1.SOX11-mediated CBLN2 Upregulation Contributes to Neuropathic Pain through NF-κB-Driven Neuroinflammation in Dorsal Root Ganglia of Mice.
Ling-Jie MA ; Tian WANG ; Ting XIE ; Lin-Peng ZHU ; Zuo-Hao YAO ; Meng-Na LI ; Bao-Tong YUAN ; Xiao-Bo WU ; Yong-Jing GAO ; Yi-Bin QIN
Neuroscience Bulletin 2025;41(12):2201-2217
Neuropathic pain, a debilitating condition caused by dysfunction of the somatosensory nervous system, remains difficult to treat due to limited understanding of its molecular mechanisms. Bioinformatics analysis identified cerebellin 2 (CBLN2) as highly enriched in human and murine proprioceptive and nociceptive neurons. We found that CBLN2 expression is persistently upregulated in dorsal root ganglia (DRG) following spinal nerve ligation (SNL) in mice. In addition, transcription factor SOX11 binds to 12 cis-regulatory elements within the Cbln2 promoter to enhance its transcription. SNL also induced SOX11 upregulation, with SOX11 and CBLN2 co-localized in nociceptive neurons. The siRNA-mediated knockdown of Sox11 or Cbln2 attenuated SNL-induced mechanical allodynia and thermal hyperalgesia. High-throughput sequencing of DRG following intrathecal injection of CBLN2 revealed widespread gene expression changes, including upregulation of numerous NF-κB downstream targets. Consistently, CBLN2 activated NF-κB signaling, and inhibition with pyrrolidine dithiocarbamate reduced CBLN2-induced pain hypersensitivity, proinflammatory cytokines and chemokines production, and neuronal hyperexcitability. Together, these findings identified the SOX11/CBLN2/NF-κB axis as a critical mediator of neuropathic pain and a promising target for therapeutic intervention.
Animals
;
Neuralgia/metabolism*
;
Ganglia, Spinal/metabolism*
;
Up-Regulation
;
Mice
;
NF-kappa B/metabolism*
;
SOXC Transcription Factors/genetics*
;
Male
;
Neuroinflammatory Diseases/metabolism*
;
Mice, Inbred C57BL
;
Nerve Tissue Proteins/genetics*
;
Hyperalgesia/metabolism*
;
Signal Transduction
;
Spinal Nerves
2.Research progress on pentacyclic triterpenoids in medicinal Ilex species and their pharmacological activities.
Yu-Ling LIU ; Yi-Ran WU ; Bao-Lin WANG ; Xiao-Wei SU ; Qiu-Juan CHEN ; Yi RAO ; Shi-Lin YANG ; Li-Ni HUO ; Hong-Wei GAO
China Journal of Chinese Materia Medica 2025;50(12):3252-3266
Traditional Chinese medicine(TCM) capable of clearing heat and removing toxin is most commonly used in clinical practice and has the effect of removing fire-heat and toxin. Studies have shown that most of the Ilex plants have the effect of clearing heat and removing toxin, among which the varieties of I. cornuta, I. pubescens, I. rotunda, I. latifolia, and I. chinensis are most widely used. These plants generally contain triterpenoids and their glycosides, alkaloids, flavonoids, phenylpropanoids, and other chemical components, especially pentacyclic triterpenoids. According to their skeletons, pentacyclic triterpenoids can be divided into the oleanane type, the ursane type, the lupinane type, etc. Among them, ursane-type components are the most abundant, and 136 species have been found so far. These components have been proved to have pharmacological effects such as anti-inflammatory, anti-tumor, hypolipidemic, anti-thrombosis, cardiomyocyte-protective, antibacterial, and hepatoprotective effects. Therefore, this paper systematically reviews the domestic and foreign literature on Ilex plants with a focus on the research progress on pentacyclic triterpenoids and their pharmacological activities, aiming to provide reference for the development of TCM resources with the effect of clearing heat and removing toxin.
Ilex/chemistry*
;
Plants, Medicinal/chemistry*
;
Pentacyclic Triterpenes/pharmacology*
;
Medicine, Chinese Traditional
;
Drugs, Chinese Herbal/pharmacology*
;
Humans
;
Animals
3.Clinical characteristics and genetic analysis of maturity-onset diabetes of the young type 2 diagnosed in childhood.
Juan YE ; Feng YE ; Ling HOU ; Wei WU ; Xiao-Ping LUO ; Yan LIANG
Chinese Journal of Contemporary Pediatrics 2025;27(1):94-100
OBJECTIVES:
To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice.
METHODS:
A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023.
RESULTS:
All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported.
CONCLUSIONS
This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans
;
Diabetes Mellitus, Type 2/diagnosis*
;
Male
;
Female
;
Child
;
Retrospective Studies
;
Glucokinase/genetics*
;
Adolescent
;
Child, Preschool
;
Glucose Tolerance Test
4.Clinical Characteristics of Adult Acute Myeloid Leukemia Patients with NUP98::HOXA9 Fusion Gene.
Hai-Xia CAO ; Ya-Min WU ; Shu-Juan WANG ; Zhi-Dan CHEN ; Jing-Han HU ; Xiao-Qian GENG ; Fang WANG ; Ling SUN ; Zhong-Xing JIANG ; Zhi-Lei BIAN
Journal of Experimental Hematology 2025;33(5):1241-1247
OBJECTIVE:
To investigate the clinical characteristics, treatment and prognosis of adult AML patients with NUP98::HOXA9 fusion gene.
METHODS:
From May 2017 to October 2023, among 2 113 AML patients who visited the Hematology Department of our hospital, patients with NUP98 rearrangements were screened. The clinical characteristics, chromosome karyotypes, immunophenotypes, gene mutations, treatment efficacy and prognosis of the patients with NUP98::HOXA9 positive were analyzed.
RESULTS:
Among the 2 113 AML patients, there were 18 cases with NUP98 rearrangement, including 14 NUP98::HOXA9 positive cases, with a detection rate of 0.66% (14/2 113). The median age of the NUP98::HOXA9 positive patients was 42.5 (23-64) years old. The most common chromosome karyotype was t(7; 11)(p15; p15). The immunophenotypes of all patients expressed CD13, CD33, CD117 and CD38, and most patients expressed CD34 and cMPO, while only a few expressed HLA-DR. Second-generation sequencing (NGS) was performed to detect genetic mutations associated with leukemia in all 14 patients, and the genes exhibiting a high frequency of mutation were WT1 (10/14), TET2 (7/14), and FLT3-ITD (6/14). Additionally, mutations were also observed in KRAS/NRAS, IDH1, and KIT. Of the 13 patients who received treatment, 9 achieved complete remission (CR), and all 3 patients who received azacytidine(AZA)+ venetoclax (VEN) regimen achieved CR after the first course of treatment. Within this cohort, 6 patients were classified as relapsed/refractory (6/13). 4 patients underwent allogeneic hematopoietic stem cell transplantation (allo-HSCT), of which two achieved long-term survival. The median follow-up time was 12 (2.1-65.0) months, while the median overall survival (OS) and relapse-free survival (RFS) were recorded as 11.4 months and 9.6 months, respectively.
CONCLUSION
The most common type of NUP98 rearrangement in adults AML patients is NUP98::HOXA9 , which is often accompanied by somatic mutations in WT1, TET2, and FLT3-ITD. These patients are prone to relapse, have short survival time, and generally face poor prognoses. Hopefully, utilization of the AZA+VEN regimen is anticipated to enhance the rate of induced remission in the patients, and some patients may prolong their survival through allo-HSCT. However, more effective treatment methods are still needed to improve the overall prognosis of these patients.
Humans
;
Adult
;
Leukemia, Myeloid, Acute/genetics*
;
Middle Aged
;
Prognosis
;
Nuclear Pore Complex Proteins/genetics*
;
Oncogene Proteins, Fusion/genetics*
;
Mutation
;
Male
;
Female
;
Young Adult
;
Homeodomain Proteins/genetics*
5.Effectiveness of Xuanshen Yishen Decoction on Intensive Blood Pressure Control: Emulation of a Randomized Target Trial Using Real-World Data.
Xiao-Jie WANG ; Yuan-Long HU ; Jia-Ming HUAN ; Shi-Bing LIANG ; Lai-Yun XIN ; Feng JIANG ; Zhen HUA ; Zhen-Yuan WANG ; Ling-Hui KONG ; Qi-Biao WU ; Yun-Lun LI
Chinese journal of integrative medicine 2025;31(8):677-684
OBJECTIVE:
To investigate the effectiveness of Xuanshen Yishen Decoction (XYD) in the treatment of hypertension.
METHODS:
Hospital electronic medical records from 2019-2023 were utilized to emulate a randomized pragmatic clinical trial. Hypertensive participants were eligible if they were aged ⩾40 years with baseline systolic blood pressure (BP) ⩾140 mm Hg. Patients treated with XYD plus antihypertensive regimen were assigned to the treatment group, whereas those who followed only antihypertensive regimen were assigned to the control group. The primary outcome assessed was the attainment rate of intensive BP control at discharge, with the secondary outcome focusing on the 6-month all-cause readmission rate.
RESULTS:
The study included 3,302 patients, comprising 2,943 individuals in the control group and 359 in the treatment group. Compared with the control group, a higher proportion in the treatment group achieved the target BP for intensive BP control [8.09% vs. 17.5%; odds ratio (OR)=2.29, 95% confidence interval (CI)=1.68 to 3.13; P<0.001], particularly in individuals with high homocysteine levels (OR=3.13; 95% CI=1.72 to 5.71; P<0.001; P for interaction=0.041). Furthermore, the 6-month all-cause readmission rate in the treatment group was lower than in the control group (hazard ratio=0.58; 95% CI=0.36 to 0.91; P=0.019), and the robustness of the results was confirmed by sensitivity analyse.
CONCLUSIONS
XYD could be a complementary therapy for intensive BP control. Our study offers real-world evidence and guides the choice of complementary and alternative therapies. (Registration No. ChiCTR2400086589).
Adult
;
Aged
;
Female
;
Humans
;
Male
;
Middle Aged
;
Antihypertensive Agents/pharmacology*
;
Blood Pressure/drug effects*
;
Drugs, Chinese Herbal/pharmacology*
;
Hypertension/physiopathology*
;
Patient Readmission
;
Treatment Outcome
6.A practice guideline for therapeutic drug monitoring of mycophenolic acid for solid organ transplants.
Shuang LIU ; Hongsheng CHEN ; Zaiwei SONG ; Qi GUO ; Xianglin ZHANG ; Bingyi SHI ; Suodi ZHAI ; Lingli ZHANG ; Liyan MIAO ; Liyan CUI ; Xiao CHEN ; Yalin DONG ; Weihong GE ; Xiaofei HOU ; Ling JIANG ; Long LIU ; Lihong LIU ; Maobai LIU ; Tao LIN ; Xiaoyang LU ; Lulin MA ; Changxi WANG ; Jianyong WU ; Wei WANG ; Zhuo WANG ; Ting XU ; Wujun XUE ; Bikui ZHANG ; Guanren ZHAO ; Jun ZHANG ; Limei ZHAO ; Qingchun ZHAO ; Xiaojian ZHANG ; Yi ZHANG ; Yu ZHANG ; Rongsheng ZHAO
Journal of Zhejiang University. Science. B 2025;26(9):897-914
Mycophenolic acid (MPA), the active moiety of both mycophenolate mofetil (MMF) and enteric-coated mycophenolate sodium (EC-MPS), serves as a primary immunosuppressant for maintaining solid organ transplants. Therapeutic drug monitoring (TDM) enhances treatment outcomes through tailored approaches. This study aimed to develop an evidence-based guideline for MPA TDM, facilitating its rational application in clinical settings. The guideline plan was drawn from the Institute of Medicine and World Health Organization (WHO) guidelines. Using the Delphi method, clinical questions and outcome indicators were generated. Systematic reviews, Grading of Recommendations Assessment, Development, and Evaluation (GRADE) evidence quality evaluations, expert opinions, and patient values guided evidence-based suggestions for the guideline. External reviews further refined the recommendations. The guideline for the TDM of MPA (IPGRP-2020CN099) consists of four sections and 16 recommendations encompassing target populations, monitoring strategies, dosage regimens, and influencing factors. High-risk populations, timing of TDM, area under the curve (AUC) versus trough concentration (C0), target concentration ranges, monitoring frequency, and analytical methods are addressed. Formulation-specific recommendations, initial dosage regimens, populations with unique considerations, pharmacokinetic-informed dosing, body weight factors, pharmacogenetics, and drug-drug interactions are covered. The evidence-based guideline offers a comprehensive recommendation for solid organ transplant recipients undergoing MPA therapy, promoting standardization of MPA TDM, and enhancing treatment efficacy and safety.
Mycophenolic Acid/administration & dosage*
;
Drug Monitoring/methods*
;
Humans
;
Organ Transplantation
;
Immunosuppressive Agents/administration & dosage*
;
Delphi Technique
7.A novel anti-ischemic stroke candidate drug AAPB with dual effects of neuroprotection and cerebral blood flow improvement.
Jianbing WU ; Duorui JI ; Weijie JIAO ; Jian JIA ; Jiayi ZHU ; Taijun HANG ; Xijing CHEN ; Yang DING ; Yuwen XU ; Xinglong CHANG ; Liang LI ; Qiu LIU ; Yumei CAO ; Yan ZHONG ; Xia SUN ; Qingming GUO ; Tuanjie WANG ; Zhenzhong WANG ; Ya LING ; Wei XIAO ; Zhangjian HUANG ; Yihua ZHANG
Acta Pharmaceutica Sinica B 2025;15(2):1070-1083
Ischemic stroke (IS) is a globally life-threatening disease. Presently, few therapeutic medicines are available for treating IS, and rt-PA is the only drug approved by the US Food and Drug Administration (FDA) in the US. In fact, many agents showing excellent neuroprotection but no blood flow-improving activity in animals have not achieved ideal clinical efficacy, while thrombolytic drugs only improving blood flow without neuroprotection have limited their wider application. To address these challenges and meet the huge unmet clinical need, we have designed and identified a novel compound AAPB with dual effects of neuroprotection and cerebral blood flow improvement. AAPB significantly reduced cerebral infarction and neural function deficit in tMCAO rats, pMCAO rats, and IS rhesus monkeys, as well as displayed exceptional safety profiles and excellent pharmacokinetic properties in rats and dogs. AAPB has now entered phase I of clinical trials fighting IS in China.
8.Oxymatrine, a novel TLR2 agonist, promotes megakaryopoiesis and thrombopoiesis through the STING/NF-κB pathway.
Chengyang NI ; Ling ZHOU ; Shuo YANG ; Mei RAN ; Jiesi LUO ; Kui CHENG ; Feihong HUANG ; Xiaoqin TANG ; Xiang XIE ; Dalian QIN ; Qibing MEI ; Long WANG ; Juan XIAO ; Jianming WU
Journal of Pharmaceutical Analysis 2025;15(1):101054-101054
Radiation-induced thrombocytopenia (RIT) faces a perplexing challenge in the clinical treatment of cancer patients, and current therapeutic approaches are inadequate in the clinical settings. In this research, oxymatrine, a new molecule capable of healing RIT was screened out, and the underlying regulatory mechanism associated with magakaryocyte (MK) differentiation and thrombopoiesis was demonstrated. The capacity of oxymatrine to induce MK differentiation was verified in K-562 and Meg-01 cells in vitro. The ability to induce thrombopoiesis was subsequently demonstrated in Tg (cd41:enhanced green fluorescent protein (eGFP)) zebrafish and RIT model mice. In addition, we carried out network pharmacological prediction, drug affinity responsive target stability assay (DARTS) and cellular thermal shift assay (CETSA) analyses to explore the potential targets of oxymatrine. Moreover, the pathway underlying the effects of oxymatrine was determined by Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analyses, Western blot (WB), and immunofluorescence. Oxymatrine markedly promoted MK differentiation and maturation in vitro. Moreover, oxymatrine induced thrombopoiesis in Tg (cd41:eGFP) zebrafish and accelerated thrombopoiesis and platelet function recovery in RIT model mice. Mechanistically, oxymatrine directly binds to toll-like receptor 2 (TLR2) and further regulates the downstream pathway stimulator of interferon genes (STING)/nuclear factor-kappaB (NF-κB), which can be blocked by C29 and C-176, which are specific inhibitors of TLR2 and STING, respectively. Taken together, we demonstrated that oxymatrine, a novel TLR2 agonist, plays a critical role in accelerating MK differentiation and thrombopoiesis via the STING/NF-κB axis, suggesting that oxymatrine is a promising candidate for RIT therapy.
9.Antidepressant mechanism of Xiaoyaosan: A perspective from energy metabolism of the brain and intestine.
Meng-Ting XIAO ; Sen-Yan WANG ; Xiao-Ling WU ; Zi-Yu ZHAO ; Hui-Min WANG ; Hui-Min LIU ; Xue-Mei QIN ; Xiao-Jie LIU
Journal of Integrative Medicine 2025;23(6):706-720
OBJECTIVE:
This study investigated the antidepression mechanisms of Xiaoyaosan (XYS), a classic Chinese prescription, from the perspective of energy metabolism in the brain and intestinal tissues.
METHODS:
Chronic unpredictable mild stress model-a classic depression rat model-was established. Effects of XYS on behaviors and gastrointestinal motility of depressed rats were investigated. Effects of XYS on energetic charge (EC), adenosine triphosphate-related enzymes, and key enzymes of energy metabolism in both hippocampus and jejunum tissues of depressed rats were investigated using high-performance liquid chromatography, biochemical analysis, and real-time quantitative polymerase chain reaction, respectively. Spearman correlation analysis was conducted to construct a correlation network of "behavior-brain energy metabolism-intestinal energy metabolism" of depression.
RESULTS:
XYS significantly reduced the abnormal behaviors that observed in depressed rats and increased the EC and the activity of Na+-K+-adenosine triphosphatase (ATPase) and Ca2+-Mg2+-ATPase in hippocampus and jejunum tissues of depressed rats. XYS restored the key energetic pathways that had been interrupted by depression, including glycolysis, tricarboxylic acid cycle, and oxidative phosphorylation. Furthermore, XYS exhibited antidepressive effects in terms of regulating energy metabolism in tissues of both brain and intestine.
CONCLUSION
XYS significantly corrected the disturbances in EC and energy metabolism-related enzymes of both brain and intestinal tissues, alleviating both core and concomitant symptoms of depression. The current findings underscore the role of energy metabolism in the antidepressive activity of XYS, providing a fresh perspective on depression, and novel research strategies for revealing the mechanism of actions of traditional Chinese medicines on multi-site and multi-symptom diseases. Please cite this article as: Xiao MT, Wang SY, Wu XL, Zhao ZY, Wang HM, Liu HM, Qin XM, Liu XJ. Antidepressant mechanism of Xiaoyaosan: A perspective from energy metabolism of the brain and intestine. J Integr Med. 2025; 23(6):706-720.
Animals
;
Energy Metabolism/drug effects*
;
Antidepressive Agents/therapeutic use*
;
Drugs, Chinese Herbal/therapeutic use*
;
Brain/drug effects*
;
Male
;
Depression/metabolism*
;
Rats
;
Rats, Sprague-Dawley
;
Intestines/drug effects*
;
Hippocampus/drug effects*
10.Inflammatory Bowel Disease and Dementia: Evidence Triangulation from a Meta-Analysis of Observational Studies and Mendelian Randomization Study.
Di LIU ; Mei Ling CAO ; Shan Shan WU ; Bing Li LI ; Yi Wen JIANG ; Teng Fei LIN ; Fu Xiao LI ; Wei Jie CAO ; Jin Qiu YUAN ; Feng SHA ; Zhi Rong YANG ; Jin Ling TANG
Biomedical and Environmental Sciences 2025;38(1):56-66
OBJECTIVE:
Observational studies have found associations between inflammatory bowel disease (IBD) and the risk of dementia, including Alzheimer's dementia (AD) and vascular dementia (VD); however, these findings are inconsistent. It remains unclear whether these associations are causal.
METHODS:
We conducted a meta-analysis by systematically searching for observational studies on the association between IBD and dementia. Mendelian randomization (MR) analysis based on summary genome-wide association studies (GWASs) was performed. Genetic correlation and Bayesian co-localization analyses were used to provide robust genetic evidence.
RESULTS:
Ten observational studies involving 80,565,688 participants were included in this meta-analysis. IBD was significantly associated with dementia (risk ratio [ RR] =1.36, 95% CI = 1.04-1.78; I 2 = 84.8%) and VD ( RR = 2.60, 95% CI = 1.18-5.70; only one study), but not with AD ( RR = 2.00, 95% CI = 0.96-4.13; I 2 = 99.8%). MR analyses did not supported significant causal associations of IBD with dementia (dementia: odds ratio [ OR] = 1.01, 95% CI = 0.98-1.03; AD: OR = 0.98, 95% CI = 0.95-1.01; VD: OR = 1.02, 95% CI = 0.97-1.07). In addition, genetic correlation and co-localization analyses did not reveal any genetic associations between IBD and dementia.
CONCLUSION
Our study did not provide genetic evidence for a causal association between IBD and dementia risk. The increased risk of dementia observed in observational studies may be attributed to unobserved confounding factors or detection bias.
Humans
;
Mendelian Randomization Analysis
;
Inflammatory Bowel Diseases/complications*
;
Dementia/etiology*
;
Observational Studies as Topic
;
Genome-Wide Association Study

Result Analysis
Print
Save
E-mail