This paper summarized the clinical experience in treating ischemic stroke with jiao （角） medicine （triple-medicinal combinations）. Clinically， the combination of Roucongrong （Cistanche deserticola）-Shanyurou （Cornus officinalis）-Guijia （Testudinis Carapax et Plastrum） is used to nourish the kidneys and liver for disease mechanism of liver-kidney depletion， and foundation deficiency due to insufficient essence and blood； the combination of Xixiancao （Sigesbeckia orientalis）-Tianma （Gastrodia elata）-Gouteng （Uncaria rhynchophylla） is used to extinguish wind and eliminate dampness for treating numbness and swelling of limbs caused by ischemic stroke； the combination of Shichangpu （Acorus Tatarinowii）-Yuanzhi （Polygala tenuifolia）-Yujin （Curcumae Radix） is used to improve intelligence， refresh the brain， and clear the mind for treating cognitive impairment， memory loss， or speech difficulties caused by ischemic stroke； the combination of Banxia （Pinellia ternata）-Baizhu （Atractylodes macrocephala）- Tianma （Gastrodiae rhizoma） is used to dissolve phlegm and extinguish wind， unblock meridians and relieve dizziness for treating dizziness or headache caused by ischemic stroke； the combination of Danggui （Angelica sinensis radix）- Chuanxiong （Ligusticum chuanxiong）-Guijianyu （Euonymus alatus） is used to nourish and activate blood circulation， remove blood stasis and unblock meridians for treating weak limbs and activiry difficulty caused by ischemic stroke； the combination of Chaihu （Bupleurum chinense）-Zhiziz （Gardenia jasminoides）-Guanye Jinsitao （Hypericum perforatum） is used to soothe the liver and resolve constraint， cool the blood and calm the mind for treating emotional complications.

The zebrafish model has attracted much attention due to its strong reproductive ability, short research cycle, and ease of maintenance. It has always been an important vertebrate model system, often used to carry out human disease research. Its motor behavior features have the advantages of being simpler, more intuitive, and quantifiable. In recent years, it has received widespread attention in the study of traditional Chinese medicine(TCM)for the treatment of sleep disorders, neurodegenerative diseases, fatigue, epilepsy, and other diseases. This paper reviews the characteristics of zebrafish motor behavior and its applications in the pharmacodynamic verification and mechanism research of TCM extracts, active ingredients, and TCM compounds, as well as in active ingredient screening and safety evaluation. The paper also analyzes its advantages and disadvantages, with the aim of improving the breadth and depth of zebrafish and its motor behavior applications in the field of TCM research.
Zebrafish/physiology* ; Medicine, Chinese Traditional ; Drugs, Chinese Herbal/therapeutic use* ; Disease Models, Animal ; Drug Evaluation, Preclinical/methods* ; Animals ; Sleep Wake Disorders/physiopathology* ; Epilepsy/physiopathology* ; Neurodegenerative Diseases/physiopathology* ; Fatigue/physiopathology* ; Behavior, Animal/physiology* ; Motor Activity/physiology*

To elucidate the mechanism by which steaming affects the quality of Curcuma kwangsiensis root tubers, methods such as LSCM, RVA, dual-wavelength spectrophotometry, LF-NMR, and LC-MS were employed to qualitatively and quantitatively detect changes in starch gelatinization characteristics, water distribution, and material composition of C. kwangsiensis root tubers under different steaming durations. Based on multivariate statistical analysis, the correlation between differences in gelatinization parameters, water distribution, and terpenoid material composition was investigated. The results indicate that steaming affects both starch gelatinization and water distribution in C. kwangsiensis. During the steaming process, transformations occur between amylose and amylopectin, as well as between semi-bound water and free water. After 60 min of steaming, starch gelatinization and water distribution reached an equilibrium state. The content of amylopectin, the amylose-to-amylopectin ratio, and parameters such as gelatinization temperature, viscosity, breakdown value, and setback value were significantly correlated(P≤0.05). Additionally, the amylose-to-amylopectin ratio was significantly correlated with total free water and total water content(P≤0.05). Steaming induced differences in the material composition of C. kwangsiensis root tubers. Clustering of primary metabolites in the OPLS-DA model was distinct, while secondary metabolites were classified into 9 clusters using the K-means clustering algorithm. Differential terpenoid metabolites such as(-)-α-curcumene were significantly correlated with zerumbone, retinal, and all-trans-retinoic acid(P<0.05). Curcumenol was significantly correlated with isoalantolactone and ursolic acid(P<0.05), while all-trans-retinoic acid was significantly correlated with both zerumbone and retinal(P<0.05). Alpha-tocotrienol exhibited a significant correlation with retinal and all-trans-retinoic acid(P<0.05). Amylose was extremely significantly correlated with(-)-α-curcumene, curcumenol, zerumbone, retinal, all-trans-retinoic acid, and α-tocotrienol(P<0.05). Amylopectin was significantly correlated with zerumbone(P<0.05) and extremely significantly correlated with(-)-α-curcumene, curcumenol, zerumbone, retinal, all-trans-retinoic acid, and 9-cis-retinoic acid(P<0.01). The results provide scientific evidence for elucidating the mechanism of quality formation of steamed C. kwangsiensis root tubers as a medicinal material.
Curcuma/chemistry* ; Starch/chemistry* ; Multivariate Analysis ; Water/chemistry* ; Terpenes/analysis* ; Plant Roots/chemistry* ; Plant Tubers/chemistry* ; Drugs, Chinese Herbal/chemistry*

This study systematically analyzed the global research landscape, technological composition, and core patents in the field of networks target and network pharmacology, and proposes further suggestions based on the IncoPat patent citation database and VOSviewer bibliometric network visualization tool. Using patent literature metrics and scientific knowledge mapping method, technological innovation pathways, research hotspots, and future directions in this field were further revealed. In particular, this field is moving towards data-driven, intelligent, and systematic approaches. Patent analysis indicated that most patent applications in this domain focused on traditional Chinese medicine(TCM), which have provided key engineering technical approaches to explore and solve complex problems of TCM. By integrating big data and artificial intelligence technologies, network targets and network pharmacology have conferred high-precision screening and quality control of key components and targets in herbal formulations and prescriptions, accelerating the clinical translation and industrialization of TCM-based new drugs and health products with medicine-food homology. Therefore, it is essential to optimize the patent protection system and establish integrated technology platforms in this field for ensuring the competitiveness of technological achievements in research and clinical application. These efforts will advance the widespread application and high-quality development of TCM modernization, precision medicine, and innovative drug discovery.
Bibliometrics ; Patents as Topic ; Humans ; Medicine, Chinese Traditional ; Network Pharmacology/trends* ; Drugs, Chinese Herbal/pharmacology*

To investigate the effects of phosphorus fertilizer on the morphological traits, active ingredients and rhizosphere soil microbial community of Polygala tenuifolia. The phosphorus fertilizer was calculated in terms of P_2O_5. Five treatments were set up: 0(CK), 17(P1), 34(P2), 51(P3), and 68(P4) kg per Mu(1 Mu≈667 m~2). A randomized block design was adopted. Samples of P. tenuifolia and its rhizosphere soil were collected under different superphosphate fertilizer treatments. Illumina high-throughput sequencing was used to analyze the rhizosphere soil microbial community, 9 morphological traits were measured and the content of 11 active ingredients were determined. The results showed that the whole plant weight, shoot fresh weight, root weight, and root peel thickness were the highest under P1 treatment, increasing by 34.41%, 38.80%, 39.21%, and 3.17% respectively compared to CK. Under P2 treatment, the plant height, stem diameter, root thickness, and core thickness were significantly higher than CK. Phosphorus fertilizer had a significant impact on the content of tenuifolin, sibiricose A5, sibiricose A6, arillanin A, 3,6'-disinapoyl sucrose, and polygalaxanthone Ⅲ. Correlation analysis results showed that the relative abundance of Arthrobacter, Bacillus, norank＿f＿Vicinamibacteraceae, norank＿o＿Vicinamibacterales, MND1 and other bacteria, as well as the relative abundance of Neocosmospora, Paraphoma and other fungi were positively correlated with root diameter, wood core diameter, the whole plant weight, root weight, shoot fresh weight of P. tenuifolia. Bacillus, Neocosmospora, Subulicystidium were significantly positively correlated with oligosaccharides such as 3,6'-disinapoyl sucrose, sibiricose A5、sibiricose A6、glomeratose A、arillanin A and tenuifoliside C. Arthrobacter, Humicola, Aspergillus, Paraphoma were positively correlated with tenuifolin and norank＿f＿Vicinamibacteraceae, norank＿o＿Vicinamibacterales, Fusarium were positively correlated with polygalaxanthone Ⅲ. Evidently, appropriate phosphorus application is conducive to the growth and quality improvement of P. tenuifolia, and can increase the abundance of beneficial microorganisms in the soil.
Rhizosphere ; Phosphorus/pharmacology* ; Soil Microbiology ; Polygala/anatomy & histology* ; Fertilizers/analysis* ; Bacteria/metabolism* ; Soil/chemistry* ; Microbiota/drug effects* ; Plant Roots/metabolism*

This study investigated the therapeutic effects and mechanisms of Modified Yiyi Fuzi Baijiang Powder on ulcerative colitis(UC) in rats from the perspective of dampness. SD rats were randomly allocated into six groups(n=10): control, model, mesalazine, and Modified Yiyi Fuzi Baijiang Powder at low(3.96 g·kg~(-1)·d~(-1)), medium(7.92 g·kg~(-1)·d~(-1)), and high(15.84 g·kg~(-1)·d~(-1)) doses. UC was induced in all groups except the control by administration with 3% dextran sulfate sodium(DSS) solution for 7 days. The disease activity index(DAI) was recorded, and the colon tissue was collected for analysis. Histopathological changes were assessed by hematoxylin-eosin staining. Serum levels of D-lactic acid(D-LA) and diamine oxidase(DAO) were measured by ELISA. Immunohistochemistry and PCR were employed to evaluate the expression of aquaporins(AQP3, AQP4) and tight junction proteins [zonula occludens-1(ZO-1) and occludin] at both protein and mRNA levels. Compared with the control group, the model group showed an increased DAI scores(P<0.05), intestinal mucosal damage, elevated serum levels of DAO and D-LA(P<0.05), and decreased expression of AQP3, AQP4, ZO-1, and occludin(P<0.05). Treatment with Modified Yiyi Fuzi Baijiang Powder reduced the DAI scores(P<0.05), lowered the serum levels of D-LA and DAO(P<0.05), and upregulated the expression of AQP3, AQP4, ZO-1, and occludin at both protein and mRNA levels compared with the model group. These findings suggest that Modified Yiyi Fuzi Baijiang Powder exerts therapeutic effects on UC by reducing the intestinal mucosal permeability, promoting colonic mucosal repair, and regulating abnormal intestinal water metabolism, which may involve the upregulation of AQP3 and AQP4 expression.
Animals ; Colitis, Ulcerative/genetics* ; Drugs, Chinese Herbal/administration & dosage* ; Rats, Sprague-Dawley ; Rats ; Intestinal Mucosa/metabolism* ; Male ; Aquaporin 3/metabolism* ; Aquaporin 4/metabolism* ; Permeability/drug effects* ; Humans ; Powders ; Intestinal Barrier Function

A single-center, randomized, double-blind, dose-controlled trial of modified Sini Powder in treating mild to moderate generalized anxiety disorder(GAD) in the patients with syndrome of liver depression transforming into fire was conducted at Xiyuan Hospital, China Academy of Chinese Medical Sciences. A total of 80 patients with mild to moderate GAD and the syndrome of liver depression transforming into fire were included. Patients were assigned by the central randomization system at a ratio of 3∶1 into an observation group(n=60, receiving a conventional-dose of granules of modified Sini Powder) and a control group(n=20, receiving low-dose granules with the active ingredients being 50% of that in observation group). Assessments were conducted before treatment(baseline), after 2 weeks of introduction, after 2/4/8 weeks of treatment, and after 4 weeks of follow-up. The results were summarized as follows. In terms of primary outcome indicators, the observation group(62.2%) showed higher total response rate than the control group(26.6%)(P<0.05), and greater Hamilton anxiety scale(HAMA) score reduction after 8 weeks of treatment(P<0.05). In terms of secondary outcome indicators, the HAMA score(somatic anxiety score), traditional Chinese medicine(TCM) syndrome scores, Pittsburgh sleep quality index(PSQI) scale, and clinical global impression(CGI) scale score in the observation group showed a significant compared to the control group at each visit points(P<0.05). Adverse events occurred in 10 cases, including 9(16.9%) cases in the observation group and 1(6.6%) case in the control group. No adverse reaction was observed. In conclusion, conventional-dose modified Sini Powder demonstrated superior efficacy and favorable safety for mild and moderate GAD in the patients with the syndrome of liver depression transforming into fire over low-dose treatment.
Humans ; Male ; Female ; Adult ; Middle Aged ; Double-Blind Method ; Drugs, Chinese Herbal/administration & dosage* ; Anxiety Disorders/drug therapy* ; Treatment Outcome ; Young Adult ; Powders ; Aged ; Liver/drug effects* ; Generalized Anxiety Disorder

PURPOSE: We carried out the study aiming to explore and analyze the risk factors, the distribution of pathogenic bacteria, and their antibiotic-resistance characteristics influencing the occurrence of surgical site infection (SSI), to provide valuable assistance for reducing the incidence of SSI after traumatic fracture surgery. METHODS: A retrospective case-control study enrolling 3978 participants from January 2015 to December 2019 receiving surgical treatment for traumatic fractures was conducted at Tangdu Hospital of Air Force Medical University. Baseline data, demographic characteristics, lifestyles, variables related to surgical treatment, and pathogen culture were harvested and analyzed. Univariate analyses and multivariate logistic regression analyses were used to reveal the independent risk factors of SSI. A bacterial distribution histogram and drug-sensitive heat map were drawn to describe the pathogenic characteristics. RESULTS: Included 3978 patients 138 of them developed SSI with an incidence rate of 3.47% postoperatively. By logistic regression analysis, we found that variables such as gender (males) (odds ratio (OR) = 2.012, 95% confidence interval (CI): 1.235 - 3.278, p = 0.005), diabetes mellitus (OR = 5.848, 95% CI: 3.513 - 9.736, p < 0.001), hypoproteinemia (OR = 3.400, 95% CI: 1.280 - 9.031, p = 0.014), underlying disease (OR = 5.398, 95% CI: 2.343 - 12.438, p < 0.001), hormonotherapy (OR = 11.718, 95% CI: 6.269 - 21.903, p < 0.001), open fracture (OR = 29.377, 95% CI: 9.944 - 86.784, p < 0.001), and intraoperative transfusion (OR = 2.664, 95% CI: 1.572 - 4.515, p < 0.001) were independent risk factors for SSI, while, aged over 59 years (OR = 0.132, 95% CI: 0.059 - 0.296, p < 0.001), prophylactic antibiotics use (OR = 0.082, 95% CI: 0.042 - 0.164, p < 0.001) and vacuum sealing drainage use (OR = 0.036, 95% CI: 0.010 - 0.129, p < 0.001) were protective factors. Pathogens results showed that 301 strains of 38 species of bacteria were harvested, among which 178 (59.1%) strains were Gram-positive bacteria, and 123 (40.9%) strains were Gram-negative bacteria. Staphylococcus aureus (108, 60.7%) and Enterobacter cloacae (38, 30.9%) accounted for the largest proportion. The susceptibility of Gram-positive bacteria to Vancomycin and Linezolid was almost 100%. The susceptibility of Gram-negative bacteria to Imipenem, Amikacin, and Meropenem exceeded 73%. CONCLUSION Orthopedic surgeons need to develop appropriate surgical plans based on the risk factors and protective factors associated with postoperative SSI to reduce its occurrence. Meanwhile, it is recommended to strengthen blood glucose control in the early stage of admission and for surgeons to be cautious and scientific when choosing antibiotic therapy in clinical practice.
Humans ; Surgical Wound Infection/epidemiology* ; Male ; Female ; Risk Factors ; Retrospective Studies ; Middle Aged ; Adult ; Case-Control Studies ; Fractures, Bone/surgery* ; Aged ; Drug Resistance, Bacterial ; Logistic Models ; Anti-Bacterial Agents/therapeutic use* ; Incidence ; Bacteria/drug effects*

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

A 7-year-old girl was admitted to the hospital with rapidly progressive vision loss. Since 1 year of age, she had exhibited developmental delay accompanied by visual impairment and neutropenia. Combined with genetic testing and molecular pathogenicity analysis, she was diagnosed with Cohen syndrome (CS) caused by compound heterozygous variants in VPS13B (c.6940+1G>T and c.2911C>T). The c.6940+1G>T variant resulted in exon 38 skipping, leading to a frameshift and premature termination. Reverse transcription quantitative polymerase chain reaction revealed significantly reduced VPS13B gene expression (P<0.05). Bioinformatic analysis suggested that both variants likely produce truncated proteins. This case highlights that integrating clinical features with molecular pathogenicity assessment (DNA, RNA, and protein analysis) can improve early diagnostic accuracy for CS.
Humans ; Female ; Child ; Vesicular Transport Proteins/genetics* ; Developmental Disabilities/etiology* ; Muscle Hypotonia/etiology* ; Myopia/etiology* ; Heterozygote ; Intellectual Disability/etiology* ; Microcephaly/etiology* ; Obesity/genetics* ; Growth Disorders/etiology* ; Retinal Degeneration/genetics* ; Psychomotor Disorders/genetics* ; Fingers/abnormalities*