Metabolic dysfunction-associated steatotic liver disease (MASLD) has become the most prevalent chronic liver disease worldwide, affecting approximately 32%-38% of the adult population and posing a growing public health burden. MASLD represents a continuous disease spectrum ranging from simple steatosis to metabolic dysfunction-associated steatohepatitis (MASH), progressive hepatic fibrosis, cirrhosis, and ultimately hepatocellular carcinoma (HCC). The pathological core of MASLD lies in disruption of hepatic lipid metabolic homeostasis, characterized by an imbalance among de novo lipogenesis, fatty acid β-oxidation, and very-low-density lipoprotein (VLDL)-mediated lipid export. This metabolic disequilibrium subsequently drives inflammatory injury and fibrotic progression. Among the multiple regulatory pathways involved, thyroid hormone (TH) signaling has emerged as a central regulator of hepatic metabolic homeostasis. The liver is a major peripheral target organ of TH action, where TH predominantly exerts its metabolic effects through thyroid hormone receptor β (TRβ). Large-scale epidemiological studies and meta-analyses have demonstrated that hypothyroidism is significantly associated with increased MASLD prevalence, more severe histological injury, and advanced hepatic fibrosis, suggesting that dysregulation of TH signaling may participate throughout the entire MASLD disease spectrum. At the molecular level, TH regulates hepatic lipid metabolism by coordinating suppression of lipogenesis, enhancement of mitochondrial fatty acid oxidation, and promotion of VLDL assembly and secretion through integrated genomic actions of the T3-TRβ axis and non-genomic signaling pathways. Across different stages of MASLD, TH signaling exerts stage-dependent protective effects. In the steatosis stage, TH improves metabolic flexibility by modulating insulin sensitivity, glucose metabolism, and lipid droplet clearance, thereby alleviating early lipotoxic stress. During progression to MASH, TH attenuates inflammatory amplification by improving mitochondrial homeostasis, suppressing activation of the NOD-like receptor family pyrin domain containing 3 (NLRP3) inflammasome, and modulating the gut-liver axis microenvironment. In advanced stages, TH signaling influences hepatic stellate cell activation and extracellular matrix deposition, partly through interaction with the transforming growth factor-β (TGF-β)/SMAD pathway, while alterations in intrahepatic TH availability, mediated by dynamic changes in iodothyronine deiodinase 1 (DIO1), contribute to fibrosis progression and hepatocellular dedifferentiation. In hepatocellular carcinoma, coordinated downregulation of TRβ and DIO1 establishes a tumor-associated hypothyroid state that promotes metabolic reprogramming and tumor progression. The clinical relevance of TH signaling in MASLD has been underscored by the recent approval of Resmetirom, a liver-targeted TRβ‑selective agonist, for the treatment of non-cirrhotic MASH with moderate-to-severe fibrosis (F2-F3). This approval represents a landmark transition from mechanistic understanding to metabolism-centered precision therapy in MASLD. Clinical trials have demonstrated that Resmetirom not only improves key histological endpoints, including MASH resolution and fibrosis regression, but also favorably modulates atherogenic lipid profiles, highlighting the therapeutic potential of selectively targeting hepatic TH pathways. This review systematically summarizes the multidimensional regulatory roles of TH across the MASLD disease spectrum and discusses emerging diagnostic and therapeutic implications of TH-based interventions, aiming to inform future mechanistic research and optimize clinical management strategies.

"Prescriptions being modified according to the syndrome and processing following prescription" is one of the characteristics of clinical medication in traditional Chinese medicine(TCM), and it is also an important sign that distinguishes TCM from other traditional medicine. The processing methods of TCM decoctions originate from the ingenious combination of medicinal materials, the mutual restraint of seven emotions, the harmony of four properties, and the pairing and combining of medicinal materials in prescriptions. They are the concrete embodiment of the essence and characteristics of "prescriptions being modified according to the syndrome and processing following prescription". However, due to insufficient inheritance and innovation, many characteristic varieties and pharmaceutical experience have been lost or forgotten. There is an urgent need to systematically explore and organize the processing theory and characteristic varieties of TCM decoctions, delve into the scientific connotation of the processing principles, and optimize the processing technology. Therefore, this article systematically organizes and summarizes the historical evolution and modern research progress of TCM decoction processing, conducts in-depth reflection on the current problems, and puts forward reasonable suggestions, with the aim of further inheriting, enriching, and developing the processing theory of TCM decoctions and providing support for ensuring the clinical efficacy of prescriptions.
Drugs, Chinese Herbal/isolation & purification* ; Humans ; Medicine, Chinese Traditional/methods*

PURPOSE: Intertrochanteric fractures undergoing proximal femoral nail antirotation (PFNA) surgery are associated with significant hidden blood loss. This study aimed to explore whether intramedullary administration of tranexamic acid (TXA) can reduce bleeding in PFNA surgery for intertrochanteric fractures in elderly individuals. METHODS: A randomized controlled trial was conducted from January 2019 to December 2022. Patients aged over 60 years with intertrochanteric fractures who underwent intramedullary fixation surgery with PFNA were eligible for inclusion and grouped according to random numbers. A total of 249 patients were initially enrolled, of which 83 were randomly allocated to the TXA group and 82 were allocated to the saline group. The TXA group received intramedullary perfusion of TXA after the bone marrow was reamed. The primary outcomes were total peri-operative blood loss and post-operative transfusion rate. The occurrence of adverse events was also recorded. Continuous data was analyzed by unpaired t-test or Mann-Whitney U test, and categorical data was analyzed by Pearson Chi-square test. RESULTS: The total peri-operative blood loss (mL) in the TXA group was significantly lower than that in the saline group (577.23 ± 358.02 vs. 716.89 ± 420.30, p = 0.031). The post-operative transfusion rate was 30.67% in the TXA group and 47.95% in the saline group (p = 0.031). The extent of post-operative deep venous thrombosis and the 3-month mortality rate were similar between the 2 groups. CONCLUSION We observed that intramedullary administration of TXA in PFNA surgery for intertrochanteric fractures in elderly individuals resulted in less peri-operative blood loss and decreased transfusion rate, without any adverse effects, and is, thus, recommended.
Humans ; Tranexamic Acid/administration & dosage* ; Hip Fractures/surgery* ; Male ; Aged ; Female ; Fracture Fixation, Intramedullary/adverse effects* ; Blood Loss, Surgical/prevention & control* ; Antifibrinolytic Agents/administration & dosage* ; Aged, 80 and over ; Bone Nails ; Middle Aged ; Blood Transfusion/statistics & numerical data*

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVES: To investigate the application value of thromboelastography (TEG) in assessing coagulation function in children with severe hemophilia A (HA) after emicizumab (EMI) therapy. METHODS: A retrospective analysis was performed on the activated partial thromboplastin time (APTT) and TEG testing results of 17 children with severe HA before and after EMI treatment at Shenzhen Children's Hospital from January 2023 to July 2024. Correlation analysis was conducted between coagulation factor VIII (FVIII) equivalent activity and reaction time (R value) measured by TEG. RESULTS: After EMI treatment, the mean bleeding rate for children with severe HA was 1.6 events per year, with 15 children (88%) without spontaneous bleeding or joint bleeding. The children with severe HA showed a significant reduction in APTT after EMI treatment (P<0.05), with a significantly shorter APTT than the normal control group (P<0.05). There was no correlation between APTT and FVIII equivalent activity after treatment (P>0.05). After EMI treatment, TEG parameters, including R value, kinetic time, alpha angle (α), maximum amplitude, clot strength, and coagulation index, shifted from a hypocoagulable state before treatment to a nearly normal state after treatment (P<0.05). The R value demonstrated a strong negative correlation with FVIII equivalent activity (r=-0.758, P<0.05). CONCLUSIONS The bleeding condition of children with severe HA can be effectively controlled after EMI treatment. Routine APTT testing cannot reflect true coagulation function, whereas TEG testing is clinically valuable in assessing the coagulation function of children with severe HA undergoing EMI treatment.
Humans ; Thrombelastography ; Hemophilia A/physiopathology* ; Male ; Child ; Antibodies, Bispecific/therapeutic use* ; Antibodies, Monoclonal, Humanized/therapeutic use* ; Blood Coagulation/drug effects* ; Child, Preschool ; Retrospective Studies ; Female ; Partial Thromboplastin Time ; Adolescent ; Infant

Early screening, diagnosis, and intervention for congenital muscular torticollis (CMT) in infants are crucial for improving clinical outcomes. However, in China, limited awareness of CMT among child healthcare institutions and caregivers, as well as inconsistent professional standards among rehabilitation personnel, pose significant challenges to the effective diagnosis and management of CMT. The "Physical therapy management of congenital muscular torticollis: a 2024 evidence-based clinical practice guideline from the American Physical Therapy Association Academy of Pediatric Physical Therapy" includes 17 action statements, primarily addressing the prevention, identification, assessment, and intervention of CMT. This guideline is expected to facilitate early detection of CMT in infants, enhance the treatment capabilities of physical therapists, and improve clinical outcomes. This article provides an interpretation of the guideline in the context of the current status of CMT diagnosis and management in China, aiming to offer a reference for improving the ability of primary child healthcare providers and physical therapists to recognize and manage CMTropriately.
Humans ; Torticollis/diagnosis* ; Physical Therapy Modalities ; Practice Guidelines as Topic ; Infant ; United States

The use of wastewater analysis, or wastewater-based epidemiology, to assess and monitor the situation of drug abuse is now widely used at home and abroad. However, there is currently a lack of effective evaluation methods and effective ways of comparison, supervision and standardization, which is not conducive to the analysis and comparisons of data in different countries and regions. Quality control techniques can control the laboratory's analytical errors, safeguard the consistency and comparability of identification conclusions, and promote the further improvement of the level and capacity of urban drug governance, thus playing significant roles. This paper provides an overview of sample collection, sample preservation and transportation, laboratory analysis, back-calculation of drug use and external laboratory quality control in the process of wastewater analysis, with a view to exploring more comprehensive scientific and objective methods and approaches suitable for examining and evaluating qualitative and quantitative analysis of drugs in wastewater among laboratories.

Objective lt focuses on the pivotal role of physician-scientists as a central driving force in the advancement of research-oriented hospitals,with particular emphasis on mapping the cultivation pathways and structural framework of their core competencies,while integrating existing evidence to propose optimization strategies.Methods A systematic review was conducted using PubMed,Web of Science,Embase,CNKl,and Wanfang databases to identify studies published between 2000 and 2024 concerning the core competencies of physician-scientists.Results A total of 29 studies were included.The synthesized core competency framework comprises four domains:clinical research capacity,interdisciplinary integration ability,teamwork ability and leadership,and professional integrity and accountability.Conclusion The core competencies of physician-scientists exhibit a progressive trajectory aligned with career development.Future efforts should further clarify the professional role of physician-scientists and accelerate the research on the core competencies of physician-scientists in line with the requirements of job competence,thereby advancing the high-quality development of research-oriented hospitals.

Paraplegia caused by spinal cord injury is a serious neurological complication, for which surgery is currently the main treatment method. Due to different surgical approaches, patients are usually expected to maintain a passive prone position for a long time or switch between the supine and prone positions. Affected by multiple factors such as neurogenic sensory disorders, pathological changes in muscle tone and operative duration, the risk of intraoperative acquired pressure injury (IAPI) is significantly increased. Current clinical prevention strategies for IAPI in these patients predominantly focus on localized pressure relief during positioning, lacking systematic, standardized comprehensive prevention protocols or evidence-based guidelines. To address it, Department of Nursing, Orthopedics Branch, China International Exchange and Promotive Association for Medical and Health Care, Spinal Trauma Professional Committee, Orthopedics Branch, Chinese Medical Doctor Association, Nursing Group of Spine and Spinal Cord Professional Committee of Chinese Association of Rehabilitation Medicine organized experts in relevant fields to formulate Guideline for the prevention of intraoperative acquired pressure injury in paraplegic patients with spinal cord injury ( version 2025), based on evidence-based medical evidence and latest research results and clinical practice at home and abroad. Eleven recommendations were put forward from the aspects of preoperative risk assessment, intraoperative prevention strategies, postoperative handover and monitoring, and supportive mechanisms for IAPI prevention, aiming to standardize the prevention measures and management strategies of IAPI in paraplegic patients with spinal cord injury and accelerate the recovery of patients and improve the therapeutic effect.