Abelmoschi Corolla, the dried corolla of Abelmoschus manihot, has anti-inflammatory, antioxidant, and anti-fibrosis activities. Its chemical constituents mainly include flavonoids, organic acids, steroids, and polysaccharides. This study reviewed the research progress in the chemical constituents and pharmacological activities of Abelmoschi Corolla in recent 20 years. According to the concept of quality marker(Q-marker), the Q-markers of Abelmoschi Corolla were predicted from plant phylogeny, chemical constituent specificity, traditional efficacy, chemical constituent measurability, and absorbed constituents. The primary Q-markers for Abelmoschi Corolla were anticipated to include quercetin-3'-O-β-D-glucopyranoside, gossypetin-8-O-β-D-glucuronide, isoquercetin, myricetin,quercetin, and hyperoside, with the aim of providing reference data for improving the quality evaluation system of Abelmoschi Corolla.
Abelmoschus/chemistry* ; Drugs, Chinese Herbal/pharmacology* ; Flowers/chemistry* ; Humans ; Animals ; Quality Control ; Flavonoids/chemistry*

This study aimed to explore the effects and mechanisms of total extracts from Anthriscus sylvestris on pulmonary hypertension in rats. Sixty male SD rats were divided into normal(NC) group, model(M) group, positive drug sildenafil(Y) group, low-dose A. sylvestris(ES-L) group, medium-dose A. sylvestris(ES-M) group, and high-dose A. sylvestris(ES-H) group. On day 1, rats were intraperitoneally injected with monocrotaline(60 mg·kg~(-1)) to induce pulmonary hypertension, and the rat model was established on day 28. From days 15 to 28, intragastric administration of the respective treatments was performed. After modeling and treatment, small animal echocardiography was used to detect the right heart function of the rats. Arterial blood gas was measured using a blood gas analyzer. Hematoxylin and eosin(HE) staining and Masson staining were performed to observe cardiopulmonary pathological damage. Flow cytometry was used to detect apoptosis in the lung and myocardial tissues and reactive oxygen species(ROS) levels. Western blot was applied to detect the expression levels of transforming growth factor-β1(TGF-β1), phosphorylated mothers against decapentaplegic homolog 3(p-Smad3), Smad3, tissue plasminogen activator(t-PA), and plasminogen activator inhibitor-1(PAI-1) in lung tissue. A blood routine analyzer was used to measure inflammatory immune cell levels in the blood. Enzyme-linked immunosorbent assay(ELISA) was used to detect the expression levels of P-selectin and thromboxane A2(TXA2) in plasma. The results showed that, compared with the NC group, right heart hypertrophy index, right ventricular free wall thickness, right heart internal diameter, partial carbon dioxide pressure(PaCO_2), apoptosis in cardiopulmonary tissue, and ROS levels were significantly increased in the M group. In contrast, the ratio of pulmonary blood flow acceleration time(PAT)/ejection time(PET), right cardiac output, change rate of right ventricular systolic area, systolic displacement of the tricuspid ring, oxygen partial pressure(PaO_2), and blood oxygen saturation(SaO_2) were significantly decreased in the M group. After administration of the total extract of A. sylvestris, right heart function and blood gas levels were significantly improved, while apoptosis in cardiopulmonary tissue and ROS levels significantly decreased. Further testing revealed that the total extract of A. sylvestris significantly decreased the levels of interleukin-1β(IL-1β), interleukin-6(IL-6), and PAI-1 proteins in lung tissue, while increasing the expression of t-PA. Additionally, the extract reduced the levels of inflammatory cells such as leukocytes, lymphocytes, granulocytes, and monocytes in the blood, as well as the levels of P-selectin and TXA2 in plasma. Metabolomics results showed that the total extract of A. sylvestris significantly affected metabolic pathways, including arginine biosynthesis, tyrosine metabolism, and taurine and hypotaurine metabolism. In conclusion, the total extract of A. sylvestris may exert an anti-pulmonary hypertension effect by inhibiting the TGF-β1/Smad3 signaling pathway, thereby alleviating immune-inflammatory responses and thrombosis.
Animals ; Male ; Smad3 Protein/metabolism* ; Transforming Growth Factor beta1/metabolism* ; Rats, Sprague-Dawley ; Rats ; Signal Transduction/drug effects* ; Hypertension, Pulmonary/genetics* ; Thrombosis/immunology* ; Drugs, Chinese Herbal/administration & dosage* ; Humans ; Apoptosis/drug effects*

Medical institutions, with their clinical practice foundation and abundant human use experience data, have become important carriers for the inheritance and innovation of traditional Chinese medicine(TCM) and the "cradles" of the preparation of new TCM. To effectively promote the transformation of new TCM originating from the TCM clinical practice in medical institutions and establish an effective evaluation index system for the transformation of new TCM conforming to the characteristics of TCM, consensus experts adopted the literature research, questionnaire survey, Delphi method, etc. By focusing on the policy and technical evaluation of new TCM originating from the TCM clinical practice in medical institutions, a comprehensive evaluation from the dimensions of drug safety, efficacy, feasibility, and characteristic advantages was conducted, thus forming a comprehensive evaluation system with four primary indicators and 37 secondary indicators. The expert consensus reached aims to encourage medical institutions at all levels to continuously improve the high-quality research and development and transformation of new TCM originating from the TCM clinical practice in medical institutions and targeted at clinical needs, so as to provide a decision-making basis for the preparation, selection, cultivation, and transformation of new TCM for medical institutions, improve the development efficiency of new TCM, and precisely respond to the public medication needs.
Medicine, Chinese Traditional/standards* ; Humans ; Consensus ; Drugs, Chinese Herbal/therapeutic use* ; Surveys and Questionnaires

The antidepressant activity and molecular mechanisms of Yueju Wan volatile oil were investigated. The Yueju Wan volatile oil was extracted by using supercritical CO_2. Gas chromatography-mass spectrometry(GC-MS) combined with network pharmacology identified 28 chemical constituents in Yueju Wan volatile oil, primarily terpenes and lactones. A total of 123 overlapping targets were associated with depression, including core targets of interleukin-1β(IL-1β), signal transducer and activator of transcription 3(STAT3), and caspase-3(CASP3). These targets were mainly involved in the prolactin, advanced glycation end products/receptor(AGE/RAGE), and phosphoinositide 3-kinase/protein kinase B(PI3K/Akt) signaling pathways. A reserpine-induced depression mouse model was established to evaluate the therapeutic effects and mechanisms of Yueju Wan volatile oil. The effects of Yueju Wan volatile oil on depression-like behavior in mice were evaluated by analyzing body mass, body temperature index, tail suspension immobility time, forced swimming immobility time, and sucrose preference. Hematoxylin-eosin(HE) staining revealed neuronal protection of Yueju Wan volatile oil in the brain of mice. Enzyme-linked immunosorbent assay(ELISA) and Western blot were employed to detect the protein expression of AGEs, IL-1β, phosphorylated PI3K(p-PI3K), Akt, phosphorylated Akt(p-Akt), nuclear factor κB(NF-κB), and brain-derived neurotrophic factor(BDNF). Behavioral evaluation showed that Yueju Wan volatile oil could effectively control the decline of body mass and body temperature of depressed mice, reduce tail suspension and swimming immobility time, and enhance their preference for sucrose. Histopathological examination showed that Yueju Wan volatile oil could alleviate the neuronal damage in CA1 and dentate gyrus(DG) of the hippocampus of mice. ELISA and Western blot results showed that Yueju Wan volatile oil could significantly increase the protein expression levels of PI3K, Akt, and BDNF and significantly decrease the protein expression levels of AGEs, IL-1β, p-PI3K, p-Akt, and NF-κB in the hippocampus of mice. Furthermore, the p-PI3K/PI3K and p-Akt/Akt ratios were significantly decreased at medium and high doses. These findings suggest that the aromatherapy of Yueju Wan volatile oil can significantly improve reserpine-induced depression-like behavior in mice, which may be related to reducing the expression of neuronal membrane protein AGEs, reducing the phosphorylation levels of PI3K and Akt, inhibiting NF-κB entry into the nucleus, and alleviating the release of pro-inflammatory factors and nerve injury.
Animals ; Antidepressive Agents/chemistry* ; Mice ; Proto-Oncogene Proteins c-akt/immunology* ; Phosphatidylinositol 3-Kinases/immunology* ; Oils, Volatile/chemistry* ; Male ; Drugs, Chinese Herbal/chemistry* ; Signal Transduction/drug effects* ; Depression/metabolism* ; Glycation End Products, Advanced/immunology* ; Humans

OBJECTIVE: Observational studies have found associations between inflammatory bowel disease (IBD) and the risk of dementia, including Alzheimer's dementia (AD) and vascular dementia (VD); however, these findings are inconsistent. It remains unclear whether these associations are causal. METHODS: We conducted a meta-analysis by systematically searching for observational studies on the association between IBD and dementia. Mendelian randomization (MR) analysis based on summary genome-wide association studies (GWASs) was performed. Genetic correlation and Bayesian co-localization analyses were used to provide robust genetic evidence. RESULTS: Ten observational studies involving 80,565,688 participants were included in this meta-analysis. IBD was significantly associated with dementia (risk ratio [ RR] =1.36, 95% CI = 1.04-1.78; I ² = 84.8%) and VD ( RR = 2.60, 95% CI = 1.18-5.70; only one study), but not with AD ( RR = 2.00, 95% CI = 0.96-4.13; I ² = 99.8%). MR analyses did not supported significant causal associations of IBD with dementia (dementia: odds ratio [ OR] = 1.01, 95% CI = 0.98-1.03; AD: OR = 0.98, 95% CI = 0.95-1.01; VD: OR = 1.02, 95% CI = 0.97-1.07). In addition, genetic correlation and co-localization analyses did not reveal any genetic associations between IBD and dementia. CONCLUSION Our study did not provide genetic evidence for a causal association between IBD and dementia risk. The increased risk of dementia observed in observational studies may be attributed to unobserved confounding factors or detection bias.
Humans ; Mendelian Randomization Analysis ; Inflammatory Bowel Diseases/complications* ; Dementia/etiology* ; Observational Studies as Topic ; Genome-Wide Association Study

OBJECTIVE: To determine the prevalence of lumbar spondylolysis (LS) and the proportion of spondylolytic spondylolisthesis (SS) in China, and to evaluate the musculoskeletal status of patients with LS and SS. METHODS: Spine Computed Tomography (CT) images were collected from community populations aged 40 and above in a nationwide multi-center project. LS was diagnosed, and SS was graded by an experienced radiologist. Bone mineral density (BMD) and paraspinal muscle parameters were quantified based on CT images. RESULTS: One hundred and seventeen patients of a total of 3,317 individuals were diagnosed with LS, corresponding to a prevalence rate of 3.53%. 63 of the 1,214 males (5.18%) and 54 of the 2,103 females (2.57%) were diagnosed with LS. SS occurred in 64/121 vertebrae (52.89%). BMD was not associated with LS ( P = 0.341). The L5 extensor paraspinal muscle density was higher in the LS group than in the non-LS group. In the LS group, patients with SS had a smaller L5 paraspinal extensor muscle cross-sectional area than those without SS ( P = 0.003). CONCLUSION The prevalence of LS in Chinese adults was 3.53%, with prevalence rates of 5.18% in males and 2.57% in females. Patients with LS have higher muscle density, whereas those with SS have smaller muscle cross-sectional areas at the L5 level.
Humans ; Male ; Female ; Middle Aged ; China/epidemiology* ; Prevalence ; Adult ; Lumbar Vertebrae/diagnostic imaging* ; Spondylolysis/diagnostic imaging* ; Aged ; Bone Density ; Tomography, X-Ray Computed ; Aged, 80 and over ; Spondylolisthesis/epidemiology* ; East Asian People

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVES: To study the epidemiological characteristics of respiratory syncytial virus (RSV) infection in hospitalized children with community-acquired pneumonia (CAP) in Hebei Province. METHODS: Hospitalized children with CAP who tested positive for RSV and were admitted to Hebei Children's Hospital from various cities and counties across Hebei Province between January 2019 and December 2023 were included in the study. Clinical data were collected and analyzed to assess epidemiological characteristics. RESULTS: The clinical data of 43 978 children with CAP were collected, with an overall RSV detection rate of 25.98%. The detection rate was higher during the implementation of non-pharmaceutical interventions (NPIs) (30.60%) than in the non-NPIs period. Winter and spring were the primary epidemic seasons for RSV each year except in 2022. The detection rate in males (26.62%) was higher than in females (25.06%) (P<0.001). The highest detection rate (59.18%) was found in infants aged 29 days to <1 year. Single RSV infection was more common, with rhinovirus being the most frequent co-infection. CONCLUSIONS The overall RSV detection rate in Hebei Province is influenced by NPIs, being higher during their implementation. RSV predominantly circulates in winter and spring. The detection rate of RSV is higher in males and infants. RSV infection is primarily single, most often co-occurring with rhinovirus.
Humans ; Respiratory Syncytial Virus Infections/epidemiology* ; Female ; Male ; Infant ; Child, Preschool ; Seasons ; China/epidemiology* ; Infant, Newborn ; Community-Acquired Infections/epidemiology* ; Child

[This corrects the article DOI: 10.11909/j.issn.1671-5411.2017.08.005.].

OBJECTIVE: To investigate the effectiveness of Xuanshen Yishen Decoction (XYD) in the treatment of hypertension. METHODS: Hospital electronic medical records from 2019-2023 were utilized to emulate a randomized pragmatic clinical trial. Hypertensive participants were eligible if they were aged ⩾40 years with baseline systolic blood pressure (BP) ⩾140 mm Hg. Patients treated with XYD plus antihypertensive regimen were assigned to the treatment group, whereas those who followed only antihypertensive regimen were assigned to the control group. The primary outcome assessed was the attainment rate of intensive BP control at discharge, with the secondary outcome focusing on the 6-month all-cause readmission rate. RESULTS: The study included 3,302 patients, comprising 2,943 individuals in the control group and 359 in the treatment group. Compared with the control group, a higher proportion in the treatment group achieved the target BP for intensive BP control [8.09% vs. 17.5%; odds ratio (OR)=2.29, 95% confidence interval (CI)=1.68 to 3.13; P<0.001], particularly in individuals with high homocysteine levels (OR=3.13; 95% CI=1.72 to 5.71; P<0.001; P for interaction=0.041). Furthermore, the 6-month all-cause readmission rate in the treatment group was lower than in the control group (hazard ratio=0.58; 95% CI=0.36 to 0.91; P=0.019), and the robustness of the results was confirmed by sensitivity analyse. CONCLUSIONS XYD could be a complementary therapy for intensive BP control. Our study offers real-world evidence and guides the choice of complementary and alternative therapies. (Registration No. ChiCTR2400086589).
Adult ; Aged ; Female ; Humans ; Male ; Middle Aged ; Antihypertensive Agents/pharmacology* ; Blood Pressure/drug effects* ; Drugs, Chinese Herbal/pharmacology* ; Hypertension/physiopathology* ; Patient Readmission ; Treatment Outcome