The medicinal materials of Bawei Chenxiang Pills(BCPs) were extracted via three methods: reflux extraction by water, reflux extraction by 70% ethanol, and extraction by pure water following reflux extraction by 70% ethanol, yielding three extracts of ST, CT, and CST. The efficacy of ST(760 mg·kg~(-1)), CT(620 mg·kg~(-1)), and CST(1 040 mg·kg~(-1)) were evaluated by acute myocardial ischemia(AMI) and p-chlorophenylalanine(PCPA)-induced insomnia in mice, respectively. Western blot was further utilized to investigate their hypnosis mechanisms. The main chemical components of different extracts were identified by the UPLC-Q-Exactive-MS technique. The results showed that CT and CST significantly increased the ejection fraction(EF) and fractional shortening(FS) of myocardial infarction mice, reduced left ventricular internal dimension at end-diastole(LVIDd) and left ventricular internal dimension at end-systole(LVIDs). In contrast, ST did not exhibit significant effects on these parameters. In the insomnia model, CT significantly reduced sleep latency and prolonged sleep duration, whereas ST only prolonged sleep duration without shortening sleep latency. CST showed no significant effects on either sleep latency or sleep duration. Additionally, both CT and ST upregulated glutamic acid decarboxylase 67(GAD67) protein expression in brain tissue. A total of 15 main chemical components were identified from CT, including 2-(2-phenylethyl) chromone and 6-methoxy-2-(2-phenylethyl) chromone. Six chemical components including chebulidic acid were identified from ST. The results suggested that chromones and terpenes were potential anti-myocardial ischemia drugs of BCPs, and tannin and phenolic acids were potential hypnosis drugs. This study enriches the pharmacological and chemical research of BCPs, providing a basis and reference for their secondary development, quality standard improvement, and clinical application.
Animals ; Drugs, Chinese Herbal/isolation & purification* ; Mice ; Male ; Sleep Initiation and Maintenance Disorders/physiopathology* ; Humans ; Myocardial Infarction/drug therapy* ; Myocardial Ischemia/drug therapy*

OBJECTIVE: To investigate the variability of bone metabolism levels among different populations and its association with knee osteoarthritis (KOA) pain. METHODS: A total of 50 people (control group) who participated in physical examination from January 2023 to June 2023 were selected, including 26 males and 24 females, wtih a mean aged of (52.14±9.04) years old ranging 41 to 65 years old. The other 50 patients with knee osteoarthritis(case group) who attended the outpatient clinic of the Orthopedics and Traumatology Department in the same time period, including 19 males and 31 females, with a mean age of (53.60±7.76) years old ranging 40 to 65 years. The two groups of Western Ontario and McMaster Universities Osteoarthritis Index(WOMAC) and bone metabolism markers, such as 25-hydroxy-cholecalciferol[25(OH)D], β-isomerized typeⅠcollagen C-telopeptide breakdown products (β-CTX), total typeⅠprocollagen N-terminal propeptide (t-PINP), osteocalcin (OC), parathormone (PTH) levels were compared. Pearson correlation analysis was used to compare the correlation between two groups of bone metabolism related markers and WOMAC. RESULTS: The WOMAC score of the case group (39.90±2.34) was higher than that of the control group (3.60±0.57), with significant difference (P<0.05). There was no significant difference between the two groups of 25 (OH)D, β-CTX and PTH (P>0.05). The t-PINP and OC of the case group were (62.90±52.40) and (19.88±10.15) ng·ml-1, respectively, and those of the control group were (38.86±10.82) and (14.90±3.62) ng·ml^-1, respectively;the t-PINP and OC of the case group were higher than those of the control group, with significant difference (P<0.05). Pearson correlation analysis showed that t-PINP was positively correlated with WOMAC pain score in the case group (r²=0.045, P<0.01). CONCLUSION Bone metabolism levels in the serum of patients with knee osteoarthritis are different from those of healthy people, and the difference between OC and t-PINP is the most obvious, and the concentration of t-PINP levels is positively correlated with pain symptoms in patients with KOA. However, the specific mechanism of correlation between the bone metabolism levels of patients with KOA and their pain symptoms needs to be further elucidated by basic experimental research as well as by enlarging the samples.
Humans ; Female ; Male ; Middle Aged ; Osteoarthritis, Knee/metabolism* ; Aged ; Adult ; Bone and Bones/metabolism* ; Pain/etiology* ; Biomarkers/metabolism*

PURPOSE: To methodically assess the effectiveness of augmentative plating (AP) and exchange nailing (EN) in managing nonunion following intramedullary nailing for long bone fractures of the lower extremity. METHODS: PubMed, EMBASE, Web of Science, and the Cochrane Library were searched to gather clinical studies regarding the use of AP and EN techniques in the treatment of nonunion following intramedullary nailing of lower extremity long bones. The search was conducted up until May 2023. The original studies underwent an independent assessment of their quality, a process conducted utilizing the Newcastle-Ottawa scale. Data were retrieved from these studies, and meta-analysis was executed utilizing Review Manager 5.3. RESULTS: This meta-analysis included 8 studies involving 661 participants, with 305 in the AP group and 356 in the EN group. The results of the meta-analysis demonstrated that the AP group exhibited a higher rate of union (odds ratio: 8.61, 95% confidence intervals (CI): 4.12 - 17.99, p < 0.001), shorter union time (standardized mean difference (SMD): -1.08, 95% CI: -1.79 - -0.37, p = 0.003), reduced duration of the surgical procedure (SMD: -0.56, 95% CI: -0.93 - -0.19, p = 0.003), less bleeding (SMD: -1.5, 95% CI: -2.81 - -0.18, p = 0.03), and a lower incidence of complications (relative risk: -0.17, 95% CI: -0.27 - -0.06, p = 0.001). In the subgroup analysis, the time for union in the AP group in nonisthmal and isthmal nonunion of lower extremity long bones was shorter compared to the EN group (nonisthmal SMD: -1.94, 95% CI: -3.28 - -0.61, p < 0.001; isthmal SMD: -1.08, 95% CI: -1.64 - -0.52, p = 0.002). CONCLUSION In the treatment of nonunion in diaphyseal fractures of the long bones in the lower extremity, the AP approach is superior to EN, both intraoperatively (with reduced duration of the surgical procedure and diminished blood loss) and postoperatively (with an elevated union rate, shorter union time, and lower incidence of complications). Specifically, in the management of nonunion of lower extremity long bones with non-isthmal and isthmal intramedullary nails, AP demonstrated shorter union time in comparison to EN.
Humans ; Bone Nails/adverse effects* ; Bone Plates/adverse effects* ; Femoral Fractures/surgery* ; Fracture Fixation, Intramedullary/methods* ; Fractures, Ununited/surgery* ; Lower Extremity/injuries*

PURPOSE: We carried out the study aiming to explore and analyze the risk factors, the distribution of pathogenic bacteria, and their antibiotic-resistance characteristics influencing the occurrence of surgical site infection (SSI), to provide valuable assistance for reducing the incidence of SSI after traumatic fracture surgery. METHODS: A retrospective case-control study enrolling 3978 participants from January 2015 to December 2019 receiving surgical treatment for traumatic fractures was conducted at Tangdu Hospital of Air Force Medical University. Baseline data, demographic characteristics, lifestyles, variables related to surgical treatment, and pathogen culture were harvested and analyzed. Univariate analyses and multivariate logistic regression analyses were used to reveal the independent risk factors of SSI. A bacterial distribution histogram and drug-sensitive heat map were drawn to describe the pathogenic characteristics. RESULTS: Included 3978 patients 138 of them developed SSI with an incidence rate of 3.47% postoperatively. By logistic regression analysis, we found that variables such as gender (males) (odds ratio (OR) = 2.012, 95% confidence interval (CI): 1.235 - 3.278, p = 0.005), diabetes mellitus (OR = 5.848, 95% CI: 3.513 - 9.736, p < 0.001), hypoproteinemia (OR = 3.400, 95% CI: 1.280 - 9.031, p = 0.014), underlying disease (OR = 5.398, 95% CI: 2.343 - 12.438, p < 0.001), hormonotherapy (OR = 11.718, 95% CI: 6.269 - 21.903, p < 0.001), open fracture (OR = 29.377, 95% CI: 9.944 - 86.784, p < 0.001), and intraoperative transfusion (OR = 2.664, 95% CI: 1.572 - 4.515, p < 0.001) were independent risk factors for SSI, while, aged over 59 years (OR = 0.132, 95% CI: 0.059 - 0.296, p < 0.001), prophylactic antibiotics use (OR = 0.082, 95% CI: 0.042 - 0.164, p < 0.001) and vacuum sealing drainage use (OR = 0.036, 95% CI: 0.010 - 0.129, p < 0.001) were protective factors. Pathogens results showed that 301 strains of 38 species of bacteria were harvested, among which 178 (59.1%) strains were Gram-positive bacteria, and 123 (40.9%) strains were Gram-negative bacteria. Staphylococcus aureus (108, 60.7%) and Enterobacter cloacae (38, 30.9%) accounted for the largest proportion. The susceptibility of Gram-positive bacteria to Vancomycin and Linezolid was almost 100%. The susceptibility of Gram-negative bacteria to Imipenem, Amikacin, and Meropenem exceeded 73%. CONCLUSION Orthopedic surgeons need to develop appropriate surgical plans based on the risk factors and protective factors associated with postoperative SSI to reduce its occurrence. Meanwhile, it is recommended to strengthen blood glucose control in the early stage of admission and for surgeons to be cautious and scientific when choosing antibiotic therapy in clinical practice.
Humans ; Surgical Wound Infection/epidemiology* ; Male ; Female ; Risk Factors ; Retrospective Studies ; Middle Aged ; Adult ; Case-Control Studies ; Fractures, Bone/surgery* ; Aged ; Drug Resistance, Bacterial ; Logistic Models ; Anti-Bacterial Agents/therapeutic use* ; Incidence ; Bacteria/drug effects*

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

Acute lung injury (ALI) has been a kind of acute and severe disease that is mainly characterized by systemic uncontrolled inflammatory response to the production of huge amounts of reactive oxygen species (ROS) in the lung tissue. Given the critical role of ROS in ALI, a Fe₃O₄ loaded bovine serum albumin (BSA) nanocluster (BF) was developed to act as a nanomedicine for the treatment of ALI. Combining with NIR irradiation, it exhibited excellent ROS scavenging capacity. Significantly, it also displayed the excellent antioxidant and anti-inflammatory functions for lipopolysaccharides (LPS) induced macrophages (RAW264.7), and Sprague Dawley rats via lowering intracellular ROS levels, reducing inflammatory factors expression levels, inducing macrophage M2 polarization, inhibiting NF-κB signaling pathway, increasing CD4⁺/CD8⁺ T cell ratios, as well as upregulating HSP70 and CD31 expression levels to reprogram redox homeostasis, reduce systemic inflammation, activate immunoregulation, and accelerate lung tissue repair, finally achieving the synergistic enhancement of ALI immunotherapy. It finally provides an effective therapeutic strategy of BF + NIR for the management of inflammation related diseases.

BACKGROUND: The use of inserted sham acupuncture as a placebo in randomized controlled trials (RCTs) is controversial, because it may produce specific effects that cause an underestimation of the effect of acupuncture treatment. OBJECTIVE: This systematic survey investigates the magnitude of insert-specific effects of sham acupuncture and whether they affect the estimation of acupuncture treatment effects. SEARCH STRATEGY: PubMed, Embase and Cochrane Central Register of Controlled Trials were searched to identify acupuncture RCTs from their inception until December 2022. INCLUSION CRITERIA: RCTs that evaluated the effects of acupuncture compared to sham acupuncture and no treatment. DATA EXTRACTION AND ANALYSIS: The total effect measured for an acupuncture treatment group in RCTs were divided into three components, including the natural history and/or regression to the mean effect (controlled for no-treatment group), the placebo effect, and the specific effect of acupuncture. The first two constituted the contextual effect of acupuncture, which is mimicked by a sham acupuncture treatment group. The proportion of acupuncture total effect size was considered to be 1. The proportion of natural history and/or regression to the mean effect (PNE) and proportional contextual effect (PCE) of included RCTs were pooled using meta-analyses with a random-effect model. The proportion of acupuncture placebo effect was the difference between PCE and PNE in RCTs with non-inserted sham acupuncture. The proportion of insert-specific effect of sham acupuncture (PIES) was obtained by subtracting the proportion of acupuncture placebo effect and PNE from PCE in RCTs with inserted sham acupuncture. The impact of PIES on the estimation of acupuncture's treatment effect was evaluated by quantifying the percentage of RCTs that the effect of outcome changed from no statistical difference to statistical difference after removing PIES in the included studies, and the impact of PIES was externally validated in other acupuncture RCTs with an inserted sham acupuncture group that were not used to calculate PIES. RESULTS: This analysis included 32 studies with 5492 patients. The overall PNE was 0.335 (95% confidence interval [CI], 0.255-0.415) and the PCE of acupuncture was 0.639 (95% CI, 0.567-0.710) of acupuncture's total effect. The proportional contribution of the placebo effect to acupuncture's total effect was 0.191, and the PIES was 0.189. When we modeled the exclusion of the insert-specific effect of sham acupuncture, the acupuncture treatment effect changed from no difference to a significant difference in 45.45% of the included RCTs, and in 40.91% of the external validated RCTs. CONCLUSION The insert-specific effect of sham acupuncture in RCTs represents 18.90% of acupuncture's total effect and significantly affects the evaluation of the acupuncture treatment effect. More than 40% of RCTs that used inserted sham acupuncture would draw different conclusions if the PIES had been controlled for. Considering the impact of the insert-specific effect of sham acupuncture, caution should be taken when using inserted sham acupuncture placebos in RCTs. Please cite this article as: Luo XC, Liu JL, Yao MH, Chen YM, Fan AY, Liang FR, Zhao JP, Zhao L, Zhou X, Zhong XY, Yang JH, Li B, Zhang Y, Sun X, Li L. Specific effect of inserted sham acupuncture and its impact on the estimation of acupuncture treatment effect in randomized controlled trials: A systematic survey. J Integr Med. 2025; 23(6):630-640.
Acupuncture Therapy/methods* ; Humans ; Randomized Controlled Trials as Topic ; Placebo Effect ; Placebos ; Treatment Outcome

OBJECTIVE: This study reports the first imported case of Lassa fever (LF) in China. Laboratory detection and molecular epidemiological analysis of the Lassa virus (LASV) from this case offer valuable insights for the prevention and control of LF. METHODS: Samples of cerebrospinal fluid (CSF), blood, urine, saliva, and environmental materials were collected from the patient and their close contacts for LASV nucleotide detection. Whole-genome sequencing was performed on positive samples to analyze the genetic characteristics of the virus. RESULTS: LASV was detected in the patient's CSF, blood, and urine, while all samples from close contacts and the environment tested negative. The virus belongs to the lineage IV strain and shares the highest homology with strains from Sierra Leone. The variability in the glycoprotein complex (GPC) among different strains ranged from 3.9% to 15.1%, higher than previously reported for the seven known lineages. Amino acid mutation analysis revealed multiple mutations within the GPC immunogenic epitopes, increasing strain diversity and potentially impacting immune response. CONCLUSION The case was confirmed through nucleotide detection, with no evidence of secondary transmission or viral spread. The LASV strain identified belongs to lineage IV, with broader GPC variability than previously reported. Mutations in the immune-related sites of GPC may affect immune responses, necessitating heightened vigilance regarding the virus.
Humans ; China/epidemiology* ; Genome, Viral ; Lassa Fever/virology* ; Lassa virus/classification* ; Molecular Epidemiology ; Phylogeny

Deep vein thrombosis(DVT)is a common complication after surgery for lower limb fracture.It has the features of high morbidity,high disability rate and high mortality.At present,the measures for clinical prevention and treatment of post-operative DVT in lower limb fracture mainly include perioperative nursing,intervention with medical auxiliary instruments,western medicine prevention and treatment,traditional Chinese medicine(TCM)intervention,and patients'self-cooperation.The patients'self-cooperation is the basis for the smooth implementation of other measures for prevention and treatment,and the patients'active cooperation is the premise of achieving the efficacy of prevention and treatment.Perioperative nursing is helpful for the patients to understand the risk factors of postoperative DVT and the possible risks after the occurrence of DVT,guides the patients to choose the food,assists the patients to do postoperative exercises,improves the level of patients'hemorheological indexes,and reduce the incidence of postoperative DVT.Medical devices are helpful for assisting patients to do postoperative rehabilitation exercises,improving the levels of hemodynamic indicators,promoting patients'rehabilitation and reducing the incidence of postoperative DVT.Western medicines such as low molecular weight heparin,Rivaroxaban,Enoxaparin and other anticoagulant drugs can reduce the aggregation of coagulation factors and blood viscosity,and reduce the incidence of postoperative DVT.TCM interventions mainly include oral administration of Chinese medicine and external treatment such as acupuncture,moxibustion and massage.Oral administration of Chinese medicine is helpful for improving blood flow status.Acupuncture,moxibustion and massage are beneficial to the activation of the function of zang-fu organs,and can stimulate the healthy qi to improve the qi-blood state of the whole body.Each method of prevention and treatment has its advantages and disadvantages.In clinical application,reasonable prevention and treatment methods should be selected according to the specific conditions and individual conditions of the patients.TCM intervention of DVT can be performed in patients with lower limb fracture before and after surgery,and has the advantages of low cost and definite efficacy,which is worthy of continuous research and inheritance and innovation.