This paper introduces a real-world cohort research model for community-acquired pneumonia （CAP） based on the Jiangsu Traditional Chinese Medicine （TCM） Dominant Diseases Diagnosis and Treatment Data Platform. Firstly， data cleaning is performed by standardizing diagnosis， symptoms， treatment and imaging， intelligently extracting unstructured information， and cleaning and constructing a standardized database. Secondly， for cohort establishment， CAP patients across the province are screened in accordance with CAP diagnostic criteria to build a high-quality disease-specific cohort. Lastly， in terms of protocol design， the characteristics of TCM research and the CAP disease profile are considered to determine appropriate inclusion and exclusion criteria， estimate sample size， define interventions， outcomes and economic evaluations， providing a reference for real-world TCM research on CAP.

This paper introduces a real-world cohort research model for community-acquired pneumonia （CAP） based on the Jiangsu Traditional Chinese Medicine （TCM） Dominant Diseases Diagnosis and Treatment Data Platform. Firstly， data cleaning is performed by standardizing diagnosis， symptoms， treatment and imaging， intelligently extracting unstructured information， and cleaning and constructing a standardized database. Secondly， for cohort establishment， CAP patients across the province are screened in accordance with CAP diagnostic criteria to build a high-quality disease-specific cohort. Lastly， in terms of protocol design， the characteristics of TCM research and the CAP disease profile are considered to determine appropriate inclusion and exclusion criteria， estimate sample size， define interventions， outcomes and economic evaluations， providing a reference for real-world TCM research on CAP.

This study was aimed at developing an in vitro fluorescent substrate assay for the activity of leucyl aminopeptid-ase(LAP)from Echinococcus multilocularis and comparing it with the chemical chromogenic substrate enzyme activity assay.Through the establishment of reaction conditions for the fluorescent substrate-based in vitro enzyme activity assay,we com-pared the differences between the fluorescent substrate L-Leucine-7-amido-4-methylocoumarin(Leu-AMC)and the chemical chromogenic substrate L-Leucine-4-nitroanilide(Leu-pNA)through molecular docking,inhibition rates,and precision measures.Molecular docking revealed that the fluorescent substrate Leu-AMC had higher affinity for the protein than the chemical chromogenic substrate Leu-pNA.Through analysis of the effects of varying reaction conditions on fluorescence intensi-ty,we optimized the fluorescent substrate enzyme activity assay to demonstrate favorable performance at a reaction temperature of 37℃,a pH of 9.0,a protein concentration of 800 nmol/L,and a reaction duration of 60 minutes.Leu-AMC exhibited significant and distinct responses at a 5 μmol/L substrate concentration,under varying substrate conditions.The fluo-rescent substrate assay demonstrated more significant intergroup differences than the chemical chromogenic substrate assay when various inhibitors were added.This study established a fluorescence-based enzyme activity assay for leucyl aminopeptidase from Echinococcus multilocularis by using Leu-AMC as the substrate;this method demonstrated a more significant intergroup difference and sensitivity than the chemical chromogenic substrate assay.

This paper uses literature and network data to systematically sort out the theoretical and practical foundations of global public health cooperation,combines expert interviews to conduct empirical analyses,and further explores China's strategies for participating in global public health cooperation through quantitative statistics and text mining of interview data,and proposes a plan for China's participation in global public health cooperation under the current international situation.Under the countercurrents to globalization,China should take its own public health capacity building as the foundation,put global security and health equity at the core,with a philosophy of open cooperation and sustainable development,actively promote bilateral and multilateral cooperation,focus on cultivating global health talents,and enhance the effectiveness of disease prevention and control by making use of existing platforms,international mechanisms and digital health technologies,so as to help build a Global Community of Health for All.

Objective:To develop an indicator system for defining the health services provided by family doctors within the "Healthy Subdistrict" initiative in China.Methods:An initial set of indicators was developed through literature review and qualitative research, followed by the design of an expert consultation questionnaire. Twenty-one experts with extensive experience in community family doctor services in Beijing were selected. Two rounds of Delphi consultations were conducted via email between December 2024 and February 2025. Expert demographics and authority coefficients were collected and the indicator system was finalized.Results:The response rate was 100% for both rounds. The average expert authority coefficient ( Cr) was 0.860 (range: 0.700-1.000). Kendall′s W for importance and feasibility increased from 0.129 and 0.196 in the first round to 0.230 and 0.268 in the second round (all P<0.001), indicating strong consensus. The final system includes 5 first-level and 23 second-level indicators, categorized as: Integrated Preventive and Clinical Care Services, Healthy Community Promotion Services, Basic Medical Services, Public Health Services, and Services for Promoting Equity in Citizen Health and Well-being. The highest-weighted first-level indicators were Basic Medical Services (0.281) and Integrated Preventive and Clinical Care Services (0.281), followed by Services for Promoting Equity in Citizen Health and Well-being (0.191), Healthy Community Promotion Services (0.124), and Public Health Services (0.124). All indicators had importance and feasibility scores above 3.5. Conclusion:This study establishes a weighted indicator system to guide and evaluate the health services provided by family doctors within the "Healthy Subdistrict" initiative, clarifying key service priorities.

This study aimed to explore the effects and mechanisms of total extracts from Anthriscus sylvestris on pulmonary hypertension in rats. Sixty male SD rats were divided into normal(NC) group, model(M) group, positive drug sildenafil(Y) group, low-dose A. sylvestris(ES-L) group, medium-dose A. sylvestris(ES-M) group, and high-dose A. sylvestris(ES-H) group. On day 1, rats were intraperitoneally injected with monocrotaline(60 mg·kg~(-1)) to induce pulmonary hypertension, and the rat model was established on day 28. From days 15 to 28, intragastric administration of the respective treatments was performed. After modeling and treatment, small animal echocardiography was used to detect the right heart function of the rats. Arterial blood gas was measured using a blood gas analyzer. Hematoxylin and eosin(HE) staining and Masson staining were performed to observe cardiopulmonary pathological damage. Flow cytometry was used to detect apoptosis in the lung and myocardial tissues and reactive oxygen species(ROS) levels. Western blot was applied to detect the expression levels of transforming growth factor-β1(TGF-β1), phosphorylated mothers against decapentaplegic homolog 3(p-Smad3), Smad3, tissue plasminogen activator(t-PA), and plasminogen activator inhibitor-1(PAI-1) in lung tissue. A blood routine analyzer was used to measure inflammatory immune cell levels in the blood. Enzyme-linked immunosorbent assay(ELISA) was used to detect the expression levels of P-selectin and thromboxane A2(TXA2) in plasma. The results showed that, compared with the NC group, right heart hypertrophy index, right ventricular free wall thickness, right heart internal diameter, partial carbon dioxide pressure(PaCO_2), apoptosis in cardiopulmonary tissue, and ROS levels were significantly increased in the M group. In contrast, the ratio of pulmonary blood flow acceleration time(PAT)/ejection time(PET), right cardiac output, change rate of right ventricular systolic area, systolic displacement of the tricuspid ring, oxygen partial pressure(PaO_2), and blood oxygen saturation(SaO_2) were significantly decreased in the M group. After administration of the total extract of A. sylvestris, right heart function and blood gas levels were significantly improved, while apoptosis in cardiopulmonary tissue and ROS levels significantly decreased. Further testing revealed that the total extract of A. sylvestris significantly decreased the levels of interleukin-1β(IL-1β), interleukin-6(IL-6), and PAI-1 proteins in lung tissue, while increasing the expression of t-PA. Additionally, the extract reduced the levels of inflammatory cells such as leukocytes, lymphocytes, granulocytes, and monocytes in the blood, as well as the levels of P-selectin and TXA2 in plasma. Metabolomics results showed that the total extract of A. sylvestris significantly affected metabolic pathways, including arginine biosynthesis, tyrosine metabolism, and taurine and hypotaurine metabolism. In conclusion, the total extract of A. sylvestris may exert an anti-pulmonary hypertension effect by inhibiting the TGF-β1/Smad3 signaling pathway, thereby alleviating immune-inflammatory responses and thrombosis.
Animals ; Male ; Smad3 Protein/metabolism* ; Transforming Growth Factor beta1/metabolism* ; Rats, Sprague-Dawley ; Rats ; Signal Transduction/drug effects* ; Hypertension, Pulmonary/genetics* ; Thrombosis/immunology* ; Drugs, Chinese Herbal/administration & dosage* ; Humans ; Apoptosis/drug effects*

Syringa pinnatifolia, belonging to the family Oleaceae, is a species endemic to China. It is predominantly distributed in the Helan Mountains region of Inner Mongolia and Ningxia of China. The peeled roots, stems, and thick branches have been used as a distinctive Mongolian medicinal material known as "Shan-chen-xiang", which has effects such as suppressing "khii", clearing heat, and relieving pain and is employed for the treatment of cardiovascular and pulmonary diseases and joint pain. Over the past five years, significant increase was achieved in research on chemical constituents and pharmacological effects. There were a total of 130 new constituents reported, covering sesquiterpenoids, lignans, and alkaloids. Its effects of anti-myocardial ischemia, anti-cerebral ischemia/reperfusion, sedation, and analgesia were revealed, and the mechanisms of agarwood formation were also investigated. To better understand its medical value and potential of clinical application, this review updates the research progress in recent five years focusing on the chemical constituents and pharmacological effects of S. pinnatifolia, providing reference for subsequent research on active ingredient and support for its innovative application in modern medicine system.
Medicine, Mongolian Traditional ; Humans ; Drugs, Chinese Herbal/pharmacology* ; Animals ; Syringa/chemistry*

Bawei Chenxiang Powder(BCP), first documented in the Tibetan medical work Four Medical Classics, has been widely applied in clinical practices in Tibetan and Mongolian medicines since its development. It has the effect of clearing the heart heat, calming the mind, and inducing resuscitation. On the basis of BCP, multiple types of formulae have been developed, such as Bawei Yiheyi Chenxiang Powder, Bawei Rang Chenxiang Powder, and Bawei Pingchuan Chenxiang Powder, which are widely used for treating cardiovascular and respiratory diseases. Current pharmacological research has revealed the pharmacological effects of BCP and its related formulae against myocardial ischemia, cerebral ischemia, renal ischemia, and anti-hypoxia. BCP and its related formulae introduced more treatment options for related clinical diseases and provided insights for fully comprehending the essence and pharmacological components of the formulae. This paper systematically reviewed the clinical and pharmacological research on BCP and its related formulae, analyzing the formulation principles and potential key flavors and active ingredients. This lays a fundamental scientific basis for the clinical use, quality evaluation, and subsequent development and application of BCP and its related formulae, providing references for studying traditional Chinese medicine formulae in a thorough and systematic manner.
Drugs, Chinese Herbal/chemistry* ; Humans ; Powders/chemistry* ; Animals ; Medicine, Chinese Traditional

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

OBJECTIVE: To investigate the clinical characteristics and prognosis of primary pulmonary lymphoma (PPL). METHODS: The clinical data of 17 patients with PPL admitted to Gansu Provincial Hospital from January 2013 to June 2023 were collected, and their clinical characteristics and prognosis were retrospectively analyzed and summarized. RESULTS: The median age of the 17 patients was 56 (29-73) years old. There were 8 males and 9 females. According to Ann Arbor staging system, there were 9 patients with stage I-II and 8 patients with stage III-IV. There were 14 patients with IPI score of 0-2 and 3 patients with IPI score of 3-4. All 17 patients had symptoms at the initial diagnosis, most of the first symptoms were cough, and 6 patients had B symptoms.Among the 17 patients, there were 8 cases of diffuse large B-cell lymphoma (DLBCL), 5 cases of mucosa-associated lymphoid tissue (MALT) lymphoma, 1 case of gray zone lymphoma (GZL), and 3 cases of Hodgkin's lymphoma (HL). 15 patients received chemotherapy, of which 3 cases received autologous hematopoietic stem cell transplantation(ASCT) and 3 cases received radiotherapy; 2 patients did not receive treatment. The median number of chemotherapy courses was 6(2-8). The short-term efficacy was evaluated, 12 patients achieved complete remission (CR) and 3 patients achieved partial remission (PR). The age, pathological subtype, sex, Ann Arbor stage, β₂-microglobulin(β₂-MG) level, lactate dehydrogenase(LDH) level were not correlated with CR rate (P >0.05), while IPI score was correlated with recent CR rate (P < 0.05 ). The median follow-up time was 31(2-102) months. One of the 12 CR patients died of COVID-19, and the rest survived. Among the 3 patients who did not reach CR, 1 died after disease progression, while the other 2 survived. One of the 2 untreated patients died one year after diagnosis. Both the median progression-free survival (PFS) time and overall survival (OS) time of the 17 patients were both 31 (2-102) months. CONCLUSION The incidence of PPL is low, and the disease has no specific clinical manifestations, which is easily missed and misdiagnosed. The pathological subtypes are mainly MALT lymphoma and DLBCL, and the treatment is mainly combined chemotherapy. The IPI score is related to the treatment efficacy.
Humans ; Middle Aged ; Male ; Female ; Adult ; Prognosis ; Aged ; Lung Neoplasms/therapy* ; Retrospective Studies ; Neoplasm Staging ; Lymphoma/therapy* ; Lymphoma, Large B-Cell, Diffuse