BACKGROUND:In recent years,numerous studies have shown that autophagy and mitophagy play an important role in the regulation of bone metabolism.Under non-physiological conditions,mitophagy breaks the balance of bone metabolism and triggers metabolism disorders,which affect osteoblasts,osteoclasts,osteocytes,chondrocytes,bone marrow mesenchymal stem cells,etc. OBJECTIVE:To summarize the mechanism of mitophagy in regulating bone metabolic diseases and its application in clinical treatment. METHODS:PubMed,Web of Science,CNKI,WanFang and VIP databases were searched by computer using the keywords of"mitophagy,bone metabolism,osteoblasts,osteoclasts,osteocytes,chondrocytes,bone marrow mesenchymal stem cells"in English and Chinese.The search time was from 2008 to 2023.According to the inclusion criteria,90 articles were finally included for review and analysis. RESULTS AND CONCLUSION:Mitophagy promotes the generation of osteoblasts through SIRT1,PINK1/Parkin,FOXO3 and PI3K signaling pathways,while inhibiting osteoclast function through PINK1/Parkin and SIRT1 signaling pathways.Mitophagy leads to bone loss by increasing calcium phosphate particles and tissue protein kinase K in bone tissue.Mitophagy improves the function of chondrocytes through PINK1/Parkin,PI3K/AKT/mTOR and AMPK signaling pathways.Modulation of mitophagy shows great potential in the treatment of bone diseases,but there are still some issues to be further explored,such as different stages of drug-activated mitophagy,and the regulatory mechanisms of different signaling pathways.

Dry eye disease (DED) is a prevalent and intractable ocular disease induced by a variety of causes. Elevated sphingomyelin (SM) levels and pro-inflammatory cytokines were detected on the ocular surface of DED patients, particularly in the meibomian glands. Sphingomyelin synthase 2 (SMS2), one of the proteins involved in SM synthesis, would light a novel way of developing a DED therapy strategy. Herein, we report the design and optimization of a series of novel thiophene carboxamide derivatives to afford 14l with an improved highly potent inhibitory activity on SM synthesis (IC_{50, SMS2} = 28 nmol/L). Moreover, 14l exhibited a notable protective effect of anti-inflammation and anti-apoptosis on human corneal epithelial cells (HCEC) under TNF-α-hyperosmotic stress conditions in vitro, with an acceptable ocular specific distribution (corneas and meibomian glands) and pharmacokinetics (PK) profiles (t _{1/2, cornea} = 1.11 h; t _{1/2, meibomian glands} = 4.32 h) in rats. Furthermore, 14l alleviated the dry eye symptoms including corneal fluorescein staining scores and tear secretion in a dose-dependent manner in mice. Mechanically, 14l reduced the mRNA expression of Tnf-α, Il-1β and Mmp-9 in corneas, as well as the proportion of very long chain SM in meibomian glands. Our findings provide a new strategy for DED therapy based on selective SMS2 inhibitors.

CD47 is an immune checkpoint widely regarded as a 'don't eat me' signal. CD47-based anti-cancer therapy has received considerable attention, with a significant number of clinical trials conducted. While anti-cancer therapies based on CD47 remain a focal point of interest among researchers, it is noteworthy that an increasing number of studies have found that CD47-based therapy ameliorated the pathological status of non-cancer diseases. This review aims to provide an overview of the recent progress in comprehending the role of CD47-based therapy in non-cancer diseases, including diseases of the circulatory system, nervous system, digestive system, and so on. Furthermore, we sought to delineate the promising mechanisms of CD47-based therapy in treating non-cancer diseases. Our findings suggest that CD47-based agents may exert their effect by regulating phagocytosis, regulating T cells, dendritic cells, and neutrophils, and regulating the secretion of cytokines and chemokines. Additionally, we put forward the orientation of further research to bring to light the potential of CD47 and its binding partners as a target in non-cancer diseases.

Objective To explore the predictive value of dose surface histogram(DSH)in image guided radiotherapy(IGRT)for radiotherapy-induced acute radiation proctitis(ARP)in cervical cancer(CCA).Methods Totally 380 patients with CCA IGRT admitted to some hospital from May 2019 to May 2023 were selected prospectively and randomly divided into a control group(n=1 80)and an experimental group(n=200).The patients in the 2 groups were followed up and the incidence rates of ARP were counted,and rectal dose distribution was evaluated using dose volume histogram(DVH)in the control group and DSH in the experimental group.The predictive values of DVH and DSH for ARP were evaluated and compared using ROC curves.Statistical analysis was performed using SPSS 21.0 software.Results The two groups did not have statistically significant difference in the incidence rate of ARP(P＞0.05),while there were significant differences in the evaluation indicators of the rectal dose distribution(P＜0.05).V40,V50,S40 and S50 proved to have low predictive values for grade Ⅰ-Ⅳ ARP with AUC 0.700(P＜0.05);V60 and S60 had moderate predictive values for grade Ⅰ-Ⅳ ARP with AUC greater than 0.700 and less than or equal to 0.900(P＜0.05);V70,V78,S70 and S7s showed high predictive values for grade Ⅰ-Ⅳ ARP with AUC higher than 0.900(P＜0.05).Delong's test results indicated that DVH and DSH had no significant differences in AUC when used to predict gradeⅠ-Ⅳ ARP(allP＞0.05).Conclusion DSH is essentially the same as DVH when used for the prediction of grade Ⅰ-Ⅳ ARP due to CCA IGRT,and thus can be used for the supplementation and optimization of radiotherapy planning systems.[Chinese Medical Equipment Journal,2025,46(3):48-53]

This study was aimed at identifying the pathogenic bacteria responsible for the death of a young tiger at the Fujian Meihua Mountain South China Tiger Breeding Research Institute.Tissue samples from the lungs,liver,and intestines of the deceased tiger were collected,and the bacteria were cultured inasterile environment.The bacterial strains were characterized according to their morphological and molecular biological properties,including assessment of virulence genes and antibiotic resistance genes,mouse lethality tests,and antibiotic susceptibility evaluations.A predominant bacterial strain isolated from the liver of the deceased tiger was identified as enterotoxigenic Escherichia coli(ETEC)strain Tiger22513F.Phylogenetic analysis of the 16S rRNA gene revealed that the Tiger22513F strain exhibited close genetic similarity to the reference strain ETEC(MF919609.1),with 99.9%nucleotide similarity,and resided on the same evolutionary branch.The Tiger22513F strain contained 11 antibiotic resistance genes(tetA,sul1,sul3,cmlA,floR,blaTEM,blaSHV,blaCMY-2,qnrA,qnrS,and qnrD)along with five virulence genes(VT1,fyuA,tsh,iucD,and ST).Mouse lethality tests indicated significant pathogenicity toward mice,affecting primarily the lungs,liver,and intestines.Antibiotic susceptibility testing demonstrated that this strain exhibited resistance to various classes of beta-lactam antibiotics,as well as quinolones and aminoglycosides.This investigation successfully isolated a multi-drug resistant enterotoxigenic Escherichia coli strain with pronounced pathogenicity from the liver of a deceased tiger;thus providing valuable scientific insights for clinical diagnosis,as well as prevention and control measures,against ETEC infections in South China tigers.

Body weight abnormalities, including overweight, obesity, and underweight, have become a dual public health challenge in Chinese adults: overweight and obesity lead to a variety of chronic complications, while underweight increases the risks of malnutrition, sarcopenia, and organ dysfunction. To systematically address these issues, multidisciplinary experts in endocrinology, sports science, nutrition, and psychiatry from various regions have held multiple weight management seminars. Based on the latest epidemiological data and clinical evidence, they expanded the guideline to include assessment and intervention strategies for underweight, in addition to the core content of obesity management. This guideline outlines the etiological mechanisms, evaluation methods, and multidimensional management strategies for overweight and obesity, covering key areas such as diagnosis and assessment, medical nutrition therapy, exercise prescription, pharmacological intervention, and psychological support. It is intended to provide a scientific and standardized approach to weight management across the adult population, aiming to curb the rising prevalence of obesity, mitigate complications associated with abnormal body weight, and improve nutritional status and overall quality of life.

Medical institutions, with their clinical practice foundation and abundant human use experience data, have become important carriers for the inheritance and innovation of traditional Chinese medicine(TCM) and the "cradles" of the preparation of new TCM. To effectively promote the transformation of new TCM originating from the TCM clinical practice in medical institutions and establish an effective evaluation index system for the transformation of new TCM conforming to the characteristics of TCM, consensus experts adopted the literature research, questionnaire survey, Delphi method, etc. By focusing on the policy and technical evaluation of new TCM originating from the TCM clinical practice in medical institutions, a comprehensive evaluation from the dimensions of drug safety, efficacy, feasibility, and characteristic advantages was conducted, thus forming a comprehensive evaluation system with four primary indicators and 37 secondary indicators. The expert consensus reached aims to encourage medical institutions at all levels to continuously improve the high-quality research and development and transformation of new TCM originating from the TCM clinical practice in medical institutions and targeted at clinical needs, so as to provide a decision-making basis for the preparation, selection, cultivation, and transformation of new TCM for medical institutions, improve the development efficiency of new TCM, and precisely respond to the public medication needs.
Medicine, Chinese Traditional/standards* ; Humans ; Consensus ; Drugs, Chinese Herbal/therapeutic use* ; Surveys and Questionnaires

This study investigated the protective effect of arbutin(Arb) in yam on lipopolysaccharide(LPS)-induced acute lung injury(ALI) in a mouse model and revealed its possible mechanism of action by metabolomics technology, providing a theoretical basis for clinical treatment of ALI. SPF BALB/c mice were randomly divided into normal control group, model group, resveratrol(Rv)-positive control group, Arb low-dose(15 mg·kg~(-1)) group, and Arb high-dose(30 mg·kg~(-1)) group. The LPS-induced ALI model was established in all groups except the normal control group. Hematoxylin-eosin(HE) staining, TUNEL staining, and WBP whole-body non-invasive pulmonary function testing were used to evaluate the degree of lung tissue damage and lung function changes. Enzyme-linked immunosorbent assay(ELISA) was used to detect the level of inflammatory factors in lung tissue. Flow cytometry was used to analyze the M1/M2 polarization status of macrophages in lung tissue. Western blot was used to detect the expression levels of the TLR4 signaling pathway and related apoptotic proteins. Liquid chromatograph-mass spectrometer(LC-MS) metabolomics was used to analyze the changes in serum metabolic profile after Arb intervention. The results showed that Arb pretreatment significantly alleviated LPS-induced lung tissue injury, improved lung function, reduced the levels of pro-inflammatory factors(IL-6, TNF-α, IL-18, and IL-1β), and regulated the polarization status of M1/M2 macrophages. In addition, Arb inhibited the activation of the TLR4 signaling pathway, reduced the expression of pro-apoptotic proteins such as Bax, caspase-3, and caspase-9, up-regulated the level of Bcl-2 protein, and inhibited apoptosis of lung cells. Metabolomic analysis showed that Arb significantly improved LPS-induced metabolic abnormalities, mainly involving key pathways such as galactose metabolism, phenylalanine metabolism, and lipid metabolism. In summary, Arb can significantly reduce LPS-induced ALI by regulating the release of inflammatory factors, inhibiting the activation of the TLR4 signaling pathway, improving metabolic disorders, and regulating macrophage polarization, indicating that Arb has potential clinical application value.
Animals ; Acute Lung Injury/chemically induced* ; Mice ; Mice, Inbred BALB C ; Arbutin/administration & dosage* ; Male ; Toll-Like Receptor 4/immunology* ; Apoptosis/drug effects* ; Lung/metabolism* ; Signal Transduction/drug effects* ; Protective Agents/administration & dosage* ; Humans ; Macrophages/immunology* ; Drugs, Chinese Herbal/administration & dosage*

To investigate the impact of preoperative serum follicle-stimulating hormone (FSH) levels on the probability of testicular sperm retrieval, we conducted a study of nonobstructive azoospermic (NOA) men with different testicular volumes (TVs) who underwent microdissection testicular sperm extraction (micro-TESE). A total of 177 NOA patients undergoing micro-TESE for the first time from April 2019 to November 2022 in Shenzhen Zhongshan Obstetrics and Gynecology Hospital (formerly Shenzhen Zhongshan Urology Hospital, Shenzhen, China) were retrospectively reviewed. The subjects were divided into four groups based on average TV quartiles. Serum hormone levels in each TV group were compared between positive and negative sperm retrieval subgroups. Overall sperm retrieval rate was 57.6%. FSH levels (median [interquartile range]) were higher in the positive sperm retrieval subgroup compared with the negative outcome subgroup when average TV was <5 ml (first quartile [Q1: TV <3 ml]: 43.32 [17.92] IU l -1 vs 32.95 [18.56] IU l -1 , P = 0.048; second quartile [Q2: 3 ml ≤ TV <5 ml]: 31.31 [15.37] IU l -1 vs 25.59 [18.40] IU l -1 , P = 0.042). Elevated serum FSH levels were associated with successful micro-TESE sperm retrieval in NOA men whose average TVs were <5 ml (adjusted odds ratio [OR]: 1.06 per unit increase; 95% confidence interval [CI]: 1.01-1.11; P = 0.011). In men with TVs ≥5 ml, larger TVs were associated with lower odds of sperm retrieval (adjusted OR: 0.84 per 1 ml increase; 95% CI: 0.71-0.98; P = 0.029). In conclusion, elevated serum FSH levels were associated with positive sperm retrieval in micro-TESE in NOA men with TVs <5 ml. In men with TV ≥5 ml, increases in average TVs were associated with lower odds of sperm retrieval.
Humans ; Male ; Azoospermia/surgery* ; Sperm Retrieval/statistics & numerical data* ; Adult ; Follicle Stimulating Hormone/blood* ; Retrospective Studies ; Testis/pathology* ; Microdissection ; Organ Size

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test