This study aimed to explore the effects and mechanisms of total extracts from Anthriscus sylvestris on pulmonary hypertension in rats. Sixty male SD rats were divided into normal(NC) group, model(M) group, positive drug sildenafil(Y) group, low-dose A. sylvestris(ES-L) group, medium-dose A. sylvestris(ES-M) group, and high-dose A. sylvestris(ES-H) group. On day 1, rats were intraperitoneally injected with monocrotaline(60 mg·kg~(-1)) to induce pulmonary hypertension, and the rat model was established on day 28. From days 15 to 28, intragastric administration of the respective treatments was performed. After modeling and treatment, small animal echocardiography was used to detect the right heart function of the rats. Arterial blood gas was measured using a blood gas analyzer. Hematoxylin and eosin(HE) staining and Masson staining were performed to observe cardiopulmonary pathological damage. Flow cytometry was used to detect apoptosis in the lung and myocardial tissues and reactive oxygen species(ROS) levels. Western blot was applied to detect the expression levels of transforming growth factor-β1(TGF-β1), phosphorylated mothers against decapentaplegic homolog 3(p-Smad3), Smad3, tissue plasminogen activator(t-PA), and plasminogen activator inhibitor-1(PAI-1) in lung tissue. A blood routine analyzer was used to measure inflammatory immune cell levels in the blood. Enzyme-linked immunosorbent assay(ELISA) was used to detect the expression levels of P-selectin and thromboxane A2(TXA2) in plasma. The results showed that, compared with the NC group, right heart hypertrophy index, right ventricular free wall thickness, right heart internal diameter, partial carbon dioxide pressure(PaCO_2), apoptosis in cardiopulmonary tissue, and ROS levels were significantly increased in the M group. In contrast, the ratio of pulmonary blood flow acceleration time(PAT)/ejection time(PET), right cardiac output, change rate of right ventricular systolic area, systolic displacement of the tricuspid ring, oxygen partial pressure(PaO_2), and blood oxygen saturation(SaO_2) were significantly decreased in the M group. After administration of the total extract of A. sylvestris, right heart function and blood gas levels were significantly improved, while apoptosis in cardiopulmonary tissue and ROS levels significantly decreased. Further testing revealed that the total extract of A. sylvestris significantly decreased the levels of interleukin-1β(IL-1β), interleukin-6(IL-6), and PAI-1 proteins in lung tissue, while increasing the expression of t-PA. Additionally, the extract reduced the levels of inflammatory cells such as leukocytes, lymphocytes, granulocytes, and monocytes in the blood, as well as the levels of P-selectin and TXA2 in plasma. Metabolomics results showed that the total extract of A. sylvestris significantly affected metabolic pathways, including arginine biosynthesis, tyrosine metabolism, and taurine and hypotaurine metabolism. In conclusion, the total extract of A. sylvestris may exert an anti-pulmonary hypertension effect by inhibiting the TGF-β1/Smad3 signaling pathway, thereby alleviating immune-inflammatory responses and thrombosis.
Animals ; Male ; Smad3 Protein/metabolism* ; Transforming Growth Factor beta1/metabolism* ; Rats, Sprague-Dawley ; Rats ; Signal Transduction/drug effects* ; Hypertension, Pulmonary/genetics* ; Thrombosis/immunology* ; Drugs, Chinese Herbal/administration & dosage* ; Humans ; Apoptosis/drug effects*

Traditional Chinese medicine(TCM) capable of clearing heat and removing toxin is most commonly used in clinical practice and has the effect of removing fire-heat and toxin. Studies have shown that most of the Ilex plants have the effect of clearing heat and removing toxin, among which the varieties of I. cornuta, I. pubescens, I. rotunda, I. latifolia, and I. chinensis are most widely used. These plants generally contain triterpenoids and their glycosides, alkaloids, flavonoids, phenylpropanoids, and other chemical components, especially pentacyclic triterpenoids. According to their skeletons, pentacyclic triterpenoids can be divided into the oleanane type, the ursane type, the lupinane type, etc. Among them, ursane-type components are the most abundant, and 136 species have been found so far. These components have been proved to have pharmacological effects such as anti-inflammatory, anti-tumor, hypolipidemic, anti-thrombosis, cardiomyocyte-protective, antibacterial, and hepatoprotective effects. Therefore, this paper systematically reviews the domestic and foreign literature on Ilex plants with a focus on the research progress on pentacyclic triterpenoids and their pharmacological activities, aiming to provide reference for the development of TCM resources with the effect of clearing heat and removing toxin.
Ilex/chemistry* ; Plants, Medicinal/chemistry* ; Pentacyclic Triterpenes/pharmacology* ; Medicine, Chinese Traditional ; Drugs, Chinese Herbal/pharmacology* ; Humans ; Animals

Medical institutions, with their clinical practice foundation and abundant human use experience data, have become important carriers for the inheritance and innovation of traditional Chinese medicine(TCM) and the "cradles" of the preparation of new TCM. To effectively promote the transformation of new TCM originating from the TCM clinical practice in medical institutions and establish an effective evaluation index system for the transformation of new TCM conforming to the characteristics of TCM, consensus experts adopted the literature research, questionnaire survey, Delphi method, etc. By focusing on the policy and technical evaluation of new TCM originating from the TCM clinical practice in medical institutions, a comprehensive evaluation from the dimensions of drug safety, efficacy, feasibility, and characteristic advantages was conducted, thus forming a comprehensive evaluation system with four primary indicators and 37 secondary indicators. The expert consensus reached aims to encourage medical institutions at all levels to continuously improve the high-quality research and development and transformation of new TCM originating from the TCM clinical practice in medical institutions and targeted at clinical needs, so as to provide a decision-making basis for the preparation, selection, cultivation, and transformation of new TCM for medical institutions, improve the development efficiency of new TCM, and precisely respond to the public medication needs.
Medicine, Chinese Traditional/standards* ; Humans ; Consensus ; Drugs, Chinese Herbal/therapeutic use* ; Surveys and Questionnaires

The antidepressant activity and molecular mechanisms of Yueju Wan volatile oil were investigated. The Yueju Wan volatile oil was extracted by using supercritical CO_2. Gas chromatography-mass spectrometry(GC-MS) combined with network pharmacology identified 28 chemical constituents in Yueju Wan volatile oil, primarily terpenes and lactones. A total of 123 overlapping targets were associated with depression, including core targets of interleukin-1β(IL-1β), signal transducer and activator of transcription 3(STAT3), and caspase-3(CASP3). These targets were mainly involved in the prolactin, advanced glycation end products/receptor(AGE/RAGE), and phosphoinositide 3-kinase/protein kinase B(PI3K/Akt) signaling pathways. A reserpine-induced depression mouse model was established to evaluate the therapeutic effects and mechanisms of Yueju Wan volatile oil. The effects of Yueju Wan volatile oil on depression-like behavior in mice were evaluated by analyzing body mass, body temperature index, tail suspension immobility time, forced swimming immobility time, and sucrose preference. Hematoxylin-eosin(HE) staining revealed neuronal protection of Yueju Wan volatile oil in the brain of mice. Enzyme-linked immunosorbent assay(ELISA) and Western blot were employed to detect the protein expression of AGEs, IL-1β, phosphorylated PI3K(p-PI3K), Akt, phosphorylated Akt(p-Akt), nuclear factor κB(NF-κB), and brain-derived neurotrophic factor(BDNF). Behavioral evaluation showed that Yueju Wan volatile oil could effectively control the decline of body mass and body temperature of depressed mice, reduce tail suspension and swimming immobility time, and enhance their preference for sucrose. Histopathological examination showed that Yueju Wan volatile oil could alleviate the neuronal damage in CA1 and dentate gyrus(DG) of the hippocampus of mice. ELISA and Western blot results showed that Yueju Wan volatile oil could significantly increase the protein expression levels of PI3K, Akt, and BDNF and significantly decrease the protein expression levels of AGEs, IL-1β, p-PI3K, p-Akt, and NF-κB in the hippocampus of mice. Furthermore, the p-PI3K/PI3K and p-Akt/Akt ratios were significantly decreased at medium and high doses. These findings suggest that the aromatherapy of Yueju Wan volatile oil can significantly improve reserpine-induced depression-like behavior in mice, which may be related to reducing the expression of neuronal membrane protein AGEs, reducing the phosphorylation levels of PI3K and Akt, inhibiting NF-κB entry into the nucleus, and alleviating the release of pro-inflammatory factors and nerve injury.
Animals ; Antidepressive Agents/chemistry* ; Mice ; Proto-Oncogene Proteins c-akt/immunology* ; Phosphatidylinositol 3-Kinases/immunology* ; Oils, Volatile/chemistry* ; Male ; Drugs, Chinese Herbal/chemistry* ; Signal Transduction/drug effects* ; Depression/metabolism* ; Glycation End Products, Advanced/immunology* ; Humans

Fritillariae Cirrhosae Bulbus is the dried bulb of perennial herbaceous plants in the Fritillaria genus(Liliaceae family) and is a representative traditional Chinese medicinal material with distinctive regional characteristics. Clinically, it is widely used in the treatment of dry cough, bronchial asthma, and other respiratory diseases, possessing significant medicinal and economic value and being highly esteemed in TCM. Currently, Fritillariae Cirrhosae Bulbus primarily relies on wild harvesting. However, due to excessive collection, its wild resources have drastically declined, and all source species have been classified as category Ⅱ in the List of National Key Protected Wild Plants, exacerbating the supply-demand imbalance in the market. To mitigate this issue, large-scale cultivation through the domestication of wild Fritillariae Cirrhosae Bulbus has become an inevitable trend. However, its strict environmental requirements, low propagation efficiency, high seedling mortality, and immature cultivation techniques have severely hindered industrialization. This study investigates the domestication process of Fritillariae Cirrhosae Bulbus, focusing on seed propagation, seedling cultivation, and medicinal material production. It also reviews the species and distribution of wild resources, their endangered status, market supply-demand dynamics, and the historical and current development of domestication. The findings indicate that enhancing propagation efficiency, optimizing cultivation models, and distinguishing between seed propagation and medicinal material production are key measures to accelerate the industrialization of domesticated Fritillariae Cirrhosae Bulbus. This research aims to promote the industrialization of Fritillariae Cirrhosae Bulbus domestication and provide a reference model for the conservation and sustainable utilization of rare and endangered medicinal plant resources.
Fritillaria/chemistry* ; Endangered Species ; Plants, Medicinal/growth & development* ; Drugs, Chinese Herbal/economics* ; China

OBJECTIVE: To compare the short-term clinical efficacy and safety of closed reduction with Kirschner wire fixation versus open reduction with plate fixation for treating osteoporotic Colles' fractures in middle-aged and elderly patients. METHODS: Between January 2018 and January 2023, 119 patients with Colles fractures were retrospectively analyzed, including 39 males and 80 females, aged from 48 to 74 years old with an average of(60.58±6.71) years old. The time from injury to operation ranged 1 to 13 days with an average of (5.29±2.52) days. According to the surgical method, they were divided into Kirschner wire fixation group (Kirschner wire group) and plate internal fixation group (plate group). In Kirschner wire group, there were a total of 68 patients, comprising 21 males and 47 females. The average age was (61.15±6.24) years old, ranged from 49 to 74 years old. Among them, 41 cases involved the left side while 27 cases involved the right side. In the plate group, there were a total of 51 patients, including 18 males and 33 females. The average age was (59.78±5.71) years old ranged from 48 to 72 years old. Among them, there were 31 cases on the left side and 20 cases on the right side. The following parameters were recorded before and after the operation:operation time, intraoperative blood loss, hospitalization days, hospitalization expenses, postoperative complications, and radiographic parameters of distal radius (distal radius height, ulnar deviation angle, palmar tilt angle). The clinical efficacy was evaluated at 3 and 12 months after the operation using Gartland-Werley and disabilites of the arm shoulder and hand (DASH) scores. RESULTS: The patients in both groups were followed up for a duration from 12 to 19 months with an average of(13.32±2.02) months. The Kirschner wire group exhibited significantly shorter operation time compared to the plate group 27.91(13.00, 42.00) min vs 67.52(29.72, 105.32) min, Z=-8.74, P=0.00. Intraoperative blood loss was also significantly lower in the Kirschner wire group than in the plate group 3.24(1.08, 5.40) ml vs 21.91(17.38, 26.44) ml, Z=-9.31, P=0.00. Furthermore, patients in the Kirschner wire group had a shorter length of hospital stay compared to those in the plate group (8.38±2.63) days vs (11.40±2.78) days, t=-3.12, P=0.00. Additionally, hospitalization cost was significantly lower in the Kirschner wire group than in the plate group 10 111.29(6 738.98, 13 483.60) yuan vs 15 871.11(11 690.40, 20 051.82) yuan, Z=-5.62, P=0.00. The incidence of complications was 2 cases in the Kirschner wire group and 1 case in the plate group, with no statistically significant difference(P>0.05). At 3 months postoprative, the radial height of the Kirschner wire group was found to be significantly smaller than that of the plate group, with measurements of (11.45±1.69) mm and (12.11±1.78) mm respectively (t=-2.06, P=0.04). However, there were no statistically significant differences observed in ulnar deviation angle and palmar tilt angle between the two groups (P>0.05). The DASH score and Gartland-Werley score in the Kirschner group were significantly higher than those in the plate group at 3 months post-operation (19.10±9.89) vs (13.47±3.51), t=4.34, P=0.00;(11.15±3.61) vs (6.41±2.75), t=8.13, P=0.00). However, there was no significant difference between the two groups at 12 months post-operation (P>0.05). CONCLUSION Compared to plate internal fixation, closed reduction with Kirschner wire support fixation yields a slightly inferior recovery of radial height;however, there is no significant disparity in the functional score of the affected limb at 12 months post-operation. Nonetheless, this technique offers advantages such as shorter operation time, reduced intraoperative blood loss, decreased hospitalization duration, and lower cost.
Humans ; Female ; Male ; Middle Aged ; Aged ; Fracture Fixation, Internal/instrumentation* ; Bone Wires ; Bone Plates ; Retrospective Studies ; Colles' Fracture/surgery* ; Minimally Invasive Surgical Procedures/methods* ; Open Fracture Reduction/methods* ; Osteoporotic Fractures/surgery*

OBJECTIVE: To explore the co-morbid influencing factors of postmenopausal osteoporosis(PMOP) and dyslipidemia, and to provide evidence-based basis for clinical co-morbidity management. METHODS: Based on the 2017 to 2018 Beijing community cross-sectional survey data, PMOP patients were included and divided into the dyslipidemia group and the uncomplicated dyslipidemia group according to whether they were comorbid with dyslipidemia. Demographic characteristics, living habits and disease history were collected through questionnaires, and bone mineral density and bone metabolism biomarkers (osteocalcin, blood calcium, serum typeⅠprocollagen N-terminal prepeptide, etc.) were detected on site. Co-morbidity risk factors were analyzed using binary logistic regression. RESULTS: Three hundred and twenty patients with PMOP were included, including the comorbid group (75 patients) and the uncomplicated group (245 patients). The results showed that history of cardiovascular disease [OR=1.801, 95%CI(1.003, 3.236), P=0.049], history of cerebrovascular disease [OR=2.923, 95%CI(1.460, 5.854), P=0.002], frying and cooking methods[OR=5.388, 95%CI(1.632, 17.793), P=0.006], OST results[OR=0.910, 95%CI(0.843, 0.983), P=0.016], and blood Ca results [OR=60.249, 95%CI(1.862, 1 949.926), P=0.021] were the influencing factors of PMOP complicated with dyslipidemia. CONCLUSION Focus should be placed on the influencing factors of PMOP and dyslipidemia co-morbidities, with emphasis on multidimensional assessment, combining lifestyle interventions with bone metabolism marker monitoring to optimize co-morbidity management.
Humans ; Dyslipidemias/epidemiology* ; Female ; Middle Aged ; Osteoporosis, Postmenopausal/metabolism* ; Aged ; Cross-Sectional Studies ; Risk Factors ; Bone Density

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVES: To investigate the underlying causes and clinical manifestations in infants undergoing colonoscopy, and to analyze changes in disease spectrum. METHODS: Clinical data from 180 infants who underwent a total of 184 colonoscopies at the Department of Gastroenterology, Children's Hospital Affiliated to Shandong University from January 2015 to December 2024 were retrospectively analyzed. Patients were grouped by age: ≤6 months (n=41) and >6-12 months (n=139); and by examination period: 2015-2019 (n=83) and 2020-2024 (n=97). Primary causes for performing colonoscopy, final diagnoses, and disease spectrum evolution were assessed. RESULTS: Among 184 colonoscopies, the leading causes prompting examination were hematochezia (37.8%, 68/180), diarrhea (36.7%, 66/180), and co-occurring hematochezia and diarrhea (21.1%, 38/180). Causes for performing colonoscopy differed significantly by age group (P<0.05). Colonic polyps were only detected in the >6-12 months group (P<0.05). Compared to the 2015-2019 group, the 2020-2024 group had fewer food allergy-related gastrointestinal diseases (P<0.05) but more colitis (P<0.05). CONCLUSIONS Colonoscopy is essential for diagnosing infantile digestive disorders, with disease spectra varying by age and time period.
Humans ; Infant ; Colonoscopy ; Male ; Female ; Retrospective Studies ; Infant, Newborn ; Diarrhea/etiology* ; Gastrointestinal Hemorrhage/etiology*

OBJECTIVES: To study the epidemiological characteristics of respiratory syncytial virus (RSV) infection in hospitalized children with community-acquired pneumonia (CAP) in Hebei Province. METHODS: Hospitalized children with CAP who tested positive for RSV and were admitted to Hebei Children's Hospital from various cities and counties across Hebei Province between January 2019 and December 2023 were included in the study. Clinical data were collected and analyzed to assess epidemiological characteristics. RESULTS: The clinical data of 43 978 children with CAP were collected, with an overall RSV detection rate of 25.98%. The detection rate was higher during the implementation of non-pharmaceutical interventions (NPIs) (30.60%) than in the non-NPIs period. Winter and spring were the primary epidemic seasons for RSV each year except in 2022. The detection rate in males (26.62%) was higher than in females (25.06%) (P<0.001). The highest detection rate (59.18%) was found in infants aged 29 days to <1 year. Single RSV infection was more common, with rhinovirus being the most frequent co-infection. CONCLUSIONS The overall RSV detection rate in Hebei Province is influenced by NPIs, being higher during their implementation. RSV predominantly circulates in winter and spring. The detection rate of RSV is higher in males and infants. RSV infection is primarily single, most often co-occurring with rhinovirus.
Humans ; Respiratory Syncytial Virus Infections/epidemiology* ; Female ; Male ; Infant ; Child, Preschool ; Seasons ; China/epidemiology* ; Infant, Newborn ; Community-Acquired Infections/epidemiology* ; Child