BACKGROUND:In recent years,numerous studies have shown that autophagy and mitophagy play an important role in the regulation of bone metabolism.Under non-physiological conditions,mitophagy breaks the balance of bone metabolism and triggers metabolism disorders,which affect osteoblasts,osteoclasts,osteocytes,chondrocytes,bone marrow mesenchymal stem cells,etc. OBJECTIVE:To summarize the mechanism of mitophagy in regulating bone metabolic diseases and its application in clinical treatment. METHODS:PubMed,Web of Science,CNKI,WanFang and VIP databases were searched by computer using the keywords of"mitophagy,bone metabolism,osteoblasts,osteoclasts,osteocytes,chondrocytes,bone marrow mesenchymal stem cells"in English and Chinese.The search time was from 2008 to 2023.According to the inclusion criteria,90 articles were finally included for review and analysis. RESULTS AND CONCLUSION:Mitophagy promotes the generation of osteoblasts through SIRT1,PINK1/Parkin,FOXO3 and PI3K signaling pathways,while inhibiting osteoclast function through PINK1/Parkin and SIRT1 signaling pathways.Mitophagy leads to bone loss by increasing calcium phosphate particles and tissue protein kinase K in bone tissue.Mitophagy improves the function of chondrocytes through PINK1/Parkin,PI3K/AKT/mTOR and AMPK signaling pathways.Modulation of mitophagy shows great potential in the treatment of bone diseases,but there are still some issues to be further explored,such as different stages of drug-activated mitophagy,and the regulatory mechanisms of different signaling pathways.

Medical institutions, with their clinical practice foundation and abundant human use experience data, have become important carriers for the inheritance and innovation of traditional Chinese medicine(TCM) and the "cradles" of the preparation of new TCM. To effectively promote the transformation of new TCM originating from the TCM clinical practice in medical institutions and establish an effective evaluation index system for the transformation of new TCM conforming to the characteristics of TCM, consensus experts adopted the literature research, questionnaire survey, Delphi method, etc. By focusing on the policy and technical evaluation of new TCM originating from the TCM clinical practice in medical institutions, a comprehensive evaluation from the dimensions of drug safety, efficacy, feasibility, and characteristic advantages was conducted, thus forming a comprehensive evaluation system with four primary indicators and 37 secondary indicators. The expert consensus reached aims to encourage medical institutions at all levels to continuously improve the high-quality research and development and transformation of new TCM originating from the TCM clinical practice in medical institutions and targeted at clinical needs, so as to provide a decision-making basis for the preparation, selection, cultivation, and transformation of new TCM for medical institutions, improve the development efficiency of new TCM, and precisely respond to the public medication needs.
Medicine, Chinese Traditional/standards* ; Humans ; Consensus ; Drugs, Chinese Herbal/therapeutic use* ; Surveys and Questionnaires

This study investigated the protective effect of arbutin(Arb) in yam on lipopolysaccharide(LPS)-induced acute lung injury(ALI) in a mouse model and revealed its possible mechanism of action by metabolomics technology, providing a theoretical basis for clinical treatment of ALI. SPF BALB/c mice were randomly divided into normal control group, model group, resveratrol(Rv)-positive control group, Arb low-dose(15 mg·kg~(-1)) group, and Arb high-dose(30 mg·kg~(-1)) group. The LPS-induced ALI model was established in all groups except the normal control group. Hematoxylin-eosin(HE) staining, TUNEL staining, and WBP whole-body non-invasive pulmonary function testing were used to evaluate the degree of lung tissue damage and lung function changes. Enzyme-linked immunosorbent assay(ELISA) was used to detect the level of inflammatory factors in lung tissue. Flow cytometry was used to analyze the M1/M2 polarization status of macrophages in lung tissue. Western blot was used to detect the expression levels of the TLR4 signaling pathway and related apoptotic proteins. Liquid chromatograph-mass spectrometer(LC-MS) metabolomics was used to analyze the changes in serum metabolic profile after Arb intervention. The results showed that Arb pretreatment significantly alleviated LPS-induced lung tissue injury, improved lung function, reduced the levels of pro-inflammatory factors(IL-6, TNF-α, IL-18, and IL-1β), and regulated the polarization status of M1/M2 macrophages. In addition, Arb inhibited the activation of the TLR4 signaling pathway, reduced the expression of pro-apoptotic proteins such as Bax, caspase-3, and caspase-9, up-regulated the level of Bcl-2 protein, and inhibited apoptosis of lung cells. Metabolomic analysis showed that Arb significantly improved LPS-induced metabolic abnormalities, mainly involving key pathways such as galactose metabolism, phenylalanine metabolism, and lipid metabolism. In summary, Arb can significantly reduce LPS-induced ALI by regulating the release of inflammatory factors, inhibiting the activation of the TLR4 signaling pathway, improving metabolic disorders, and regulating macrophage polarization, indicating that Arb has potential clinical application value.
Animals ; Acute Lung Injury/chemically induced* ; Mice ; Mice, Inbred BALB C ; Arbutin/administration & dosage* ; Male ; Toll-Like Receptor 4/immunology* ; Apoptosis/drug effects* ; Lung/metabolism* ; Signal Transduction/drug effects* ; Protective Agents/administration & dosage* ; Humans ; Macrophages/immunology* ; Drugs, Chinese Herbal/administration & dosage*

To investigate the impact of preoperative serum follicle-stimulating hormone (FSH) levels on the probability of testicular sperm retrieval, we conducted a study of nonobstructive azoospermic (NOA) men with different testicular volumes (TVs) who underwent microdissection testicular sperm extraction (micro-TESE). A total of 177 NOA patients undergoing micro-TESE for the first time from April 2019 to November 2022 in Shenzhen Zhongshan Obstetrics and Gynecology Hospital (formerly Shenzhen Zhongshan Urology Hospital, Shenzhen, China) were retrospectively reviewed. The subjects were divided into four groups based on average TV quartiles. Serum hormone levels in each TV group were compared between positive and negative sperm retrieval subgroups. Overall sperm retrieval rate was 57.6%. FSH levels (median [interquartile range]) were higher in the positive sperm retrieval subgroup compared with the negative outcome subgroup when average TV was <5 ml (first quartile [Q1: TV <3 ml]: 43.32 [17.92] IU l -1 vs 32.95 [18.56] IU l -1 , P = 0.048; second quartile [Q2: 3 ml ≤ TV <5 ml]: 31.31 [15.37] IU l -1 vs 25.59 [18.40] IU l -1 , P = 0.042). Elevated serum FSH levels were associated with successful micro-TESE sperm retrieval in NOA men whose average TVs were <5 ml (adjusted odds ratio [OR]: 1.06 per unit increase; 95% confidence interval [CI]: 1.01-1.11; P = 0.011). In men with TVs ≥5 ml, larger TVs were associated with lower odds of sperm retrieval (adjusted OR: 0.84 per 1 ml increase; 95% CI: 0.71-0.98; P = 0.029). In conclusion, elevated serum FSH levels were associated with positive sperm retrieval in micro-TESE in NOA men with TVs <5 ml. In men with TV ≥5 ml, increases in average TVs were associated with lower odds of sperm retrieval.
Humans ; Male ; Azoospermia/surgery* ; Sperm Retrieval/statistics & numerical data* ; Adult ; Follicle Stimulating Hormone/blood* ; Retrospective Studies ; Testis/pathology* ; Microdissection ; Organ Size

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVES: To construct a Z-score regression model for coronary artery diameter based on echocardiographic data from children in Sichuan Province and to establish a Z-score calculation formula. METHODS: A total of 744 healthy children who underwent physical examinations at Sichuan Provincial People's Hospital from January 2020 to December 2022 were selected as the modeling group, while 251 children diagnosed with Kawasaki disease at the same hospital from January 2018 to December 2022 were selected as the validation group. Pearson correlation analysis was conducted to analyze the relationships between coronary artery diameter values and age, height, weight, and body surface area. A regression model was constructed using function transformation to identify the optimal regression model and establish the Z-score calculation formula, which was then validated. RESULTS: The Pearson correlation analysis showed that the correlation coefficients for the diameters of the left main coronary artery, left anterior descending artery, left circumflex artery, and right coronary artery with body surface area were 0.815, 0.793, 0.704, and 0.802, respectively (P<0.05). Among the constructed regression models, the power function regression model demonstrated the best performance and was therefore chosen as the optimal model for establishing the Z-score calculation formula. Based on this Z-score calculation formula, the detection rate of coronary artery lesions was found to be 21.5% (54/251), which was higher than the detection rate based on absolute values of coronary artery diameter. Notably, in the left anterior descending and left circumflex arteries, the detection rate of coronary artery lesions using this Z-score calculation formula was higher than that of previous classic Z-score calculation formulas. CONCLUSIONS The Z-score calculation formula established based on the power function regression model has a higher detection rate for coronary artery lesions, providing a strong reference for clinicians, particularly in assessing coronary artery lesions in children with Kawasaki disease.
Humans ; Male ; Female ; Child, Preschool ; Child ; Coronary Artery Disease/diagnostic imaging* ; Infant ; Mucocutaneous Lymph Node Syndrome ; Regression Analysis ; Coronary Vessels/diagnostic imaging* ; Echocardiography ; Adolescent

A 10-year-old girl was admitted with a 38-hour history of widespread subcutaneous petechiae and hematuria and a 6-hour history of jaundice and oliguria. Physical examination revealed widespread subcutaneous petechiae and jaundice of the skin and sclera. Laboratory tests showed anemia, thrombocytopenia, acute kidney injury, and markedly elevated lactate dehydrogenase. Thrombotic microangiopathy was initially diagnosed, with a high suspicion of atypical hemolytic uremic syndrome (aHUS). Eculizumab was initiated within 9 hours of admission (within 48 hours of onset). After the first infusion, hemolysis rapidly ceased, and the platelet count and renal function gradually returned to normal. Whole-exome sequencing identified homozygous deletions of CFHR1 exon 2 and CFHR4 exon 1. aHUS typically has abrupt onset and rapid progression. Clinicians should maintain high suspicion for aHUS when the triad of thrombocytopenia, microangiopathic hemolytic anemia, and acute kidney injury is present. Ultra-early eculizumab (within 48 hours of onset) rapidly blocks complement-mediated thrombotic microangiopathy, reverses organ injury, and improves long-term prognosis. Additionally, complement-related genetic testing is important for etiological clarification and individualized determination of eculizumab treatment duration.
Humans ; Antibodies, Monoclonal, Humanized/administration & dosage* ; Female ; Atypical Hemolytic Uremic Syndrome/drug therapy* ; Child ; Complement C3b Inactivator Proteins

BACKGROUND: Atrial fibrillation (AF) is a common cardiac arrhythmia in the elderly. This study aimed to evaluate urban-rural disparities in its prevalence and management in elderly Chinese. METHODS: Consecutive participants aged ≥ 65 years attending outpatient clinics were enrolled for AF screening using handheld single-lead electrocardiogram (ECG) from April 2017 to December 2022. Each ECG rhythm strip was reviewed from the research team. AF or uninterpretable single-lead ECGs were referred for 12-lead ECG. Primary study outcome comparison was between rural and urban areas for the prevalence of AF. The Student's t-test was used to compare mean values of clinical characteristics between rural and urban participants, while the Pearson's chi-square test was used to compare between-group proportions. Multivariate stepwise logistic regression analysis was performed to estimate the association between AF and various patient characteristics. RESULTS: The 29,166 study participants included 13,253 men (45.4%) and had a mean age of 72.2 years. The 7073 rural participants differed significantly (P ≤ 0.02) from the 22,093 urban participants in several major characteristics, such as older age, greater body mass index, and so on. The overall prevalence of AF was 4.6% (n = 1347). AF was more prevalent in 7073 rural participants than 22,093 urban participants (5.6% vs. 4.3%, P < 0.01), before and after adjustment for age, body mass index, blood pressure, pulse rate, cigarette smoking, alcohol consumption and prior medical history. Multivariate logistic regression analysis identified overweight/obesity (OR = 1.35, 95% CI: 1.17-1.54) in urban areas and cigarette smoking (OR = 1.62, 95% CI: 1.20-2.17) and alcohol consumption (OR = 1.42, 95% CI: 1.04-1.93) in rural areas as specific risk factors for prevalent AF. In patients with known AF in urban areas (n = 781) and rural areas (n = 338), 60.6% and 45.9%, respectively, received AF treatment (P < 0.01), and only 22.4% and 17.2%, respectively, received anticoagulation therapy (P = 0.05). CONCLUSIONS In China, there are urban-rural disparities in AF in the elderly, with a higher prevalence and worse management in rural areas than urban areas. Our study findings provide insight for health policymakers to consider urban-rural disparity in the prevention and treatment of AF.

Dry eye disease (DED) is a prevalent and intractable ocular disease induced by a variety of causes. Elevated sphingomyelin (SM) levels and pro-inflammatory cytokines were detected on the ocular surface of DED patients, particularly in the meibomian glands. Sphingomyelin synthase 2 (SMS2), one of the proteins involved in SM synthesis, would light a novel way of developing a DED therapy strategy. Herein, we report the design and optimization of a series of novel thiophene carboxamide derivatives to afford 14l with an improved highly potent inhibitory activity on SM synthesis (IC_{50, SMS2} = 28 nmol/L). Moreover, 14l exhibited a notable protective effect of anti-inflammation and anti-apoptosis on human corneal epithelial cells (HCEC) under TNF-α-hyperosmotic stress conditions in vitro, with an acceptable ocular specific distribution (corneas and meibomian glands) and pharmacokinetics (PK) profiles (t _{1/2, cornea} = 1.11 h; t _{1/2, meibomian glands} = 4.32 h) in rats. Furthermore, 14l alleviated the dry eye symptoms including corneal fluorescein staining scores and tear secretion in a dose-dependent manner in mice. Mechanically, 14l reduced the mRNA expression of Tnf-α, Il-1β and Mmp-9 in corneas, as well as the proportion of very long chain SM in meibomian glands. Our findings provide a new strategy for DED therapy based on selective SMS2 inhibitors.

CD47 is an immune checkpoint widely regarded as a 'don't eat me' signal. CD47-based anti-cancer therapy has received considerable attention, with a significant number of clinical trials conducted. While anti-cancer therapies based on CD47 remain a focal point of interest among researchers, it is noteworthy that an increasing number of studies have found that CD47-based therapy ameliorated the pathological status of non-cancer diseases. This review aims to provide an overview of the recent progress in comprehending the role of CD47-based therapy in non-cancer diseases, including diseases of the circulatory system, nervous system, digestive system, and so on. Furthermore, we sought to delineate the promising mechanisms of CD47-based therapy in treating non-cancer diseases. Our findings suggest that CD47-based agents may exert their effect by regulating phagocytosis, regulating T cells, dendritic cells, and neutrophils, and regulating the secretion of cytokines and chemokines. Additionally, we put forward the orientation of further research to bring to light the potential of CD47 and its binding partners as a target in non-cancer diseases.