Xanthine oxidase (XO) is an important therapeutic target for the treatment of hyperuricemia and gout. Based on the previously identified potent XO inhibitor 1, seventeen oxadiazoles and their ring-opening analogues were designed and synthesized via the bioisostere replacement strategy. Among them, compounds 2l, 2n, and 3b showed obvious XO inhibitory activity at the concentration of 10 μmol·L^-1, and compound 3b exhibited an IC₅₀ value of 1.45 μmol·L^-1.

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVES: To construct a Z-score regression model for coronary artery diameter based on echocardiographic data from children in Sichuan Province and to establish a Z-score calculation formula. METHODS: A total of 744 healthy children who underwent physical examinations at Sichuan Provincial People's Hospital from January 2020 to December 2022 were selected as the modeling group, while 251 children diagnosed with Kawasaki disease at the same hospital from January 2018 to December 2022 were selected as the validation group. Pearson correlation analysis was conducted to analyze the relationships between coronary artery diameter values and age, height, weight, and body surface area. A regression model was constructed using function transformation to identify the optimal regression model and establish the Z-score calculation formula, which was then validated. RESULTS: The Pearson correlation analysis showed that the correlation coefficients for the diameters of the left main coronary artery, left anterior descending artery, left circumflex artery, and right coronary artery with body surface area were 0.815, 0.793, 0.704, and 0.802, respectively (P<0.05). Among the constructed regression models, the power function regression model demonstrated the best performance and was therefore chosen as the optimal model for establishing the Z-score calculation formula. Based on this Z-score calculation formula, the detection rate of coronary artery lesions was found to be 21.5% (54/251), which was higher than the detection rate based on absolute values of coronary artery diameter. Notably, in the left anterior descending and left circumflex arteries, the detection rate of coronary artery lesions using this Z-score calculation formula was higher than that of previous classic Z-score calculation formulas. CONCLUSIONS The Z-score calculation formula established based on the power function regression model has a higher detection rate for coronary artery lesions, providing a strong reference for clinicians, particularly in assessing coronary artery lesions in children with Kawasaki disease.
Humans ; Male ; Female ; Child, Preschool ; Child ; Coronary Artery Disease/diagnostic imaging* ; Infant ; Mucocutaneous Lymph Node Syndrome ; Regression Analysis ; Coronary Vessels/diagnostic imaging* ; Echocardiography ; Adolescent

OBJECTIVES: To study the clinical characteristics, efficacy, and prognosis of pediatric Langerhans cell histiocytosis (LCH). METHODS: A retrospective analysis was conducted on 72 children with newly diagnosed LCH. RESULTS: The median age of the 72 children was 5 years (range: 0-14 years), with skull involvement being the most common (56 cases, 77.8%). The BRAF-V600E mutation was not associated with clinical characteristics, efficacy, or prognosis (P>0.05). The 5-year overall survival rate was 91.6%±4.2%, and the 5-year event-free survival (EFS) rate was 67.5%±5.8%. The 6-week chemotherapy response rate and 5-year EFS rate were lower in the risk organ involvement group compared to the no risk organ involvement group (P<0.05). The five-year overall survival rates for the group with multi-system involvement and the group with platelet count ≥450×10⁹/L were respectively lower than those for the single-system involvement group and the group with platelet count <450×10⁹/L (P<0.05). Risk organ involvement is an independent risk factor for 5-year EFS (P<0.05). CONCLUSIONS Skull is the most commonly affected site in pediatric LCH. The BRAF-V600E mutation is not related to clinical characteristics, efficacy, or prognosis. Elevated platelet count, risk organ involvement, and multisystem involvement are associated with poor prognosis, with risk organ involvement being an independent risk factor for 5-year EFS.
Humans ; Histiocytosis, Langerhans-Cell/therapy* ; Child, Preschool ; Child ; Male ; Infant ; Female ; Adolescent ; Retrospective Studies ; Proto-Oncogene Proteins B-raf/genetics* ; Prognosis ; Infant, Newborn ; Mutation

OBJECTIVES: To evaluate the efficacy and safety of avatrombopag in promoting platelet engraftment after allogeneic hematopoietic stem cell transplantation (allo-HSCT) in children, compared with recombinant human thrombopoietin (rhTPO). METHODS: A retrospective analysis was conducted on 53 pediatric patients who underwent allo-HSCT at the Institute of Hematology and Blood Diseases Hospital, Chinese Academy of Medical Sciences from April 2023 to August 2024. Based on medications used during the periengraftment period, patients were divided into two groups: the avatrombopag group (n=15) and the rhTPO group (n=38). RESULTS: At days 14, 30, and 60 post-transplant, platelet engraftment was achieved in 20% (3/15), 60% (9/15), and 93% (14/15) of patients in the avatrombopag group, and in 39% (15/38), 82% (31/38), and 97% (37/38) in the rhTPO group, respectively. There were no significant differences between the two groups in platelet engraftment rates at each time point, cumulative incidence of platelet engraftment, overall survival, and relapse-free survival (all P>0.05). Multivariable Cox proportional hazards analysis indicated that acute graft-versus-host disease was an independent risk factor for delayed platelet engraftment (P=0.043). CONCLUSIONS In children undergoing allo-HSCT, avatrombopag effectively promotes platelet engraftment, with efficacy and safety comparable to rhTPO, and represents a viable therapeutic option.
Humans ; Retrospective Studies ; Hematopoietic Stem Cell Transplantation/adverse effects* ; Male ; Female ; Child ; Child, Preschool ; Infant ; Adolescent ; Transplantation, Homologous ; Blood Platelets/drug effects* ; Thiazoles/therapeutic use* ; Thrombopoietin/therapeutic use* ; Thiophenes

OBJECTIVE: To investigate the risk factors, clinical characteristics, and bacterial resistance of bloodstream infections caused by Streptococcus mitis in children with hematological disease, so as to provide a reference for infection control. METHODS: The clinical information and laboratory findings of pediatric patients complicated with blood cultures positive for Streptococcus mitis from January 2018 to December 2020 in the Institute of Hematology & Blood Diseases Hospital were searched and collected. The clinical characteristics, susceptibility factors, and antibiotic resistance of the children were retrospectively analyzed. RESULTS: Data analysis from 2018 to 2020 showed that the proportion of Streptococcus mitis isolated from bloodstream infections in children (≤14 years old) with hematological diseases was the highest (19.91%) and significantly higher than other bacteria, accounting for 38.64% of Gram-positive cocci, and presented as an increasing trend year by year. A total of 427 children tested positive blood cultures, including 85 children with bloodstream infections caused by Streptococcus mitis who tested after fever. Most children experienced a recurrent high fever in the early and middle stages (≤6 d) of neutropenia and persistent fever for more than 3 days. After adjusting the antibiotics according to the preliminary drug susceptibility results, the body temperature of most children (63.5%) returned to normal within 4 days. The 85 children were mainly diagnosed with acute myeloid leukemia (AML), accounting for 84.7%. The proportion of children in the neutropenia stage was 97.7%. The incidence of oral mucosal damage, lung infection, and gastrointestinal injury symptoms was 40%, 31.8%, and 27.1%, respectively. The ratio of elevated C-reactive protein (CRP) and procalcitonin was 65.9% and 9.4%, respectively. All isolated strains of Streptococcus mitis were not resistant to vancomycin and linezolid, and the resistance rate to penicillin, cefotaxime, levofloxacin, and quinupristin-dalfopristin was 10.6%, 8.2%, 9.4%, and 14.1%, respectively. None of children died due to bloodstream infection caused by Streptococcus mitis. CONCLUSION The infection rate of Streptococcus mitis is increasing year by year in children with hematological diseases, especially in children with AML. Among them, neutropenia and oral mucosal damage after chemotherapy are high-risk infection factors. The common clinical symptoms include persistent high fever, oral mucosal damage, and elevated CRP. Penicillin and cephalosporins have good sensitivity. Linezolid, as a highly sensitive antibiotic, can effectively control infection and shorten the course of disease.
Humans ; Child ; Streptococcal Infections/microbiology* ; Retrospective Studies ; Hematologic Diseases/complications* ; Streptococcus mitis ; Drug Resistance, Bacterial ; Risk Factors ; Microbial Sensitivity Tests ; Anti-Bacterial Agents ; Female ; Male ; Bacteremia/microbiology* ; Child, Preschool ; Adolescent

BACKGROUND: Atrial fibrillation (AF) is a common cardiac arrhythmia in the elderly. This study aimed to evaluate urban-rural disparities in its prevalence and management in elderly Chinese. METHODS: Consecutive participants aged ≥ 65 years attending outpatient clinics were enrolled for AF screening using handheld single-lead electrocardiogram (ECG) from April 2017 to December 2022. Each ECG rhythm strip was reviewed from the research team. AF or uninterpretable single-lead ECGs were referred for 12-lead ECG. Primary study outcome comparison was between rural and urban areas for the prevalence of AF. The Student's t-test was used to compare mean values of clinical characteristics between rural and urban participants, while the Pearson's chi-square test was used to compare between-group proportions. Multivariate stepwise logistic regression analysis was performed to estimate the association between AF and various patient characteristics. RESULTS: The 29,166 study participants included 13,253 men (45.4%) and had a mean age of 72.2 years. The 7073 rural participants differed significantly (P ≤ 0.02) from the 22,093 urban participants in several major characteristics, such as older age, greater body mass index, and so on. The overall prevalence of AF was 4.6% (n = 1347). AF was more prevalent in 7073 rural participants than 22,093 urban participants (5.6% vs. 4.3%, P < 0.01), before and after adjustment for age, body mass index, blood pressure, pulse rate, cigarette smoking, alcohol consumption and prior medical history. Multivariate logistic regression analysis identified overweight/obesity (OR = 1.35, 95% CI: 1.17-1.54) in urban areas and cigarette smoking (OR = 1.62, 95% CI: 1.20-2.17) and alcohol consumption (OR = 1.42, 95% CI: 1.04-1.93) in rural areas as specific risk factors for prevalent AF. In patients with known AF in urban areas (n = 781) and rural areas (n = 338), 60.6% and 45.9%, respectively, received AF treatment (P < 0.01), and only 22.4% and 17.2%, respectively, received anticoagulation therapy (P = 0.05). CONCLUSIONS In China, there are urban-rural disparities in AF in the elderly, with a higher prevalence and worse management in rural areas than urban areas. Our study findings provide insight for health policymakers to consider urban-rural disparity in the prevention and treatment of AF.

Ursodeoxycholic acid (UDCA) is a naturally occurring, low-toxicity, and hydrophilic bile acid (BA) in the human body that is converted by intestinal flora using primary BA. Solute carrier family 7 member 11 (SLC7A11) functions to uptake extracellular cystine in exchange for glutamate, and is highly expressed in a variety of human cancers. Retroperitoneal liposarcoma (RLPS) refers to liposarcoma originating from the retroperitoneal area. Lipidomics analysis revealed that UDCA was one of the most significantly downregulated metabolites in sera of RLPS patients compared with healthy subjects. The augmentation of UDCA concentration (≥25 μg/mL) demonstrated a suppressive effect on the proliferation of liposarcoma cells. [¹⁵N₂]-cystine and [¹³C₅]-glutamine isotope tracing revealed that UDCA impairs cystine uptake and glutathione (GSH) synthesis. Mechanistically, UDCA binds to the cystine transporter SLC7A11 to inhibit cystine uptake and impair GSH de novo synthesis, leading to reactive oxygen species (ROS) accumulation and mitochondrial oxidative damage. Furthermore, UDCA can promote the anti-cancer effects of ferroptosis inducers (Erastin, RSL3), the murine double minute 2 (MDM2) inhibitors (Nutlin 3a, RG7112), cyclin dependent kinase 4 (CDK4) inhibitor (Abemaciclib), and glutaminase inhibitor (CB839). Together, UDCA functions as a cystine exchange factor that binds to SLC7A11 for antitumor activity, and SLC7A11 is not only a new transporter for BA but also a clinically applicable target for UDCA. More importantly, in combination with other antitumor chemotherapy or physiotherapy treatments, UDCA may provide effective and promising treatment strategies for RLPS or other types of tumors in a ROS-dependent manner.

OBJECTIVES: This study aimed to investigate the impact of foam macrophages (FMs) on the intracellular survival of Mycobacterium tuberculosis (MTB) and identify the molecular mechanisms influencing MTB survival. METHODS: An in vitro FM model was established using oleic acid induction. Transcriptomic and metabolomic analyses were conducted to identify the key molecular pathways involved in FM-mediated MTB survival. RESULTS: Induced FMs effectively restricted MTB survival. Transcriptomic and metabolomic profiling revealed distinct changes in gene and metabolite expression in FMs during MTB infection compared with normal macrophages. Integrated analyses identified significant alterations in the cyclic adenosine monophosphate (cAMP) signaling pathway, indicating that its activation contributes to the FM-mediated restriction of MTB survival. CONCLUSIONS FMs inhibit MTB survival. The cAMP signaling pathway is a key contributor. These findings enhance the understanding of the role of FMs in tuberculosis progression, suggest potential targets for host-directed therapies, and offer new directions for developing diagnostic and therapeutic strategies against tuberculosis.
Mycobacterium tuberculosis/physiology* ; Transcriptome ; Metabolomics ; Foam Cells/microbiology* ; Humans ; Metabolome ; Tuberculosis/microbiology* ; Gene Expression Profiling