ObjectiveTo evaluate the antitumor activity of Periplaneta americana extract（PAE） against human-derived lung adenocarcinoma organoids（LUAD-PDOs） and to elucidate its potential mechanism based on transcriptomics. MethodsFresh tumor and adjacent normal tissues from patients with LUAD were collected to construct LUAD-PDOs and normal lung organoid（Nor-PDOs） models using 3D organoid culture technology. The effective intervention concentration of PAE was determined using the cell counting kit-8（CCK-8） assay. Experimental groups included the model group（LUAD-PDOs）， normal group， model administration group（LUAD-PDOs+PAE）， and normal administration group（Nor-PDOs+PAE）. Hematoxylin-eosin（HE） staining was used to observe the pathological structures of PDOs， immunohistochemistry（IHC） was performed to detect the expressions of the proliferation marker Ki-67 and lung adenocarcinoma differentiation markers cytokeratin-7（CK-7） and Napsin A， TUNEL staining was applied to detect cell apoptosis. RNA sequencing（RNA-Seq） was conducted to identify differentially expressed genes（DEGs）， followed by Gene Ontology（GO）， Kyoto Encyclopedia of Genes and Genomes（KEGG）， and Gene Set Enrichment Analysis（GSEA）， alongside protein-protein interaction（PPI） network analysis to screen core mechanisms. Finally， key targets were validated by integrating external database analysis with immunofluorescence（IF）. ResultsNor-PDOs and LUAD-PDOs that highly recapitulated the pathological characteristics of the primary tissues were successfully established. The CCK-8 assay determined that the effective intervention concentration of PAE was 16 g·L^-1. Morphological observation showed that Nor-PDOs exhibited lumen-forming structures， whereas LUAD-PDOs displayed dense， solid structures. CCK-8 and TUNEL assays revealed that， compared with the model group， PAE intervention inhibited the proliferation of LUAD-PDOs and promoted apoptosis in LUAD cells， while showing no significant effect on the viability of Nor-PDOs. Transcriptomic analysis identified 719 DEGs that were significantly reversed after PAE intervention（347 up-regulated and 372 down-regulated）（P<0.05）. GO enrichment analysis indicated that DEGs in the model administration group were significantly enriched in biological processes related to cell cycle regulation compared to the model group. KEGG pathway analysis revealed that PAE affected pathways related to proliferation and metabolism， including pathways in cancer and the p53 signaling pathway. GSEA further confirmed that PAE significantly enhanced the activity of the p53 signaling pathway（P<0.05）. PPI network analysis indicated that breast cancer type 1 susceptibility protein（BRCA1） and checkpoint kinase 1（CHEK1） were the core down-regulated targets in the p53 pathway. IF verified the high expression of BRCA1 and CHEK1 in LUAD-PDOs and their significant downregulation after PAE intervention（P<0.05）. Furthermore， survival analysis based on The Cancer Genome Atlas（TCGA） database indicated that low expression of BRCA1 and CHEK1 was significantly associated with prolonged overall survival in patients with LUAD（P<0.05）. ConclusionPAE effectively inhibits proliferation of LUAD-PDOs and promotes their apoptosis， its anti-tumor mechanism is potentially associated with the activation of the p53 signaling pathway， with BRCA1 and CHEK1 genes likely serving as key downstream targets for the effects of PAE.

Cancer stem cells (CSCs) represent a distinct subpopulation of cells characterized by self-renewal capacity, differentiation potential, and critical roles in driving tumor progression, therapeutic resistance, recurrence, and maintenance of the tumor microenvironment. Targeting CSCs has emerged as a pivotal direction in cancer research, offering novel strategies to overcome drug resistance and prevent metastasis and relapse. Lysosomes, traditionally recognized as central organelles for intracellular degradation and recycling, are indispensable for cellular homeostasis. Dysregulation of lysosomal function is intimately linked to various diseases, including cancer. In tumors, aberrant lysosomal activity can promote malignant progression through mechanisms such as altering metabolic pathways, enhancing lysosomal exocytosis, modulating drug resistance, and interfering with autophagy-lysosomal pathways. Recent studies have underscored the involvement of lysosomes in regulating CSC properties. This review synthesizes findings on lysosomal regulation of CSCs through the following aspects. (1) Lysosomes exert complex and critical bidirectional control over CSC stemness maintenance through three degradation pathways that are dependent on their degradative function. (i) The lysophagy pathway. This pathway exhibits dual roles. Activation can sustain CSC functions; for instance, in glioblastoma, hypoxia upregulates Gal-8 via the STAT3/HIF1α signaling axis to induce autophagy, supporting stem cell survival. In head and neck squamous cell carcinoma, degradation of GSK3β activates the Wnt pathway, enhancing stemness. Conversely, this pathway can suppress stemness by degrading stemness-related proteins such as BMI-1 and OCT4A, thereby impairing CSC self-renewal capacity. (ii) Mitophagy pathway. In non-small cell lung cancer stem cells, mitophagy-related mechanisms, such as the accumulation of mitochondrial DNA (mtDNA) activating the TLR9-Notch1-AMPK signaling axis, have been shown to promote CSC proliferation. (iii) Autophagosome-dependent lysosomal degradation pathway. This pathway directly regulates stemness-related proteins in a bidirectional manner. Enhanced degradative function can promote CSC properties, exemplified by the degradation of NUMB to activate Notch signaling. Conversely, attenuated degradative function can also enhance stemness by stabilizing oncoproteins (e.g., protecting Frizzled-1 from degradation to sustain Wnt signaling) or preventing the degradation of tumor suppressors (e.g., inhibiting Notch degradation). (2) Constituent proteins of lysosomes, including membrane proteins and luminal acid hydrolases, participate in regulating CSC stemness. Regarding membrane proteins, LAMP2A facilitates chaperone-mediated autophagy to maintain stemness in glioblastoma and ovarian cancer. V-ATPase, by maintaining an acidic luminal environment, promotes proliferation and drug resistance in glioma stem cells. Among hydrolases, cathepsins B and L are highly expressed in pancreatic and ovarian cancers and correlate with poor prognosis. Furthermore, targeting lysosomes to induce lysosomal membrane permeabilization (LMP) triggers lysosome-mediated cell death, presenting a potential therapeutic strategy for eradicating CSCs.(3) The acidic luminal environment, single-membrane structure, and the presence of transmembrane transporters (e.g., ABCA3) enable lysosomes to passively trap or actively uptake and sequester chemotherapeutic drugs. Subsequent drug extrusion via exocytosis confers drug resistance. In CSCs, this lysosome-mediated drug sequestration, often cooperating with autophagy, establishes multimodal drug resistance. Therefore, targeting lysosomal function represents a potential strategy to overcome therapy resistance. The central role of lysosomes in regulating CSC stemness and resistance positions them as highly promising therapeutic targets. Strategies aimed at disrupting lysosomal function to selectively eliminate CSCs include: inhibiting the lysosome-autophagy system using agents like IITZ or lovastatin; inducing lysosomal membrane permeabilization (LMP) with compounds such as hexamethylene amiloride to compromise membrane stability; and disrupting the acidic luminal environment using drugs like siramesine or the K/H transport compound 2. In conclusion, lysosomes critically regulate CSC stemness maintenance and drug resistance through degradative pathways, membrane protein functions, luminal hydrolase activities, and drug sequestration mechanisms. This redefines the lysosome from a traditional “waste disposal unit” to a “signal integration center” in CSCs. The duality and context-dependency of lysosomal function in CSCs offer novel insights into the heterogeneity observed across different tumors. Targeting lysosomal vulnerabilities—such as inducing LMP, disrupting acidity, or blocking autophagic flux—provides a strategy to bypass canonical CSC resistance mechanisms and directly trigger cell death. This establishes the lysosome as a key target to overcome CSC-mediated therapy resistance, paving the way for developing diverse candidate drugs and innovative combination therapies in oncology.

Metabolic dysfunction-associated steatotic liver disease (MASLD) has become the most prevalent chronic liver disease worldwide, affecting approximately 32%-38% of the adult population and posing a growing public health burden. MASLD represents a continuous disease spectrum ranging from simple steatosis to metabolic dysfunction-associated steatohepatitis (MASH), progressive hepatic fibrosis, cirrhosis, and ultimately hepatocellular carcinoma (HCC). The pathological core of MASLD lies in disruption of hepatic lipid metabolic homeostasis, characterized by an imbalance among de novo lipogenesis, fatty acid β-oxidation, and very-low-density lipoprotein (VLDL)-mediated lipid export. This metabolic disequilibrium subsequently drives inflammatory injury and fibrotic progression. Among the multiple regulatory pathways involved, thyroid hormone (TH) signaling has emerged as a central regulator of hepatic metabolic homeostasis. The liver is a major peripheral target organ of TH action, where TH predominantly exerts its metabolic effects through thyroid hormone receptor β (TRβ). Large-scale epidemiological studies and meta-analyses have demonstrated that hypothyroidism is significantly associated with increased MASLD prevalence, more severe histological injury, and advanced hepatic fibrosis, suggesting that dysregulation of TH signaling may participate throughout the entire MASLD disease spectrum. At the molecular level, TH regulates hepatic lipid metabolism by coordinating suppression of lipogenesis, enhancement of mitochondrial fatty acid oxidation, and promotion of VLDL assembly and secretion through integrated genomic actions of the T3-TRβ axis and non-genomic signaling pathways. Across different stages of MASLD, TH signaling exerts stage-dependent protective effects. In the steatosis stage, TH improves metabolic flexibility by modulating insulin sensitivity, glucose metabolism, and lipid droplet clearance, thereby alleviating early lipotoxic stress. During progression to MASH, TH attenuates inflammatory amplification by improving mitochondrial homeostasis, suppressing activation of the NOD-like receptor family pyrin domain containing 3 (NLRP3) inflammasome, and modulating the gut-liver axis microenvironment. In advanced stages, TH signaling influences hepatic stellate cell activation and extracellular matrix deposition, partly through interaction with the transforming growth factor-β (TGF-β)/SMAD pathway, while alterations in intrahepatic TH availability, mediated by dynamic changes in iodothyronine deiodinase 1 (DIO1), contribute to fibrosis progression and hepatocellular dedifferentiation. In hepatocellular carcinoma, coordinated downregulation of TRβ and DIO1 establishes a tumor-associated hypothyroid state that promotes metabolic reprogramming and tumor progression. The clinical relevance of TH signaling in MASLD has been underscored by the recent approval of Resmetirom, a liver-targeted TRβ‑selective agonist, for the treatment of non-cirrhotic MASH with moderate-to-severe fibrosis (F2-F3). This approval represents a landmark transition from mechanistic understanding to metabolism-centered precision therapy in MASLD. Clinical trials have demonstrated that Resmetirom not only improves key histological endpoints, including MASH resolution and fibrosis regression, but also favorably modulates atherogenic lipid profiles, highlighting the therapeutic potential of selectively targeting hepatic TH pathways. This review systematically summarizes the multidimensional regulatory roles of TH across the MASLD disease spectrum and discusses emerging diagnostic and therapeutic implications of TH-based interventions, aiming to inform future mechanistic research and optimize clinical management strategies.

ObjectiveTo explore the vascular endothelial injury in male mice caused by exposure to polystyrene microplastics （PS-MPs） and the intervention effect of luteolin on vascular remodeling. Additionally， to investigate the mechanism through the oxidative system and metabolomics. MethodsThirty-two C57BL/6 mice （6-8 weeks old） were randomly divided into the saline group （saline group）， the 0.1 mg/kg PS-MPs exposure group （0.1PS-MPs group）， the 1 mg/kg PS-MPs exposure group （1PS-MPs group）， and the 1 mg/kg PS-MPs + luteolin treatment group （1PS-MPs + Lut group）， with 8 mice in each group. After 8 weeks of intervention， the body weight， blood pressure， aortic organ coefficient， and aortic histopathological changes of mice in each group were detected； the total cholesterol （TC）， triglyceride （TG）， and high-density lipoprotein cholesterol （HDL-C） lipid metabolism-related indicators in the aorta of mice were detected； the reactive oxygen species （ROS）， glutathione （GSH）， and malondialdehyde （MDA） oxidative stress-related indicators were detected； the endothelin （ET-1）， nitric oxide （NO）， vascular endothelial growth factor A （VEGF-A）， vascular cell adhesion molecule-1 （VCAM-1/CD106）， and intercellular adhesion molecule-1 （ICAM-1/CD54） endothelial function-related indicators and serum metabolomics were detected. ResultsCompared to the saline group， exposure to PS-MPs resulted in pathological thickening of the mouse aorta， increased aortic organ coefficient， and elevated blood pressure. Lipid metabolism-related indicators， including TC and TG， were elevated， while HDL-C was reduced， indicating lipid metabolism disorder in mice. Oxidative stress markers such as ROS and MDA increased， whereas GSH decreased， demonstrating oxidative damage. Vascular endothelial inflammation and injury markers， including ET-1， VEGF-A， VCAM-1， and ICAM-1， were upregulated， while the vasodilatory substance NO was downregulated， confirming endothelial injury. Furthermore， serum metabolomics results revealed that PS-MPs exposure induced endothelial damage by disrupting metabolic pathways such as the citrate cycle. Compared to the PS-MPs group， luteolin significantly reversed these effects， attenuating oxidative stress and lipid metabolism disorders， and effectively repairing endothelial injury. ConclusionPS-MPs induce vascular toxicity through oxidative stress and lipid metabolism. Luteolin effectively alleviates endothelial damage and vascular remodeling.

Background/Aims: Chronic constipation is prevalent yet under-diagnosed across Asia, compromising quality of life and burdening healthcare systems. Cultural stigma, varied diets, and limited access to standardized diagnostic tools delay timely care. Methods: The Bali Chronic Constipation Roundtable in November 2024, brought together experts from 11 Asian countries. The group reviewed epidemiological data, analyzed multinational questionnaire on clinical practice pattern, and conducted structured discussions to identify key barriers and propose region-specific recommendations. Results: Chronic constipation prevalence varies across Asia, ranging from 1.8% in India to 16.6% in Japan, with women and the elderly disproportionately affected. Under-reporting persists owing to cultural taboos and widespread self treatment with laxatives and traditional medications. Although the Rome IV criteria remains the global standard, they may not fully reflect Asian symptom profiles, and diagnosis is limited by scarce motility laboratories. First line therapies such as dietary-fiber optimization and osmotic laxatives are widely available, but newer pharmacotherapies (prucalopride, linaclotide, lubiprostone, and elobixibat) remain costly and unevenly accessible. Biofeedback for dyssynergic defecation is underutilized due to limited availability. Experts recommend expanded regional research on to refine diagnostic criteria, coupled with enhanced physician education and public awareness. They advocate accessibility to second-line and novel therapies that incorporate culturally attuned regional guidelines, and improved access to gastrointestinal motility testing. Conclusions The Bali Chronic Constipation Roundtable highlighted Asia’s need for region specific diagnostics and management. Addressing diagnostic and treatment gaps will improve outcomes, while ongoing researcher clinician policy collaboration must standardize guidelines, advance research, and ensure equitable care across Asia.

ObjectiveTo establish the mouse models of psoriasis-like lesions induced by continuous cold exposure or intermittent cold exposure combined with imiquimod （IMQ）， and to evaluate the interventional effects of Kaixuan Jiedu core prescription （KXJD） on the two models. MethodsMale C57BL/6J mice were selected and classified into two experimental batches. The first batch of 36 mice was randomized into a room temperature group， a continuous cold exposure （10 ℃/24 h） group， and an intermittent cold exposure （10 ℃/6 h） group. Each group was further divided into a normal subgroup and a model subgroup （topical application of IMQ to induce skin lesions）， with 6 mice in each subgroup， for modeling and evaluation. The second batch of 54 mice， with 6 in each group， were subjected to the same temperature grouping with an additional KXJD （30.42 g·kg^-1， continuous gavage for 5 days） group. Comprehensive evaluation of model characteristics and KXJD efficacy was conducted through Psoriasis Area and Severity Index （PASI） scoring， skin temperature measurement by infrared thermography， histopathological observation by hematoxylin-eosin （HE） staining， detection of vascular endothelial growth factor （VEGF） and platelet endothelial cell adhesion molecule 1 （CD31） by immunohistochemistry， detection of Claudin-1 and Occludin by immunofluorescence assay， determination of serum levels of tumor necrosis factor-α （TNF-α） and interleukin （IL）-10 by enzyme-linked immunosorbent assay （ELISA）， and quantification of mRNA levels of IL-17A， IL-23， IL-6， and chemokine ligand 20 （CCL20） in skin lesions by quantitative Real-time polymerase chain reaction （Real-time PCR）. ResultsModel mice in all temperature groups exhibited typical psoriasis-like skin lesions. Compared with the normal groups， the model groups showed increased PASI scores， decreased skin temperatures （P<0.05）， obvious epidermal thickening， parakeratosis， and dermal inflammatory cell infiltration， as well as elevated mRNA levels of IL-17A， IL-23， IL-6， and CCL20 （P<0.05）. Cold exposure further aggravated psoriasis. The total PASI score of the intermittent cold exposure model group was higher than that of the room temperature model group （P<0.05）. The serum IL-10 did not show a compensatory elevation， and the blood vessels presented a characteristic of elevated CD31 expression （P<0.05） without a synchronous increase in VEGF. The continuous cold exposure model group exhibited more significant dermal capillary tortuosity and dilation， with the highest mRNA levels of IL-17A， IL-23， IL-6， and CCL20 among all groups. Compared with the respective model groups， KXJD intervention alleviated skin lesions， reduced epidermal thickness and inflammatory cell infiltration， and increased skin temperature， with the temperature increase being particularly significant in the intermittent cold exposure+KXJD group （P<0.05）. Furthermore， KXJD down-regulated the expression of VEGF and CD31， restored the expression of Claudin-1 and Occludin， decreased the mRNA levels of IL-17A and IL-23 （P<0.05）， and reduced the serum TNF-α level. ConclusionThis study successfully established compound psoriasis-like mouse models induced by cold exposure combined with IMQ. It confirms that cold aggravates the severity of psoriasis by exacerbating the closure of Xuanfu （sweat pores）， microcirculation disorders， and immune imbalance. Moreover， different cold exposure patterns have distinct mechanism differences. Continuous cold exposure focuses on enhancing the inflammatory response via the IL-23/IL-17 axis and angiogenesis， simulating chronic aggravation under a long-term cold environment. Intermittent cold exposure tends to impair immune regulation and induce microvascular endothelial stress， corresponding to acute exacerbations caused by sudden temperature drops. KXJD can effectively alleviate psoriasis-like skin lesions under cold conditions by unblocking Xuanfu， regulating vasomotor function， and correcting abnormal immune-inflammatory responses.

OBJECTIVE: To investigate the clinical effect of minimally invasive technique in the treatment of moderate and severe gluteal muscle contracture. METHODS: A retrospective study was conducted on 85 patients (170 sides) with bilateral gluteal muscle contracture admitted from January 2016 to December 2019. All patients were treated with minimally invasive release of tendon knife. There were 32 males and 53 females, ranging in age from 15 to 37 years old, with an average age of (22.3±6.3) years old. Operation time, intraoperative blood loss, incision length, first postoperative ambulation time, complication rate, recurrence rate, and Harris hip score (HHS) were analyzed and evaluated. RESULTS: The average follow-up time was (16.2±4.6) months, ranging from 12 to 30 months. The operation time ranged from 7 to 15 min, with an average of (10.2±3.1) min. Intraoperative blood loss ranged from 2 to 20 ml, with an average of (8.4±2.2) ml. The incision length ranged from 0.6 to 2.0 cm, with an average of (0.8±0.3) cm. The time to postoperative ambulation ranged from 12 to 28 h, with an average of (20.0±3.2) h. All patients achieved primary wound healing without sciatic nerve injury or recurrence. HHS hip function scores ranged from 90 to 98, with an average score of (96.2±1.4). Complications included intraoperative tendon blade tip fracture in two cases (removed under fluoroscopic guidance) and subcutaneous hematoma in three cases-two resolved with compression and one with open evacuation.. Twenty-nine patients exhibited transient swaying gait postoperatively, of which 24 patients returned to normal after 4 weeks and 5 patients returned to normal after 6 weeks. CONCLUSION Minimally invasive tendon blade release is a safe and effective technique for treating gluteal muscle contracture, offering minimal trauma, rapid recovery, and excellent cosmetic and functional outcomes. However, it exhibits a low risk of blade tip fracture and sciatic nerve injury, warranting experienced surgical handling.
Humans ; Male ; Female ; Adult ; Minimally Invasive Surgical Procedures/methods* ; Adolescent ; Retrospective Studies ; Buttocks/surgery* ; Young Adult ; Contracture/surgery* ; Tendons/surgery* ; Muscle, Skeletal/surgery*

To guide clinical blood transfusion practices for pediatric patients, the National Health Commission has issued the health standard "Guideline for pediatric transfusion" (WS/T 795-2022). Blood transfusion is one of the most commonly used supportive treatments for children with hematological diseases. This guideline provides guidance and recommendations for blood transfusions in children with aplastic anemia, thalassemia, autoimmune hemolytic anemia, glucose-6-phosphate dehydrogenase deficiency, acute leukemia, myelodysplastic syndromes, immune thrombocytopenic purpura, and thrombotic thrombocytopenic purpura. This article presents the evidence and interpretation of the blood transfusion provisions for children with hematological diseases in the "Guideline for pediatric transfusion", aiming to assist in the understanding and implementing the blood transfusion section of this guideline.
Humans ; Child ; Hematologic Diseases/therapy* ; Blood Transfusion/standards* ; Practice Guidelines as Topic

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

To guide clinical blood transfusion practices for pediatric patients, the National Health Commission has issued the health standard "Guideline for pediatric transfusion" (WS/T 795-2022). Blood transfusion for children undergoing hematopoietic stem cell transplantation is highly complex and challenging. This guideline provides recommendations on transfusion thresholds and the selection of blood components for these children. This article presents the evidence and interpretation of the transfusion provisions for children undergoing hematopoietic stem cell transplantation, with the aim of enhancing the understanding and implementation of the "Guideline for pediatric transfusion".
Humans ; Hematopoietic Stem Cell Transplantation ; Child ; Blood Transfusion/standards* ; Practice Guidelines as Topic