Nanoparticle delivery systems have good application prospects in the field of precision therapy, but the preparation process of nanomaterial has problems such as short in vivo circulation time, easy recognition, and clearance by the immune system in the body. In recent years, biomimetic nanoparticle delivery systems mediated by natural cell membranes have become a research hotspot to address these issues. The natural membrane biomimetic nanoparticle delivery system cleverly integrates the advantages of natural biofilm "autologous" and "artificial" functional carriers by using endogenous cell membranes to modify the surface of nanocarriers, endowing them with characteristics such as tumor targeting, low immunogenicity, and long blood circulation. Currently, biomimetic nanoparticle delivery systems have been used in the treatment of malignant tumors, cardiovascular diseases, bacterial infections, and other diseases. This paper analyzes the development status and current research hotspots of natural cell membrane camouflaged biomimetic nanoparticle delivery systems mainly reviews the latest research progress of red blood cell membrane camouflaged biomimetic nanoparticle delivery systems in the field of disease treatment in recent years. It focuses on exploring the advantages, future development prospects, and limitations of biomimetic nanoparticle delivery systems based on red blood cell membrane camouflage in improving drug delivery, to provide a reference for the in-depth research and development of this system.

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVE: To explore the clinical significance of circulating tumor DNA (ctDNA) in response evaluation and relapse monitoring for patients with primary mediastinal large B-cell lymphoma (PMBCL). METHODS: The clinical characteristics, efficacy and survival of 38 PMBCL patients in our hospital from January 2010 to April 2020 were retrospectively analyzed. The ctDNA monitoring was conducted by targeted next-generation sequencing (NGS). RESULTS: Among the 38 patients, 26 cases were female, and 32 cases were diagnosed with Ann Arbor stage I-II. The 5-year overall survival (OS) rate and progression-free survival (PFS) rate were 74.7% and 61.7%, respectively. Males and those with high aaIPI scores (3 points) had a relatively poor prognosis. The NGS results of 23 patients showed that STAT6 (65.2%), SOCS1 (56.5%), and TNFAIP3 (56.5%) were the most common mutated genes. Patients with stable disease (SD)/progressive disease (PD) exhibited enrichment in cell cycle, FoxO, and TNF signaling pathways. A total of 29 patients underwent end-of-treatment PET/CT (EOT PET/CT), and 16 of them received ctDNA monitoring with 12 negative. Among 6 patients with EOT PET/CT positive (Deauville 4), 4 underwent ctDNA monitoring, and 3 of them were negative, being still in continuous remission without any subsequent anti-tumor therapy. CONCLUSION CtDNA may be combined with PET/CT to assess efficacy, monitor relapse, and guide treatment of PMBCL.
Humans ; Circulating Tumor DNA/blood* ; Female ; Mediastinal Neoplasms ; Male ; Retrospective Studies ; High-Throughput Nucleotide Sequencing ; Prognosis ; Lymphoma, Large B-Cell, Diffuse/genetics* ; Middle Aged ; Adult ; Aged ; Neoplasm Recurrence, Local ; Mutation

[This corrects the article DOI: 10.11909/j.issn.1671-5411.2017.08.005.].

OBJECTIVE: To investigate the effectiveness of Xuanshen Yishen Decoction (XYD) in the treatment of hypertension. METHODS: Hospital electronic medical records from 2019-2023 were utilized to emulate a randomized pragmatic clinical trial. Hypertensive participants were eligible if they were aged ⩾40 years with baseline systolic blood pressure (BP) ⩾140 mm Hg. Patients treated with XYD plus antihypertensive regimen were assigned to the treatment group, whereas those who followed only antihypertensive regimen were assigned to the control group. The primary outcome assessed was the attainment rate of intensive BP control at discharge, with the secondary outcome focusing on the 6-month all-cause readmission rate. RESULTS: The study included 3,302 patients, comprising 2,943 individuals in the control group and 359 in the treatment group. Compared with the control group, a higher proportion in the treatment group achieved the target BP for intensive BP control [8.09% vs. 17.5%; odds ratio (OR)=2.29, 95% confidence interval (CI)=1.68 to 3.13; P<0.001], particularly in individuals with high homocysteine levels (OR=3.13; 95% CI=1.72 to 5.71; P<0.001; P for interaction=0.041). Furthermore, the 6-month all-cause readmission rate in the treatment group was lower than in the control group (hazard ratio=0.58; 95% CI=0.36 to 0.91; P=0.019), and the robustness of the results was confirmed by sensitivity analyse. CONCLUSIONS XYD could be a complementary therapy for intensive BP control. Our study offers real-world evidence and guides the choice of complementary and alternative therapies. (Registration No. ChiCTR2400086589).
Adult ; Aged ; Female ; Humans ; Male ; Middle Aged ; Antihypertensive Agents/pharmacology* ; Blood Pressure/drug effects* ; Drugs, Chinese Herbal/pharmacology* ; Hypertension/physiopathology* ; Patient Readmission ; Treatment Outcome

Ischemic stroke (IS) is a globally life-threatening disease. Presently, few therapeutic medicines are available for treating IS, and rt-PA is the only drug approved by the US Food and Drug Administration (FDA) in the US. In fact, many agents showing excellent neuroprotection but no blood flow-improving activity in animals have not achieved ideal clinical efficacy, while thrombolytic drugs only improving blood flow without neuroprotection have limited their wider application. To address these challenges and meet the huge unmet clinical need, we have designed and identified a novel compound AAPB with dual effects of neuroprotection and cerebral blood flow improvement. AAPB significantly reduced cerebral infarction and neural function deficit in tMCAO rats, pMCAO rats, and IS rhesus monkeys, as well as displayed exceptional safety profiles and excellent pharmacokinetic properties in rats and dogs. AAPB has now entered phase I of clinical trials fighting IS in China.

BACKGROUND: The use of inserted sham acupuncture as a placebo in randomized controlled trials (RCTs) is controversial, because it may produce specific effects that cause an underestimation of the effect of acupuncture treatment. OBJECTIVE: This systematic survey investigates the magnitude of insert-specific effects of sham acupuncture and whether they affect the estimation of acupuncture treatment effects. SEARCH STRATEGY: PubMed, Embase and Cochrane Central Register of Controlled Trials were searched to identify acupuncture RCTs from their inception until December 2022. INCLUSION CRITERIA: RCTs that evaluated the effects of acupuncture compared to sham acupuncture and no treatment. DATA EXTRACTION AND ANALYSIS: The total effect measured for an acupuncture treatment group in RCTs were divided into three components, including the natural history and/or regression to the mean effect (controlled for no-treatment group), the placebo effect, and the specific effect of acupuncture. The first two constituted the contextual effect of acupuncture, which is mimicked by a sham acupuncture treatment group. The proportion of acupuncture total effect size was considered to be 1. The proportion of natural history and/or regression to the mean effect (PNE) and proportional contextual effect (PCE) of included RCTs were pooled using meta-analyses with a random-effect model. The proportion of acupuncture placebo effect was the difference between PCE and PNE in RCTs with non-inserted sham acupuncture. The proportion of insert-specific effect of sham acupuncture (PIES) was obtained by subtracting the proportion of acupuncture placebo effect and PNE from PCE in RCTs with inserted sham acupuncture. The impact of PIES on the estimation of acupuncture's treatment effect was evaluated by quantifying the percentage of RCTs that the effect of outcome changed from no statistical difference to statistical difference after removing PIES in the included studies, and the impact of PIES was externally validated in other acupuncture RCTs with an inserted sham acupuncture group that were not used to calculate PIES. RESULTS: This analysis included 32 studies with 5492 patients. The overall PNE was 0.335 (95% confidence interval [CI], 0.255-0.415) and the PCE of acupuncture was 0.639 (95% CI, 0.567-0.710) of acupuncture's total effect. The proportional contribution of the placebo effect to acupuncture's total effect was 0.191, and the PIES was 0.189. When we modeled the exclusion of the insert-specific effect of sham acupuncture, the acupuncture treatment effect changed from no difference to a significant difference in 45.45% of the included RCTs, and in 40.91% of the external validated RCTs. CONCLUSION The insert-specific effect of sham acupuncture in RCTs represents 18.90% of acupuncture's total effect and significantly affects the evaluation of the acupuncture treatment effect. More than 40% of RCTs that used inserted sham acupuncture would draw different conclusions if the PIES had been controlled for. Considering the impact of the insert-specific effect of sham acupuncture, caution should be taken when using inserted sham acupuncture placebos in RCTs. Please cite this article as: Luo XC, Liu JL, Yao MH, Chen YM, Fan AY, Liang FR, Zhao JP, Zhao L, Zhou X, Zhong XY, Yang JH, Li B, Zhang Y, Sun X, Li L. Specific effect of inserted sham acupuncture and its impact on the estimation of acupuncture treatment effect in randomized controlled trials: A systematic survey. J Integr Med. 2025; 23(6):630-640.
Acupuncture Therapy/methods* ; Humans ; Randomized Controlled Trials as Topic ; Placebo Effect ; Placebos ; Treatment Outcome

2-(4-Methylthiazol-5-yl) ethyl nitrate hydrochloride (W1302) is a nitro containing derivative of clomethiazole, which is a novel neuroprotective agent with both carbon monoxide (NO) donor and weak γ-aminobutyric acid type A (GABA_A) receptor allosteric regulatory excitatory effect. The current study used a rat model of transient middle cerebral arteryocclusion (tMCAO) brain injury to evaluate the therapeutic effect of W1302 on ischemic stroke and explore its potential mechanisms of action. This experiment has been reviewed and approved by the Laboratory Animal Management and Use Committee of the Institute of Materia Medica, Chinese Academy of Medical Sciences (ethical review forms No. 620, 632, 5013). The results showed that gavage administration of 1, 3, and 10 mg·kg^-1 of W1302 can significantly reduce the volume of cerebral infarction in rats with ischemia for 2 h and reperfusion for 24 h, and the therapeutic effect was better than that of 200 mg·kg^-1 of DL-3n-butylphthalide. W1302 significantly increased NO levels in blood and brain tissue. It increased cerebral blood flow and brain adenosine triphosphate (ATP) content after reperfusion, as well as, inhibited the expressions of inflammatory factors tumor necrosis factor-α (TNF-α) and interleukin-1β (IL-1β) in brain tissue. The time window of W1302 was between 120-180 min after ischemia. These research results demonstrated that W1302 could increase NO release, dilate blood vessels, and increase cerebral blood flow, improve energy supply to brain tissue and increase ATP levels, and inhibit neuro-inflammation, which playing the protective roles in tMCAO stroke model rats. This provides theoretical support for the clinical application of W1302 in the treatment of ischemic stroke.

Objective To investigate the efficacies of proximal femoral nail anti-rotation(PFNA)internal fixation in traction bed supine position and non-traction bed lateral position in the treatment of elderly unstable femoral intertrochanteric fractures.Methods The clinical data of patients with unstable femoral intertrochanteric fractures treated with PFNA internal fixation in our hospital were retrospec-tively analyzed,41 patients received treatment in traction bed supine position were included in the supine position group,and 55 patients treated received treatment in non-traction bed lateral position were included in the lateral position group.The perioperative related indicators,surgical reduction,hip Harris score,and incidence of complications in the two groups were analyzed.Results The operation time and incision length of patients in the lateral position group were shorter than those in the supine position group,and the intraoperative blood loss and fluoroscopy times were less than those in the supine position group,with statistically significant differences(P<0.05).There was no significant difference in the anesthesia mode,blood transfusion or hospital stay of patients between the two groups(P>0.05).There was no significant difference in the incidence of postoperative complications of patients between the two groups(P>0.05).There was no significant difference in neck-shaft angle,tip-apex distance or hip Harris score of patients between the two groups(P>0.05).Conclusion PFNA internal fixation in traction bed supine position and non-traction bed lateral position have the same effect in the treatment of elderly unstable femoral intertrochanteric fractures,while the non-traction bed lateral position for treatment has more advantages in shortening operation time,decreasing intraoperative blood loss,and reducing radiation exposure.

[Objective] To explore the value of the TyG index for predicting postoperative recurrence in persistent atrial fibrillation (AF) patients combined with on-alcoholic fatty liver disease (NAFLD) undergoing catheter ablation. [Methods] This study was a single-center, retrospective, cohort study. Clinical data of patients who underwent catheter ablation during hospitalization or outpatient visits at The First Affiliated Hospital of Xi’an Jiaotong University from January 2021 to December 2022 were retrospectively collected. The patients were divided into recurrence and non-recurrence groups based on whether AF recurred within 1 year after the procedure. General clinical data and relevant laboratory test results were collected, and the preoperative TyG index was calculated. The risk factors for AF recurrence after catheter ablation in these patients were analyzed using univariate and multivariate COX proportional hazards regression models. The value of the TyG index for predicting AF recurrence was assessed using receiver operating characteristic (ROC) curve analysis. [Results] We recruited 167 patients, among whom 103 were males and 64 were females. The mean follow-up time was 12±1.3 months, with 52 cases of AF recurrence and 115 ones of non-recurrence. Compared with the non-recurrence group, the TyG index was higher in the recurrence group (9.62±0.96 vs. 8.26±0.46, P<0.05). Multivariate COX regression analysis showed that the preoperative TyG index (HR=1.35, 95% CI: 1.10-1.60, P<0.05) and postoperative electrocardiogram P-wave dispersion (HR=1.51, 95% CI: 1.32-1.70, P<0.001) were risk factors for AF recurrence after catheter ablation in persistent AF patients with NAFLD. The ROC curve analysis showed that the area under the curve (AUC) for the TyG index in predicting AF recurrence after catheter ablation in these patients was 0.846 (95% CI: 0.773-0.919, P<0.001). [Conclusion] The TyG index is an effective indicator for predicting atrial fibrillation recurrence after catheter ablation in persistent AF patients combined with NAFLD.