Objective This study reports on the obligatory parasitism of water mites Arrenurus sp. on Anopheles messeae at the Manzhouli Port, Inner Mongolia, China. Methods Duing July 2024, a survey on the mosquito diversity was conducted at the Manzhouli Port. Captured mosquitoes and their ectoparasites were identified to species level. Results A total of 1840 adult mosquitoes were collected, representing species from three genera: Culex(Cx. modestus, Cx. pipiens pallens), Aedes(Ae. dorsalis, Ae. flavidorsalis, Ae. flavescens), and Anopheles (An. messeae). Among all the mosqutioes specimens,3 out of 150 captured An. messeae were found to carry ectoparasitic mites, with number of 2,4,27 mites separately. Morphological and molecular identification reached the same result as water mites(Hydrachnidiae, Hydracrina). COI gene sequence showed 94% similarity with the closest species Arrenurus truncatellus. Conlusions Literature review suggests water mites are host-specific parasitism of mosquito species and herein with the first record of Arrenurus sp. parasiting on An. Messeae in the most high-latitude region globally.

ObjectiveTo observe the clinical effectiveness and safety of Dingchan Granule （定颤颗粒） for paroxysmal atrial fibrillation with syndrome of qi stagnation and blood stasis. MethodsUsing a randomised， double-blind， placebo controlled study method， 90 patients with paroxysmal atrial fibrillation with qi stagnation and blood stasis syndrome were divided into 45 cases each in the treatment group and the control group. Both groups were given conventional western medicine treatment， and the treatment group was additionally treated with Dingchan Granule， while the control group was treated with Dingchan Granule placebo， both of which were taken orally for 8 g each time twice a day. Both groups were treated for 8 weeks. We compared the clinical effectiveness， the improvement of traditional Chinese medicine （TCM） symptoms and the recovery rate of atrial fibrillation between the two groups. We compared the number and duration of atrial fibrillation episodes， TCM symptoms score， atrial fibrillation symptom classification， 24-hour average ventricular rate， Pittsburgh Sleep Quality Index （PSQI）， anxiety index， depression index before and after treatment， and evaluated the safety of the two groups. ResultsThe total clinical effectiveness rate in the treatment group was 82.22% （37/45）， which was better than 60.00% （27/45） in the control group （P＜0.05）. The total effective rate of TCM syndrome effectiveness in the treatment group was 88.89% （40/45）， which was better than 66.67% （30/45） in the control group （P＜0.05）； and the rate of atrial fibrillation regression in the treatment group was 26.67% （12/45）， better than 6.67% （3/45） in the control group （P＜0.05）. The number and duration of atrial fibrillation episodes in both groups were significantly decreased （P＜0.01）， and the number and duration of atrial fibrillation episodes in the treatment group were lower than those in the control group （P＜0.01）. The TCM syndrome scores of both groups after treatment were significantly lower than before treatment （P＜0.01）， and the scores of the treatment group was lower than those of the control group （P＜0.05）. The severity of atrial fibrillation symptoms and the grading of atrial fibrillation symptoms in both groups after treatment were improved （P＜0.01）， and the degree of symptom improvement in the treatment group was better than that in the control group （P＜0.01）. The 24-hour average ventricular rate of both groups after treatment was significantly lower （P＜0.01）. The PSQI， anxiety index and depression index of the treatment group were all lower than before treatment （P＜0.01）， while the PSQI and anxiety index of the control group were both lower than before treatment （P＜0.01 or P＜0.05）， the PSQI， anxiety index and depression index of the treatment group being lower than those of the control group （P＜0.05 or P＜0.01）. No adverse events occurred in both groups， and no abnormalities were observed in blood， urine， stool routine， liver and kidney function， and coagulation function indexes. ConclusionDingchan Granule for paroxysmal atrial fibrillation with qi stagnation and blood stasis syndrome can alleviate clinical symptom， improve TCM symptom scores， increase atrial fibrillation recovery rate， stabilise the average ventricular rate， and significantly improve the quality of sleep， alleviate the anxiety and depression， with a good safety profile.

OBJECTIVE: Observational studies have found associations between inflammatory bowel disease (IBD) and the risk of dementia, including Alzheimer's dementia (AD) and vascular dementia (VD); however, these findings are inconsistent. It remains unclear whether these associations are causal. METHODS: We conducted a meta-analysis by systematically searching for observational studies on the association between IBD and dementia. Mendelian randomization (MR) analysis based on summary genome-wide association studies (GWASs) was performed. Genetic correlation and Bayesian co-localization analyses were used to provide robust genetic evidence. RESULTS: Ten observational studies involving 80,565,688 participants were included in this meta-analysis. IBD was significantly associated with dementia (risk ratio [ RR] =1.36, 95% CI = 1.04-1.78; I ² = 84.8%) and VD ( RR = 2.60, 95% CI = 1.18-5.70; only one study), but not with AD ( RR = 2.00, 95% CI = 0.96-4.13; I ² = 99.8%). MR analyses did not supported significant causal associations of IBD with dementia (dementia: odds ratio [ OR] = 1.01, 95% CI = 0.98-1.03; AD: OR = 0.98, 95% CI = 0.95-1.01; VD: OR = 1.02, 95% CI = 0.97-1.07). In addition, genetic correlation and co-localization analyses did not reveal any genetic associations between IBD and dementia. CONCLUSION Our study did not provide genetic evidence for a causal association between IBD and dementia risk. The increased risk of dementia observed in observational studies may be attributed to unobserved confounding factors or detection bias.
Humans ; Mendelian Randomization Analysis ; Inflammatory Bowel Diseases/complications* ; Dementia/etiology* ; Observational Studies as Topic ; Genome-Wide Association Study

OBJECTIVE: To determine the prevalence of lumbar spondylolysis (LS) and the proportion of spondylolytic spondylolisthesis (SS) in China, and to evaluate the musculoskeletal status of patients with LS and SS. METHODS: Spine Computed Tomography (CT) images were collected from community populations aged 40 and above in a nationwide multi-center project. LS was diagnosed, and SS was graded by an experienced radiologist. Bone mineral density (BMD) and paraspinal muscle parameters were quantified based on CT images. RESULTS: One hundred and seventeen patients of a total of 3,317 individuals were diagnosed with LS, corresponding to a prevalence rate of 3.53%. 63 of the 1,214 males (5.18%) and 54 of the 2,103 females (2.57%) were diagnosed with LS. SS occurred in 64/121 vertebrae (52.89%). BMD was not associated with LS ( P = 0.341). The L5 extensor paraspinal muscle density was higher in the LS group than in the non-LS group. In the LS group, patients with SS had a smaller L5 paraspinal extensor muscle cross-sectional area than those without SS ( P = 0.003). CONCLUSION The prevalence of LS in Chinese adults was 3.53%, with prevalence rates of 5.18% in males and 2.57% in females. Patients with LS have higher muscle density, whereas those with SS have smaller muscle cross-sectional areas at the L5 level.
Humans ; Male ; Female ; Middle Aged ; China/epidemiology* ; Prevalence ; Adult ; Lumbar Vertebrae/diagnostic imaging* ; Spondylolysis/diagnostic imaging* ; Aged ; Bone Density ; Tomography, X-Ray Computed ; Aged, 80 and over ; Spondylolisthesis/epidemiology* ; East Asian People

Objective To compare the application effects of plankton multiplex polymerase chain reac-tion-capillary electrophoresis(PCR-CE),SYBR Green Ⅰ real-time quantitative PCR(qPCR)and microwave digestion-vacuum filtration-automated scanning electron microscopy(MD-VF-Auto SEM)in the diagnosis of drowning.Methods Lung,liver and kidney tissues from 212 drowned corpses and 30 non-drowned corpses were examined respectively by the three drowning-related plankton testing methods,and the detection rates of plankton in each tissue by three methods were compared.Results In drowned corpses,the total detection rates of PCR-CE,qPCR,and MD-VF-Auto SEM were 93.9%,96.2%,and 95.3%,respectively,with no statistically significant difference(P>0.05).The detection rate of lung tissue by MD-VF-Auto SEM(100%)was higher than those of PCR-CE and qPCR(P<0.05),and there was no significant difference in the detection rates of the three methods in liver or kidney tissues(P>0.05).In non-drowning corpses,a small number of diatoms(less than 10 cells/10 g)were detected by MD-VF-Auto SEM method,only in liver and kidney tissues,while the other two methods yielded negative results for all tissues.Conclusion All three methods have good efficacy in the examination of drowned corpses.The MD-VF-Auto SEM method directly observes diatom morpho-logical characteristics through scanning electron microscopy,and the qualitative and quantitative analy-ses are intuitive and accurate.It has great advantages in the examination of difficult degradation samples.The PCR-CE method and qPCR method have a low sample demand(0.5 g),are easy to operate and have short detection time(4-7 h).They are easy to be applied in the grassroots depart-ments and are suitable for the rapid determination of drowned corpses in routin cases.The combina-tion of the two DNA methods with the MD-VF-Auto SEM method can increase the detection rate of plankton,ensuring the reliability of examination results.This combined use is of significant importance in the application of drowning diagnosis.

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVES: To study the epidemiological characteristics of respiratory syncytial virus (RSV) infection in hospitalized children with community-acquired pneumonia (CAP) in Hebei Province. METHODS: Hospitalized children with CAP who tested positive for RSV and were admitted to Hebei Children's Hospital from various cities and counties across Hebei Province between January 2019 and December 2023 were included in the study. Clinical data were collected and analyzed to assess epidemiological characteristics. RESULTS: The clinical data of 43 978 children with CAP were collected, with an overall RSV detection rate of 25.98%. The detection rate was higher during the implementation of non-pharmaceutical interventions (NPIs) (30.60%) than in the non-NPIs period. Winter and spring were the primary epidemic seasons for RSV each year except in 2022. The detection rate in males (26.62%) was higher than in females (25.06%) (P<0.001). The highest detection rate (59.18%) was found in infants aged 29 days to <1 year. Single RSV infection was more common, with rhinovirus being the most frequent co-infection. CONCLUSIONS The overall RSV detection rate in Hebei Province is influenced by NPIs, being higher during their implementation. RSV predominantly circulates in winter and spring. The detection rate of RSV is higher in males and infants. RSV infection is primarily single, most often co-occurring with rhinovirus.
Humans ; Respiratory Syncytial Virus Infections/epidemiology* ; Female ; Male ; Infant ; Child, Preschool ; Seasons ; China/epidemiology* ; Infant, Newborn ; Community-Acquired Infections/epidemiology* ; Child

Medical institutions, with their clinical practice foundation and abundant human use experience data, have become important carriers for the inheritance and innovation of traditional Chinese medicine(TCM) and the "cradles" of the preparation of new TCM. To effectively promote the transformation of new TCM originating from the TCM clinical practice in medical institutions and establish an effective evaluation index system for the transformation of new TCM conforming to the characteristics of TCM, consensus experts adopted the literature research, questionnaire survey, Delphi method, etc. By focusing on the policy and technical evaluation of new TCM originating from the TCM clinical practice in medical institutions, a comprehensive evaluation from the dimensions of drug safety, efficacy, feasibility, and characteristic advantages was conducted, thus forming a comprehensive evaluation system with four primary indicators and 37 secondary indicators. The expert consensus reached aims to encourage medical institutions at all levels to continuously improve the high-quality research and development and transformation of new TCM originating from the TCM clinical practice in medical institutions and targeted at clinical needs, so as to provide a decision-making basis for the preparation, selection, cultivation, and transformation of new TCM for medical institutions, improve the development efficiency of new TCM, and precisely respond to the public medication needs.
Medicine, Chinese Traditional/standards* ; Humans ; Consensus ; Drugs, Chinese Herbal/therapeutic use* ; Surveys and Questionnaires

The antidepressant activity and molecular mechanisms of Yueju Wan volatile oil were investigated. The Yueju Wan volatile oil was extracted by using supercritical CO_2. Gas chromatography-mass spectrometry(GC-MS) combined with network pharmacology identified 28 chemical constituents in Yueju Wan volatile oil, primarily terpenes and lactones. A total of 123 overlapping targets were associated with depression, including core targets of interleukin-1β(IL-1β), signal transducer and activator of transcription 3(STAT3), and caspase-3(CASP3). These targets were mainly involved in the prolactin, advanced glycation end products/receptor(AGE/RAGE), and phosphoinositide 3-kinase/protein kinase B(PI3K/Akt) signaling pathways. A reserpine-induced depression mouse model was established to evaluate the therapeutic effects and mechanisms of Yueju Wan volatile oil. The effects of Yueju Wan volatile oil on depression-like behavior in mice were evaluated by analyzing body mass, body temperature index, tail suspension immobility time, forced swimming immobility time, and sucrose preference. Hematoxylin-eosin(HE) staining revealed neuronal protection of Yueju Wan volatile oil in the brain of mice. Enzyme-linked immunosorbent assay(ELISA) and Western blot were employed to detect the protein expression of AGEs, IL-1β, phosphorylated PI3K(p-PI3K), Akt, phosphorylated Akt(p-Akt), nuclear factor κB(NF-κB), and brain-derived neurotrophic factor(BDNF). Behavioral evaluation showed that Yueju Wan volatile oil could effectively control the decline of body mass and body temperature of depressed mice, reduce tail suspension and swimming immobility time, and enhance their preference for sucrose. Histopathological examination showed that Yueju Wan volatile oil could alleviate the neuronal damage in CA1 and dentate gyrus(DG) of the hippocampus of mice. ELISA and Western blot results showed that Yueju Wan volatile oil could significantly increase the protein expression levels of PI3K, Akt, and BDNF and significantly decrease the protein expression levels of AGEs, IL-1β, p-PI3K, p-Akt, and NF-κB in the hippocampus of mice. Furthermore, the p-PI3K/PI3K and p-Akt/Akt ratios were significantly decreased at medium and high doses. These findings suggest that the aromatherapy of Yueju Wan volatile oil can significantly improve reserpine-induced depression-like behavior in mice, which may be related to reducing the expression of neuronal membrane protein AGEs, reducing the phosphorylation levels of PI3K and Akt, inhibiting NF-κB entry into the nucleus, and alleviating the release of pro-inflammatory factors and nerve injury.
Animals ; Antidepressive Agents/chemistry* ; Mice ; Proto-Oncogene Proteins c-akt/immunology* ; Phosphatidylinositol 3-Kinases/immunology* ; Oils, Volatile/chemistry* ; Male ; Drugs, Chinese Herbal/chemistry* ; Signal Transduction/drug effects* ; Depression/metabolism* ; Glycation End Products, Advanced/immunology* ; Humans

[This corrects the article DOI: 10.11909/j.issn.1671-5411.2017.08.005.].