The zebrafish model has attracted much attention due to its strong reproductive ability, short research cycle, and ease of maintenance. It has always been an important vertebrate model system, often used to carry out human disease research. Its motor behavior features have the advantages of being simpler, more intuitive, and quantifiable. In recent years, it has received widespread attention in the study of traditional Chinese medicine(TCM)for the treatment of sleep disorders, neurodegenerative diseases, fatigue, epilepsy, and other diseases. This paper reviews the characteristics of zebrafish motor behavior and its applications in the pharmacodynamic verification and mechanism research of TCM extracts, active ingredients, and TCM compounds, as well as in active ingredient screening and safety evaluation. The paper also analyzes its advantages and disadvantages, with the aim of improving the breadth and depth of zebrafish and its motor behavior applications in the field of TCM research.
Zebrafish/physiology* ; Medicine, Chinese Traditional ; Drugs, Chinese Herbal/therapeutic use* ; Disease Models, Animal ; Drug Evaluation, Preclinical/methods* ; Animals ; Sleep Wake Disorders/physiopathology* ; Epilepsy/physiopathology* ; Neurodegenerative Diseases/physiopathology* ; Fatigue/physiopathology* ; Behavior, Animal/physiology* ; Motor Activity/physiology*

To elucidate the mechanism by which steaming affects the quality of Curcuma kwangsiensis root tubers, methods such as LSCM, RVA, dual-wavelength spectrophotometry, LF-NMR, and LC-MS were employed to qualitatively and quantitatively detect changes in starch gelatinization characteristics, water distribution, and material composition of C. kwangsiensis root tubers under different steaming durations. Based on multivariate statistical analysis, the correlation between differences in gelatinization parameters, water distribution, and terpenoid material composition was investigated. The results indicate that steaming affects both starch gelatinization and water distribution in C. kwangsiensis. During the steaming process, transformations occur between amylose and amylopectin, as well as between semi-bound water and free water. After 60 min of steaming, starch gelatinization and water distribution reached an equilibrium state. The content of amylopectin, the amylose-to-amylopectin ratio, and parameters such as gelatinization temperature, viscosity, breakdown value, and setback value were significantly correlated(P≤0.05). Additionally, the amylose-to-amylopectin ratio was significantly correlated with total free water and total water content(P≤0.05). Steaming induced differences in the material composition of C. kwangsiensis root tubers. Clustering of primary metabolites in the OPLS-DA model was distinct, while secondary metabolites were classified into 9 clusters using the K-means clustering algorithm. Differential terpenoid metabolites such as(-)-α-curcumene were significantly correlated with zerumbone, retinal, and all-trans-retinoic acid(P<0.05). Curcumenol was significantly correlated with isoalantolactone and ursolic acid(P<0.05), while all-trans-retinoic acid was significantly correlated with both zerumbone and retinal(P<0.05). Alpha-tocotrienol exhibited a significant correlation with retinal and all-trans-retinoic acid(P<0.05). Amylose was extremely significantly correlated with(-)-α-curcumene, curcumenol, zerumbone, retinal, all-trans-retinoic acid, and α-tocotrienol(P<0.05). Amylopectin was significantly correlated with zerumbone(P<0.05) and extremely significantly correlated with(-)-α-curcumene, curcumenol, zerumbone, retinal, all-trans-retinoic acid, and 9-cis-retinoic acid(P<0.01). The results provide scientific evidence for elucidating the mechanism of quality formation of steamed C. kwangsiensis root tubers as a medicinal material.
Curcuma/chemistry* ; Starch/chemistry* ; Multivariate Analysis ; Water/chemistry* ; Terpenes/analysis* ; Plant Roots/chemistry* ; Plant Tubers/chemistry* ; Drugs, Chinese Herbal/chemistry*

Kidney-Yang deficiency syndrome is a common geriatric disease that underlies chronic conditions such as diabetic nephropathy, chronic kidney disease, and osteoporosis. As age progresses, the kidney-Yang deficiency syndrome showcases increasingly pronounced manifestations, emerging as a key factor in the comorbidities experienced by elderly patients and affecting their quality of life and overall health status. Traditional Chinese medicine(TCM) has been extensively utilized in the treatment of kidney-Yang deficiency syndrome, with Epimedii Folium, Cinnamomi Cortex, and Lycii Fructus widely used in clinical settings. Despite the complexity of the molecular mechanisms involved in treating kidney-Yang deficiency syndrome, the potential therapeutic value of TCM remains compelling. Delving into the mechanisms of TCM treatment of kidney-Yang deficiency syndrome by regulating the neuro-endocrine-immune system can provide a scientific basis for targeted treatments of this syndrome and lay a foundation for the modernization of TCM. The pathophysiology of kidney-Yang deficiency syndrome involves multiple systems, including the interaction of the neuro-endocrine-immune system, the decline in renal function, the intensification of oxidative stress responses, and energy metabolism disorders. Understanding these mechanisms and their interrelationships can help untangle the etiology of kidney-Yang deficiency syndrome, aiding clinicians in making more precise diagnoses and treatments. Furthermore, the research on the specific applications of TCM in research on these pathological mechanisms can enhance the international recognition and status of TCM, enabling it to exert a greater global influence.
Humans ; Yang Deficiency/physiopathology* ; Drugs, Chinese Herbal/therapeutic use* ; Medicine, Chinese Traditional ; Kidney Diseases/physiopathology* ; Neurosecretory Systems/physiopathology* ; Animals ; Kidney/physiopathology* ; Endocrine System/physiopathology* ; Immune System/physiopathology*

OBJECTIVE: To compare the short-term clinical efficacy and safety of closed reduction with Kirschner wire fixation versus open reduction with plate fixation for treating osteoporotic Colles' fractures in middle-aged and elderly patients. METHODS: Between January 2018 and January 2023, 119 patients with Colles fractures were retrospectively analyzed, including 39 males and 80 females, aged from 48 to 74 years old with an average of(60.58±6.71) years old. The time from injury to operation ranged 1 to 13 days with an average of (5.29±2.52) days. According to the surgical method, they were divided into Kirschner wire fixation group (Kirschner wire group) and plate internal fixation group (plate group). In Kirschner wire group, there were a total of 68 patients, comprising 21 males and 47 females. The average age was (61.15±6.24) years old, ranged from 49 to 74 years old. Among them, 41 cases involved the left side while 27 cases involved the right side. In the plate group, there were a total of 51 patients, including 18 males and 33 females. The average age was (59.78±5.71) years old ranged from 48 to 72 years old. Among them, there were 31 cases on the left side and 20 cases on the right side. The following parameters were recorded before and after the operation:operation time, intraoperative blood loss, hospitalization days, hospitalization expenses, postoperative complications, and radiographic parameters of distal radius (distal radius height, ulnar deviation angle, palmar tilt angle). The clinical efficacy was evaluated at 3 and 12 months after the operation using Gartland-Werley and disabilites of the arm shoulder and hand (DASH) scores. RESULTS: The patients in both groups were followed up for a duration from 12 to 19 months with an average of(13.32±2.02) months. The Kirschner wire group exhibited significantly shorter operation time compared to the plate group 27.91(13.00, 42.00) min vs 67.52(29.72, 105.32) min, Z=-8.74, P=0.00. Intraoperative blood loss was also significantly lower in the Kirschner wire group than in the plate group 3.24(1.08, 5.40) ml vs 21.91(17.38, 26.44) ml, Z=-9.31, P=0.00. Furthermore, patients in the Kirschner wire group had a shorter length of hospital stay compared to those in the plate group (8.38±2.63) days vs (11.40±2.78) days, t=-3.12, P=0.00. Additionally, hospitalization cost was significantly lower in the Kirschner wire group than in the plate group 10 111.29(6 738.98, 13 483.60) yuan vs 15 871.11(11 690.40, 20 051.82) yuan, Z=-5.62, P=0.00. The incidence of complications was 2 cases in the Kirschner wire group and 1 case in the plate group, with no statistically significant difference(P>0.05). At 3 months postoprative, the radial height of the Kirschner wire group was found to be significantly smaller than that of the plate group, with measurements of (11.45±1.69) mm and (12.11±1.78) mm respectively (t=-2.06, P=0.04). However, there were no statistically significant differences observed in ulnar deviation angle and palmar tilt angle between the two groups (P>0.05). The DASH score and Gartland-Werley score in the Kirschner group were significantly higher than those in the plate group at 3 months post-operation (19.10±9.89) vs (13.47±3.51), t=4.34, P=0.00;(11.15±3.61) vs (6.41±2.75), t=8.13, P=0.00). However, there was no significant difference between the two groups at 12 months post-operation (P>0.05). CONCLUSION Compared to plate internal fixation, closed reduction with Kirschner wire support fixation yields a slightly inferior recovery of radial height;however, there is no significant disparity in the functional score of the affected limb at 12 months post-operation. Nonetheless, this technique offers advantages such as shorter operation time, reduced intraoperative blood loss, decreased hospitalization duration, and lower cost.
Humans ; Female ; Male ; Middle Aged ; Aged ; Fracture Fixation, Internal/instrumentation* ; Bone Wires ; Bone Plates ; Retrospective Studies ; Colles' Fracture/surgery* ; Minimally Invasive Surgical Procedures/methods* ; Open Fracture Reduction/methods* ; Osteoporotic Fractures/surgery*

PURPOSE: We carried out the study aiming to explore and analyze the risk factors, the distribution of pathogenic bacteria, and their antibiotic-resistance characteristics influencing the occurrence of surgical site infection (SSI), to provide valuable assistance for reducing the incidence of SSI after traumatic fracture surgery. METHODS: A retrospective case-control study enrolling 3978 participants from January 2015 to December 2019 receiving surgical treatment for traumatic fractures was conducted at Tangdu Hospital of Air Force Medical University. Baseline data, demographic characteristics, lifestyles, variables related to surgical treatment, and pathogen culture were harvested and analyzed. Univariate analyses and multivariate logistic regression analyses were used to reveal the independent risk factors of SSI. A bacterial distribution histogram and drug-sensitive heat map were drawn to describe the pathogenic characteristics. RESULTS: Included 3978 patients 138 of them developed SSI with an incidence rate of 3.47% postoperatively. By logistic regression analysis, we found that variables such as gender (males) (odds ratio (OR) = 2.012, 95% confidence interval (CI): 1.235 - 3.278, p = 0.005), diabetes mellitus (OR = 5.848, 95% CI: 3.513 - 9.736, p < 0.001), hypoproteinemia (OR = 3.400, 95% CI: 1.280 - 9.031, p = 0.014), underlying disease (OR = 5.398, 95% CI: 2.343 - 12.438, p < 0.001), hormonotherapy (OR = 11.718, 95% CI: 6.269 - 21.903, p < 0.001), open fracture (OR = 29.377, 95% CI: 9.944 - 86.784, p < 0.001), and intraoperative transfusion (OR = 2.664, 95% CI: 1.572 - 4.515, p < 0.001) were independent risk factors for SSI, while, aged over 59 years (OR = 0.132, 95% CI: 0.059 - 0.296, p < 0.001), prophylactic antibiotics use (OR = 0.082, 95% CI: 0.042 - 0.164, p < 0.001) and vacuum sealing drainage use (OR = 0.036, 95% CI: 0.010 - 0.129, p < 0.001) were protective factors. Pathogens results showed that 301 strains of 38 species of bacteria were harvested, among which 178 (59.1%) strains were Gram-positive bacteria, and 123 (40.9%) strains were Gram-negative bacteria. Staphylococcus aureus (108, 60.7%) and Enterobacter cloacae (38, 30.9%) accounted for the largest proportion. The susceptibility of Gram-positive bacteria to Vancomycin and Linezolid was almost 100%. The susceptibility of Gram-negative bacteria to Imipenem, Amikacin, and Meropenem exceeded 73%. CONCLUSION Orthopedic surgeons need to develop appropriate surgical plans based on the risk factors and protective factors associated with postoperative SSI to reduce its occurrence. Meanwhile, it is recommended to strengthen blood glucose control in the early stage of admission and for surgeons to be cautious and scientific when choosing antibiotic therapy in clinical practice.
Humans ; Surgical Wound Infection/epidemiology* ; Male ; Female ; Risk Factors ; Retrospective Studies ; Middle Aged ; Adult ; Case-Control Studies ; Fractures, Bone/surgery* ; Aged ; Drug Resistance, Bacterial ; Logistic Models ; Anti-Bacterial Agents/therapeutic use* ; Incidence ; Bacteria/drug effects*

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

BACKGROUND: Biomarkers-based prediction of long-term risk of acute coronary syndrome (ACS) is scarce. We aim to develop a risk score integrating clinical routine information (C) and plasma biomarkers (B) for predicting long-term risk of ACS patients. METHODS: We included 2729 ACS patients from the OCEA (Observation of cardiovascular events in ACS patients). The earlier admitted 1910 patients were enrolled as development cohort; and the subsequently admitted 819 subjects were treated as validation cohort. We investigated 10-year risk of cardiovascular (CV) death, myocardial infarction (MI) and all cause death in these patients. Potential variables contributing to risk of clinical events were assessed using Cox regression models and a score was derived using main part of these variables. RESULTS: During 16,110 person-years of follow-up, there were 238 CV death/MI in the development cohort. The 7 most important predictors including in the final model were NT-proBNP, D-dimer, GDF-15, peripheral artery disease (PAD), Fibrinogen, ST-segment elevated MI (STEMI), left ventricular ejection fraction (LVEF), termed as CB-ACS score. C-index of the score for predication of cardiovascular events was 0.79 (95% CI: 0.76-0.82) in development cohort and 0.77 (95% CI: 0.76-0.78) in the validation cohort (5832 person-years of follow-up), which outperformed GRACE 2.0 and ABC-ACS risk score. The CB-ACS score was also well calibrated in development and validation cohort (Greenwood-Nam-D'Agostino: P = 0.70 and P = 0.07, respectively). CONCLUSIONS CB-ACS risk score provides a useful tool for long-term prediction of CV events in patients with ACS. This model outperforms GRACE 2.0 and ABC-ACS ischemic risk score.

OBJECTIVE: To evaluate the dynamic changes of glucocorticoid (GC) dose and the feasibility of GC discontinuation in rheumatoid arthritis (RA) patients under the background of Chinese medicine (CM). METHODS: This multicenter retrospective cohort study included 1,196 RA patients enrolled in the China Rheumatoid Arthritis Registry of Patients with Chinese Medicine (CERTAIN) from September 1, 2019 to December 4, 2023, who initiated GC therapy. Participants were divided into the Western medicine (WM) and integrative medicine (IM, combination of CM and WM) groups based on medication regimen. Follow-up was performed at least every 3 months to assess dynamic changes in GC dose. Changes in GC dose were analyzed by generalized estimator equation, the probability of GC discontinuation was assessed using Kaplan-Meier curve, and predictors of GC discontinuation were analyzed by Cox regression. Patients with <12 months of follow-up were excluded for the sensitivity analysis. RESULTS: Among 1,196 patients (85.4% female; median age 56.4 years), 880 (73.6%) received IM. Over a median 12-month follow-up, 34.3% (410 cases) discontinued GC, with significantly higher rates in the IM group (40.8% vs. 16.1% in WM; P<0.05). GC dose declined progressively, with IM patients demonstrating faster reductions (median 3.75 mg vs. 5.00 mg in WM at 12 months; P<0.05). Multivariate Cox analysis identified age <60 years [P<0.001, hazard ratios (HR)=2.142, 95% confidence interval (CI): 1.523-3.012], IM therapy (P=0.001, HR=2.175, 95% CI: 1.369-3.456), baseline GC dose ⩽7.5 mg (P=0.003, HR=1.637, 95% CI: 1.177-2.275), and absence of non-steroidal anti-inflammatory drugs use (P=0.001, HR=2.546, 95% CI: 1.432-4.527) as significant predictors of GC discontinuation. Sensitivity analysis (545 cases) confirmed these findings. CONCLUSIONS RA patients receiving CM face difficulties in following guideline-recommended GC discontinuation protocols. IM can promote GC discontinuation and is a promising strategy to reduce GC dependency in RA management. (Trial registration: ClinicalTrials.gov, No. NCT05219214).
Adult ; Aged ; Female ; Humans ; Male ; Middle Aged ; Arthritis, Rheumatoid/drug therapy* ; Glucocorticoids/therapeutic use* ; Medicine, Chinese Traditional ; Retrospective Studies

Mycophenolic acid (MPA), the active moiety of both mycophenolate mofetil (MMF) and enteric-coated mycophenolate sodium (EC-MPS), serves as a primary immunosuppressant for maintaining solid organ transplants. Therapeutic drug monitoring (TDM) enhances treatment outcomes through tailored approaches. This study aimed to develop an evidence-based guideline for MPA TDM, facilitating its rational application in clinical settings. The guideline plan was drawn from the Institute of Medicine and World Health Organization (WHO) guidelines. Using the Delphi method, clinical questions and outcome indicators were generated. Systematic reviews, Grading of Recommendations Assessment, Development, and Evaluation (GRADE) evidence quality evaluations, expert opinions, and patient values guided evidence-based suggestions for the guideline. External reviews further refined the recommendations. The guideline for the TDM of MPA (IPGRP-2020CN099) consists of four sections and 16 recommendations encompassing target populations, monitoring strategies, dosage regimens, and influencing factors. High-risk populations, timing of TDM, area under the curve (AUC) versus trough concentration (C₀), target concentration ranges, monitoring frequency, and analytical methods are addressed. Formulation-specific recommendations, initial dosage regimens, populations with unique considerations, pharmacokinetic-informed dosing, body weight factors, pharmacogenetics, and drug‍-‍drug interactions are covered. The evidence-based guideline offers a comprehensive recommendation for solid organ transplant recipients undergoing MPA therapy, promoting standardization of MPA TDM, and enhancing treatment efficacy and safety.
Mycophenolic Acid/administration & dosage* ; Drug Monitoring/methods* ; Humans ; Organ Transplantation ; Immunosuppressive Agents/administration & dosage* ; Delphi Technique