while 251 children diagnosed with Kawasaki disease at the same hospital from January 2018 to December 2022 were selected as the validation group. Pearson correlation analysis was conducted to analyze the relationships between coronary artery diameter values and age, height, weight, and body surface area. A regression model was constructed using function transformation to identify the optimal regression model and establish the Z-score calculation formula, which was then validated. RESULTS: The Pearson correlation analysis showed that the correlation coefficients for the diameters of the left main coronary artery, left anterior descending artery, left circumflex artery, and right coronary artery with body surface area were 0.815, 0.793, 0.704, and 0.802, respectively (P<0.05). Among the constructed regression models, the power function regression model demonstrated the best performance and was therefore chosen as the optimal model for establishing the Z-score calculation formula. Based on this Z-score calculation formula, the detection rate of coronary artery lesions was found to be 21.5% (54/251), which was higher than the detection rate based on absolute values of coronary artery diameter. Notably, in the left anterior descending and left circumflex arteries, the detection rate of coronary artery lesions using this Z-score calculation formula was higher than that of previous classic Z-score calculation formulas. CONCLUSIONS The Z-score calculation formula established based on the power function regression model has a higher detection rate for coronary artery lesions, providing a strong reference for clinicians, particularly in assessing coronary artery lesions in children with Kawasaki disease.
Humans ; Male ; Female ; Child, Preschool ; Child ; Coronary Artery Disease/diagnostic imaging* ; Infant ; Mucocutaneous Lymph Node Syndrome ; Regression Analysis ; Coronary Vessels/diagnostic imaging* ; Echocardiography ; Adolescent

OBJECTIVES: To study the clinical characteristics, efficacy, and prognosis of pediatric Langerhans cell histiocytosis (LCH). METHODS: A retrospective analysis was conducted on 72 children with newly diagnosed LCH. RESULTS: The median age of the 72 children was 5 years (range: 0-14 years), with skull involvement being the most common (56 cases, 77.8%). The BRAF-V600E mutation was not associated with clinical characteristics, efficacy, or prognosis (P>0.05). The 5-year overall survival rate was 91.6%±4.2%, and the 5-year event-free survival (EFS) rate was 67.5%±5.8%. The 6-week chemotherapy response rate and 5-year EFS rate were lower in the risk organ involvement group compared to the no risk organ involvement group (P<0.05). The five-year overall survival rates for the group with multi-system involvement and the group with platelet count ≥450×10⁹/L were respectively lower than those for the single-system involvement group and the group with platelet count <450×10⁹/L (P<0.05). Risk organ involvement is an independent risk factor for 5-year EFS (P<0.05). CONCLUSIONS Skull is the most commonly affected site in pediatric LCH. The BRAF-V600E mutation is not related to clinical characteristics, efficacy, or prognosis. Elevated platelet count, risk organ involvement, and multisystem involvement are associated with poor prognosis, with risk organ involvement being an independent risk factor for 5-year EFS.
Humans ; Histiocytosis, Langerhans-Cell/therapy* ; Child, Preschool ; Child ; Male ; Infant ; Female ; Adolescent ; Retrospective Studies ; Proto-Oncogene Proteins B-raf/genetics* ; Prognosis ; Infant, Newborn ; Mutation

OBJECTIVES: To evaluate the efficacy and safety of avatrombopag in promoting platelet engraftment after allogeneic hematopoietic stem cell transplantation (allo-HSCT) in children, compared with recombinant human thrombopoietin (rhTPO). METHODS: A retrospective analysis was conducted on 53 pediatric patients who underwent allo-HSCT at the Institute of Hematology and Blood Diseases Hospital, Chinese Academy of Medical Sciences from April 2023 to August 2024. Based on medications used during the periengraftment period, patients were divided into two groups: the avatrombopag group (n=15) and the rhTPO group (n=38). RESULTS: At days 14, 30, and 60 post-transplant, platelet engraftment was achieved in 20% (3/15), 60% (9/15), and 93% (14/15) of patients in the avatrombopag group, and in 39% (15/38), 82% (31/38), and 97% (37/38) in the rhTPO group, respectively. There were no significant differences between the two groups in platelet engraftment rates at each time point, cumulative incidence of platelet engraftment, overall survival, and relapse-free survival (all P>0.05). Multivariable Cox proportional hazards analysis indicated that acute graft-versus-host disease was an independent risk factor for delayed platelet engraftment (P=0.043). CONCLUSIONS In children undergoing allo-HSCT, avatrombopag effectively promotes platelet engraftment, with efficacy and safety comparable to rhTPO, and represents a viable therapeutic option.
Humans ; Retrospective Studies ; Hematopoietic Stem Cell Transplantation/adverse effects* ; Male ; Female ; Child ; Child, Preschool ; Infant ; Adolescent ; Transplantation, Homologous ; Blood Platelets/drug effects* ; Thiazoles/therapeutic use* ; Thrombopoietin/therapeutic use* ; Thiophenes