1.An assessment model for efficacy of autologous CD19 chimeric antigen receptor T-cell therapy and relapse or refractory diffuse large B-cell lymphoma risk.
Bin XUE ; Yifan LIU ; Min ZHANG ; Gangfeng XIAO ; Xiu LUO ; Lili ZHOU ; Shiguang YE ; Yan LU ; Wenbin QIAN ; Li WANG ; Ping LI ; Aibin LIANG
Chinese Medical Journal 2025;138(1):108-110
2.Development goals and strategies of ecological agriculture of Chinese materia medica.
Chuan-Zhi KANG ; Si-Qi LIU ; Bang-Xing HAN ; Tao ZHOU ; Xiao WANG ; Da-Hui LIU ; Ye YANG ; Lan-Ping GUO
China Journal of Chinese Materia Medica 2025;50(1):42-47
This paper aims to contribute to guaranteeing the stable development and enhancing the understanding of ecological agriculture of Chinese materia medica so that the national strategy and industrial demand can be better served. It first introduces current traditional Chinese medicine(TCM)policy and industrial development status from five aspects, including policy guarantee, theoretical support, technological innovation, standardization system, and brand influence. Then, the paper analyzes the development dilemma of TCM agriculture in production and quality increase and ecological environment protection. It also proposes the development goals of ecological agriculture of Chinese materia medica that meet the current industrial development demand, which are reducing chemical fertilizers, pesticides, and carbon emissions, improving quality, increasing efficiency, and protecting ecological environment. In addition, the new development goals are interpreted through case studies. Finally, this paper proposes four development strategies for ecological agriculture of Chinese materia medica: conducting research on the pattern and spatial and temporal variations of nationwide TCM production areas; studying the internal and external ecological memories of medicinal plant growth from the perspectives of genetic variations and environmental adaptation variations and elucidating their contributions to the formation of quality; carrying out selection and breeding of stress-resistant varieties for ecological agriculture of Chinese materia medica, the optimization of key technologies for soil improvement and restoration and green prevention and control against diseases and pests, and the improvement of quality; carrying out research on the quality assurance and value realization of ecological products made from TCM. This research can provide guidance for policy formulation, theoretical development of the discipline, and the enhancement of industrial technology for ecological agriculture of Chinese materia medica.
Agriculture/methods*
;
China
;
Drugs, Chinese Herbal
;
Plants, Medicinal/chemistry*
;
Ecosystem
;
Materia Medica
;
Medicine, Chinese Traditional
3.Expert consensus on evaluation index system construction for new traditional Chinese medicine(TCM) from TCM clinical practice in medical institutions.
Li LIU ; Lei ZHANG ; Wei-An YUAN ; Zhong-Qi YANG ; Jun-Hua ZHANG ; Bao-He WANG ; Si-Yuan HU ; Zu-Guang YE ; Ling HAN ; Yue-Hua ZHOU ; Zi-Feng YANG ; Rui GAO ; Ming YANG ; Ting WANG ; Jie-Lai XIA ; Shi-Shan YU ; Xiao-Hui FAN ; Hua HUA ; Jia HE ; Yin LU ; Zhong WANG ; Jin-Hui DOU ; Geng LI ; Yu DONG ; Hao YU ; Li-Ping QU ; Jian-Yuan TANG
China Journal of Chinese Materia Medica 2025;50(12):3474-3482
Medical institutions, with their clinical practice foundation and abundant human use experience data, have become important carriers for the inheritance and innovation of traditional Chinese medicine(TCM) and the "cradles" of the preparation of new TCM. To effectively promote the transformation of new TCM originating from the TCM clinical practice in medical institutions and establish an effective evaluation index system for the transformation of new TCM conforming to the characteristics of TCM, consensus experts adopted the literature research, questionnaire survey, Delphi method, etc. By focusing on the policy and technical evaluation of new TCM originating from the TCM clinical practice in medical institutions, a comprehensive evaluation from the dimensions of drug safety, efficacy, feasibility, and characteristic advantages was conducted, thus forming a comprehensive evaluation system with four primary indicators and 37 secondary indicators. The expert consensus reached aims to encourage medical institutions at all levels to continuously improve the high-quality research and development and transformation of new TCM originating from the TCM clinical practice in medical institutions and targeted at clinical needs, so as to provide a decision-making basis for the preparation, selection, cultivation, and transformation of new TCM for medical institutions, improve the development efficiency of new TCM, and precisely respond to the public medication needs.
Medicine, Chinese Traditional/standards*
;
Humans
;
Consensus
;
Drugs, Chinese Herbal/therapeutic use*
;
Surveys and Questionnaires
4.Clinical characteristics and genetic analysis of maturity-onset diabetes of the young type 2 diagnosed in childhood.
Juan YE ; Feng YE ; Ling HOU ; Wei WU ; Xiao-Ping LUO ; Yan LIANG
Chinese Journal of Contemporary Pediatrics 2025;27(1):94-100
OBJECTIVES:
To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice.
METHODS:
A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023.
RESULTS:
All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported.
CONCLUSIONS
This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans
;
Diabetes Mellitus, Type 2/diagnosis*
;
Male
;
Female
;
Child
;
Retrospective Studies
;
Glucokinase/genetics*
;
Adolescent
;
Child, Preschool
;
Glucose Tolerance Test
5.Diagnosis of coronary artery lesions in children based on Z-score regression model.
Yong WANG ; Jia-Ying JIANG ; Yan DENG ; Bo LI ; Ping SHUAI ; Xiao-Ping HU ; Yin-Yan ZHANG ; Han WU ; Lu-Wei YE ; Qian PENG
Chinese Journal of Contemporary Pediatrics 2025;27(2):176-183
OBJECTIVES:
To construct a Z-score regression model for coronary artery diameter based on echocardiographic data from children in Sichuan Province and to establish a Z-score calculation formula.
METHODS:
A total of 744 healthy children who underwent physical examinations at Sichuan Provincial People's Hospital from January 2020 to December 2022 were selected as the modeling group, while 251 children diagnosed with Kawasaki disease at the same hospital from January 2018 to December 2022 were selected as the validation group. Pearson correlation analysis was conducted to analyze the relationships between coronary artery diameter values and age, height, weight, and body surface area. A regression model was constructed using function transformation to identify the optimal regression model and establish the Z-score calculation formula, which was then validated.
RESULTS:
The Pearson correlation analysis showed that the correlation coefficients for the diameters of the left main coronary artery, left anterior descending artery, left circumflex artery, and right coronary artery with body surface area were 0.815, 0.793, 0.704, and 0.802, respectively (P<0.05). Among the constructed regression models, the power function regression model demonstrated the best performance and was therefore chosen as the optimal model for establishing the Z-score calculation formula. Based on this Z-score calculation formula, the detection rate of coronary artery lesions was found to be 21.5% (54/251), which was higher than the detection rate based on absolute values of coronary artery diameter. Notably, in the left anterior descending and left circumflex arteries, the detection rate of coronary artery lesions using this Z-score calculation formula was higher than that of previous classic Z-score calculation formulas.
CONCLUSIONS
The Z-score calculation formula established based on the power function regression model has a higher detection rate for coronary artery lesions, providing a strong reference for clinicians, particularly in assessing coronary artery lesions in children with Kawasaki disease.
Humans
;
Male
;
Female
;
Child, Preschool
;
Child
;
Coronary Artery Disease/diagnostic imaging*
;
Infant
;
Mucocutaneous Lymph Node Syndrome
;
Regression Analysis
;
Coronary Vessels/diagnostic imaging*
;
Echocardiography
;
Adolescent
6.Integrated evidence chain-based effectiveness evaluation of traditional Chinese medicines (Eff-iEC): A demonstration study.
Ye LUO ; Xu ZHAO ; Ruilin WANG ; Xiaoyan ZHAN ; Tianyi ZHANG ; Tingting HE ; Jing JING ; Jianyu LI ; Fengyi LI ; Ping ZHANG ; Junling CAO ; Jinfa TANG ; Zhijie MA ; Tingming SHEN ; Shuanglin QIN ; Ming YANG ; Jun ZHAO ; Zhaofang BAI ; Jiabo WANG ; Aiguo DAI ; Xiangmei CHEN ; Xiaohe XIAO
Acta Pharmaceutica Sinica B 2025;15(2):909-918
Addressing the enduring challenge of evaluating traditional Chinese medicines (TCMs), the integrated evidence chain-based effectiveness evaluation of TCMs (Eff-iEC) has emerged. This paper explored its capacity through a demonstration study that evaluated the effectiveness evidence of six commonly used anti-hepatic fibrosis Chinese patent medicines (CPMs), including Biejiajian Pill (BP), Dahuang Zhechong Pill (DZP), Biejia Ruangan Compound (BRC), Fuzheng Huayu Capsule (FHC), Anluo Huaxian Pill (AHP), and Heluo Shugan Capsule (HSC), using both Eff-iEC and the Grading of Recommendations, Assessment, Development, and Evaluation (GRADE) system. The recognition of these CPMs within the TCM academic community was also assessed through their inclusion in relevant medical documents. Results showed that the evidence of BRC and FHC received higher assessments in both Eff-iEC and GRADE system, while the assessments for others varied. Analysis of community recognition revealed that Eff-iEC more accurately reflects the clinical value of these CPMs, exhibiting superior evaluative capabilities. By breaking through the conventional pattern of TCMs effectiveness evaluation, Eff-iEC offers a novel epistemology that better aligns with the clinical realities and reasoning of TCMs, providing a coherent methodology for clinical decision-making, new drug evaluations, and health policy formulation.
7.Integrated-omics analysis defines subtypes of hepatocellular carcinoma based on circadian rhythm.
Xiao-Jie LI ; Le CHANG ; Yang MI ; Ge ZHANG ; Shan-Shan ZHU ; Yue-Xiao ZHANG ; Hao-Yu WANG ; Yi-Shuang LU ; Ye-Xuan PING ; Peng-Yuan ZHENG ; Xia XUE
Journal of Integrative Medicine 2025;23(4):445-456
OBJECTIVE:
Circadian rhythm disruption (CRD) is a risk factor that correlates with poor prognosis across multiple tumor types, including hepatocellular carcinoma (HCC). However, its mechanism remains unclear. This study aimed to define HCC subtypes based on CRD and explore their individual heterogeneity.
METHODS:
To quantify CRD, the HCC CRD score (HCCcrds) was developed. Using machine learning algorithms, we identified CRD module genes and defined CRD-related HCC subtypes in The Cancer Genome Atlas liver HCC cohort (n = 369), and the robustness of this method was validated. Furthermore, we used bioinformatics tools to investigate the cellular heterogeneity across these CRD subtypes.
RESULTS:
We defined three distinct HCC subtypes that exhibit significant heterogeneity in prognosis. The CRD-related subtype with high HCCcrds was significantly correlated with worse prognosis, higher pathological grade, and advanced clinical stages, while the CRD-related subtype with low HCCcrds had better clinical outcomes. We also identified novel biomarkers for each subtype, such as nicotinamide n-methyltransferase and myristoylated alanine-rich protein kinase C substrate-like 1.
CONCLUSION
We classify the HCC patients into three distinct groups based on circadian rhythm and identify their specific biomarkers. Within these groups greater HCCcrds was associated with worse prognosis. This approach has the potential to improve prediction of an individual's prognosis, guide precision treatments, and assist clinical decision making for HCC patients. Please cite this article as: Li XJ, Chang L, Mi Y, Zhang G, Zhu SS, Zhang YX, et al. Integrated-omics analysis defines subtypes of hepatocellular carcinoma based on circadian rhythm. J Integr Med. 2025; 23(4): 445-456.
Humans
;
Carcinoma, Hepatocellular/pathology*
;
Liver Neoplasms/pathology*
;
Circadian Rhythm/genetics*
;
Prognosis
;
Male
;
Female
;
Biomarkers, Tumor/genetics*
;
Middle Aged
;
Machine Learning
;
Computational Biology
8.Specific effect of inserted sham acupuncture and its impact on the estimation of acupuncture treatment effect in randomized controlled trials: A systematic survey.
Xiao-Chao LUO ; Jia-Li LIU ; Ming-Hong YAO ; Ye-Meng CHEN ; Arthur Yin FAN ; Fan-Rong LIANG ; Ji-Ping ZHAO ; Ling ZHAO ; Xu ZHOU ; Xiao-Ying ZHONG ; Jia-Hui YANG ; Bo LI ; Ying ZHANG ; Xin SUN ; Ling LI
Journal of Integrative Medicine 2025;23(6):630-640
BACKGROUND:
The use of inserted sham acupuncture as a placebo in randomized controlled trials (RCTs) is controversial, because it may produce specific effects that cause an underestimation of the effect of acupuncture treatment.
OBJECTIVE:
This systematic survey investigates the magnitude of insert-specific effects of sham acupuncture and whether they affect the estimation of acupuncture treatment effects.
SEARCH STRATEGY:
PubMed, Embase and Cochrane Central Register of Controlled Trials were searched to identify acupuncture RCTs from their inception until December 2022.
INCLUSION CRITERIA:
RCTs that evaluated the effects of acupuncture compared to sham acupuncture and no treatment.
DATA EXTRACTION AND ANALYSIS:
The total effect measured for an acupuncture treatment group in RCTs were divided into three components, including the natural history and/or regression to the mean effect (controlled for no-treatment group), the placebo effect, and the specific effect of acupuncture. The first two constituted the contextual effect of acupuncture, which is mimicked by a sham acupuncture treatment group. The proportion of acupuncture total effect size was considered to be 1. The proportion of natural history and/or regression to the mean effect (PNE) and proportional contextual effect (PCE) of included RCTs were pooled using meta-analyses with a random-effect model. The proportion of acupuncture placebo effect was the difference between PCE and PNE in RCTs with non-inserted sham acupuncture. The proportion of insert-specific effect of sham acupuncture (PIES) was obtained by subtracting the proportion of acupuncture placebo effect and PNE from PCE in RCTs with inserted sham acupuncture. The impact of PIES on the estimation of acupuncture's treatment effect was evaluated by quantifying the percentage of RCTs that the effect of outcome changed from no statistical difference to statistical difference after removing PIES in the included studies, and the impact of PIES was externally validated in other acupuncture RCTs with an inserted sham acupuncture group that were not used to calculate PIES.
RESULTS:
This analysis included 32 studies with 5492 patients. The overall PNE was 0.335 (95% confidence interval [CI], 0.255-0.415) and the PCE of acupuncture was 0.639 (95% CI, 0.567-0.710) of acupuncture's total effect. The proportional contribution of the placebo effect to acupuncture's total effect was 0.191, and the PIES was 0.189. When we modeled the exclusion of the insert-specific effect of sham acupuncture, the acupuncture treatment effect changed from no difference to a significant difference in 45.45% of the included RCTs, and in 40.91% of the external validated RCTs.
CONCLUSION
The insert-specific effect of sham acupuncture in RCTs represents 18.90% of acupuncture's total effect and significantly affects the evaluation of the acupuncture treatment effect. More than 40% of RCTs that used inserted sham acupuncture would draw different conclusions if the PIES had been controlled for. Considering the impact of the insert-specific effect of sham acupuncture, caution should be taken when using inserted sham acupuncture placebos in RCTs. Please cite this article as: Luo XC, Liu JL, Yao MH, Chen YM, Fan AY, Liang FR, Zhao JP, Zhao L, Zhou X, Zhong XY, Yang JH, Li B, Zhang Y, Sun X, Li L. Specific effect of inserted sham acupuncture and its impact on the estimation of acupuncture treatment effect in randomized controlled trials: A systematic survey. J Integr Med. 2025; 23(6):630-640.
Acupuncture Therapy/methods*
;
Humans
;
Randomized Controlled Trials as Topic
;
Placebo Effect
;
Placebos
;
Treatment Outcome
9.Effects of Laparoscopic Sleeve Gastrectomy on Cardiac Structure and Function in Obese Patients With Heart Failure.
Xiao-Yan JIA ; Rui-Jia LIAN ; Bao-Dong MA ; Yang-Xi HU ; Qin-Jun CHU ; Hai-Yun JING ; Zhi-Qiang KANG ; Jian-Ping YE ; Xi-Wen MA
Acta Academiae Medicinae Sinicae 2025;47(2):226-236
Objective To investigate the effects of laparoscopic sleeve gastrectomy(LSG)on the cardiac structure and function in obese patients with heart failure(HF)and compare the efficacy of LSG across obese patients with different HF types.Methods This study included 33 obese patients with HF who underwent LSG.The clinical indicators were compared between before operation and 12 months after operation.Repeated measures analysis of variance was employed to evaluate the changes in echocardiographic parameters before operation and 3,6,and 12 months after operation.Patients were allocated into a HF with preserved ejection fraction group(n=17),a HF with mildly reduced ejection fraction group(n=5)and a HF with reduced ejection fraction(HFrEF)group(n=11)based on left ventricular ejection fraction(LVEF)before operation for subgroup analyses of the effects of LSG on the cardiac structure and function of obese patients with HF.The paired samples t-test was conducted to assess the degree of cardiac structural and functional alterations after LSG.Results The 33 patients included 69.7% males,with an average age of(35.3±9.9)years,and a body mass index(BMI)of(51.2±9.8)kg/m2.The median follow-up was 9.0(5.0,13.3)months.Compared with the preoperative values,the postoperative BMI(P=0.002),body surface area(BSA)(P=0.009),waist circumference(P=0.010),hip circumference(P=0.031),body fat content(P=0.007),and percentage of patients with cardiac function grades Ⅲ-IV(P<0.001)decreased.At the 12-month follow-up left atrial diameter(P=0.006),right atrial long-axis inner diameter(RAD1)(P<0.001),right atrial short-axis inner diameter(RAD2)(P<0.001),right ventricular inner diameter(P=0.002),interventricular septal thickness at end-diastolic(P=0.002),and left ventricular end-diastolic volumes(P=0.004)and left ventricular end-systolic volumes(P=0.003) all significantly reduced compared with preoperative values.Additionally,left ventricular fractional shortening and LVEF improved(both P<0.001).Subgroup analyses revealed that cardiac structural parameters significantly decreased in the HF with preserved ejection fraction,HF with mildly reduced ejection fraction,and HFrEF subgroups compared with preoperative values.Notably,the HFrEF group demonstrated the best performance in terms of left atrial diameter(P=0.003),left ventricular inner diameter at end-diastole(P=0.008),RAD1(P<0.001),RAD2(P=0.004),right ventricular inner diameter(P=0.019),left ventricular end-diastolic volume(P=0.004)and left ventricular end-systolic volume(P=0.001),cardiac output(P=0.006),tricuspid regurgitation velocity(P=0.002),and pulmonary artery systolic pressure(P=0.001) compared to preoperatively.Postoperative left ventricular fractional shortening(P<0.001,P=0.003,P<0.001)and LVEF(P<0.001,P=0.011,P=0.001)became higher in all the three subgroups than the preoperative values.Conclusions LSG decreased the body weight,BMI,and BSA,improved the cardiac function grade,reversed the enlargement of the left atrium and left ventricle,reduced the right atrium and right ventricle,and enhanced the left ventricular systolic function.It was effective across obese patients with different HF types.Particularly,LSG demonstrates the best performance in improving the structures of both atria and ventricles in obese patients with HFrEF.
Humans
;
Male
;
Female
;
Gastrectomy/methods*
;
Heart Failure/complications*
;
Adult
;
Obesity/physiopathology*
;
Laparoscopy
;
Middle Aged
;
Heart/physiopathology*
;
Stroke Volume
10.The taste correction process of ibuprofen oral solution based on the combination of electronic tongue technology and artificial taste comprehensive evaluation
Rui YUAN ; Yun-ping QU ; Yan WANG ; Ya-xuan ZHANG ; Wan-ling ZHONG ; Xiao-yu FAN ; Hui-juan SHEN ; Yun-nan MA ; Jin-hong YE ; Jie BAI ; Shou-ying DU
Acta Pharmaceutica Sinica 2024;59(8):2404-2411
This experiment aims to study the taste-masking effects of different kinds of corrigent used individually and in combination on ibuprofen oral solution, in order to optimize the taste-masking formulation. Firstly, a wide range of corrigent and the mass fractions were extensively screened using electronic tongue technology. Subsequently, a combination of sensory evaluation, analytic hierarchy process (AHP)-fuzzy mathematics evaluation, and Box-Behnken experimental design were employed to comprehensively assess the taste-masking effects of different combinations of corrigent on ibuprofen oral solution, optimize the taste-masking formulation, and validate the results. The study received ethical approval from the Review Committee of the Beijing University of Chinese Medicine (ethical code: 2024BZYLL0102). The results showed that corrigent fractions and types were screened separately through single-factor experiments. Subsequently, a Box-Behnken response surface design combined with AHP and fuzzy mathematics evaluation was used to fit a functional model:

Result Analysis
Print
Save
E-mail