Hepatocellular carcinoma (HCC) is a leading cause of cancer-associated death globally. Liver transplantation (LT) has emerged as a key treatment for patients with HCC, and the Milan criteria have been adopted as the cornerstone of the selection policy. To allow more patients to benefit from LT, a number of expanded criteria have been proposed, many of which use radiologic morphological characteristics with larger and more tumors as surrogates to predict outcomes. Other groups developed indices incorporating biological variables and dynamic markers of response to locoregional treatment. These expanded selection criteria achieved satisfactory results with limited liver supplies. In addition, a number of prognostic models have been developed using clinicopathological characteristics, imaging radiomics features, genetic data, and advanced techniques such as artificial intelligence. These models could improve prognostic estimation, establish surveillance strategies, and bolster long-term outcomes in patients with HCC. In this study, we reviewed the latest findings and achievements regarding the selection criteria and post-transplant prognostic models for LT in patients with HCC.

Hepatocellular carcinoma (HCC) is a leading cause of cancer-associated death globally. Liver transplantation (LT) has emerged as a key treatment for patients with HCC, and the Milan criteria have been adopted as the cornerstone of the selection policy. To allow more patients to benefit from LT, a number of expanded criteria have been proposed, many of which use radiologic morphological characteristics with larger and more tumors as surrogates to predict outcomes. Other groups developed indices incorporating biological variables and dynamic markers of response to locoregional treatment. These expanded selection criteria achieved satisfactory results with limited liver supplies. In addition, a number of prognostic models have been developed using clinicopathological characteristics, imaging radiomics features, genetic data, and advanced techniques such as artificial intelligence. These models could improve prognostic estimation, establish surveillance strategies, and bolster long-term outcomes in patients with HCC. In this study, we reviewed the latest findings and achievements regarding the selection criteria and post-transplant prognostic models for LT in patients with HCC.

Hepatocellular carcinoma (HCC) is a leading cause of cancer-associated death globally. Liver transplantation (LT) has emerged as a key treatment for patients with HCC, and the Milan criteria have been adopted as the cornerstone of the selection policy. To allow more patients to benefit from LT, a number of expanded criteria have been proposed, many of which use radiologic morphological characteristics with larger and more tumors as surrogates to predict outcomes. Other groups developed indices incorporating biological variables and dynamic markers of response to locoregional treatment. These expanded selection criteria achieved satisfactory results with limited liver supplies. In addition, a number of prognostic models have been developed using clinicopathological characteristics, imaging radiomics features, genetic data, and advanced techniques such as artificial intelligence. These models could improve prognostic estimation, establish surveillance strategies, and bolster long-term outcomes in patients with HCC. In this study, we reviewed the latest findings and achievements regarding the selection criteria and post-transplant prognostic models for LT in patients with HCC.

ObjectiveTo obtain the epidemiological characteristics of re-positive cases infected with SARS-CoV-2 in Pudong New Area from March to July 2022, including clinical manifestations, duration of a negative nucleic acid conversion after tested for re-positive, and length of time from the discharge of the initial infection to the most recent re-positivity, so as to provide a scientific basis for the prevention and control of COVID-19. MethodsA questionnaire survey was conducted among the re-positive cases infected with SARS-CoV-2 after discharged from hospital/quarantine facility in Pudong New Area, and descriptive epidemiological methods were used for characteristics analysis. ResultsA total of 2 422 re-positive cases met the inclusive and exclusive criteria, with males accounting for 61.02%. The age distribution mainly fell between 18 and <60 years old, accounting for 62.39%. Clinical manifestations were predominantly asymptomatic (72.15%), followed by cough (12.03%) and sore throat (6.58%). Among the stratified randomized sample of 416 individuals, there were statistically significant differences in symptoms (χ²=262.667, P<0.001), clinical typing (χ²=12.996, P=0.001), and duration of a negative nucleic acid conversion (χ²=142.578, P<0.001) between the initial positive and re-positive instances. Besides, statistically significant differences in symptoms (χ²=13.696, P=0.016) and self-perception of the severity of re-infection (χ²=7.923, P=0.048) between the initial and re-positive cases were observed by different genders. ConclusionAmong re-positive cases, males experienced milder symptoms compared to females, and the self-perception of symptoms during re-positivity is milder than that in the initial positive infection. The length of time for negative nucleic acid conversion during the initial positive period is shorter than that during the re-positive period.

Syringa pinnatifolia, belonging to the family Oleaceae, is a species endemic to China. It is predominantly distributed in the Helan Mountains region of Inner Mongolia and Ningxia of China. The peeled roots, stems, and thick branches have been used as a distinctive Mongolian medicinal material known as "Shan-chen-xiang", which has effects such as suppressing "khii", clearing heat, and relieving pain and is employed for the treatment of cardiovascular and pulmonary diseases and joint pain. Over the past five years, significant increase was achieved in research on chemical constituents and pharmacological effects. There were a total of 130 new constituents reported, covering sesquiterpenoids, lignans, and alkaloids. Its effects of anti-myocardial ischemia, anti-cerebral ischemia/reperfusion, sedation, and analgesia were revealed, and the mechanisms of agarwood formation were also investigated. To better understand its medical value and potential of clinical application, this review updates the research progress in recent five years focusing on the chemical constituents and pharmacological effects of S. pinnatifolia, providing reference for subsequent research on active ingredient and support for its innovative application in modern medicine system.
Medicine, Mongolian Traditional ; Humans ; Drugs, Chinese Herbal/pharmacology* ; Animals ; Syringa/chemistry*

Medical institutions, with their clinical practice foundation and abundant human use experience data, have become important carriers for the inheritance and innovation of traditional Chinese medicine(TCM) and the "cradles" of the preparation of new TCM. To effectively promote the transformation of new TCM originating from the TCM clinical practice in medical institutions and establish an effective evaluation index system for the transformation of new TCM conforming to the characteristics of TCM, consensus experts adopted the literature research, questionnaire survey, Delphi method, etc. By focusing on the policy and technical evaluation of new TCM originating from the TCM clinical practice in medical institutions, a comprehensive evaluation from the dimensions of drug safety, efficacy, feasibility, and characteristic advantages was conducted, thus forming a comprehensive evaluation system with four primary indicators and 37 secondary indicators. The expert consensus reached aims to encourage medical institutions at all levels to continuously improve the high-quality research and development and transformation of new TCM originating from the TCM clinical practice in medical institutions and targeted at clinical needs, so as to provide a decision-making basis for the preparation, selection, cultivation, and transformation of new TCM for medical institutions, improve the development efficiency of new TCM, and precisely respond to the public medication needs.
Medicine, Chinese Traditional/standards* ; Humans ; Consensus ; Drugs, Chinese Herbal/therapeutic use* ; Surveys and Questionnaires

This study investigated the protective effect of arbutin(Arb) in yam on lipopolysaccharide(LPS)-induced acute lung injury(ALI) in a mouse model and revealed its possible mechanism of action by metabolomics technology, providing a theoretical basis for clinical treatment of ALI. SPF BALB/c mice were randomly divided into normal control group, model group, resveratrol(Rv)-positive control group, Arb low-dose(15 mg·kg~(-1)) group, and Arb high-dose(30 mg·kg~(-1)) group. The LPS-induced ALI model was established in all groups except the normal control group. Hematoxylin-eosin(HE) staining, TUNEL staining, and WBP whole-body non-invasive pulmonary function testing were used to evaluate the degree of lung tissue damage and lung function changes. Enzyme-linked immunosorbent assay(ELISA) was used to detect the level of inflammatory factors in lung tissue. Flow cytometry was used to analyze the M1/M2 polarization status of macrophages in lung tissue. Western blot was used to detect the expression levels of the TLR4 signaling pathway and related apoptotic proteins. Liquid chromatograph-mass spectrometer(LC-MS) metabolomics was used to analyze the changes in serum metabolic profile after Arb intervention. The results showed that Arb pretreatment significantly alleviated LPS-induced lung tissue injury, improved lung function, reduced the levels of pro-inflammatory factors(IL-6, TNF-α, IL-18, and IL-1β), and regulated the polarization status of M1/M2 macrophages. In addition, Arb inhibited the activation of the TLR4 signaling pathway, reduced the expression of pro-apoptotic proteins such as Bax, caspase-3, and caspase-9, up-regulated the level of Bcl-2 protein, and inhibited apoptosis of lung cells. Metabolomic analysis showed that Arb significantly improved LPS-induced metabolic abnormalities, mainly involving key pathways such as galactose metabolism, phenylalanine metabolism, and lipid metabolism. In summary, Arb can significantly reduce LPS-induced ALI by regulating the release of inflammatory factors, inhibiting the activation of the TLR4 signaling pathway, improving metabolic disorders, and regulating macrophage polarization, indicating that Arb has potential clinical application value.
Animals ; Acute Lung Injury/chemically induced* ; Mice ; Mice, Inbred BALB C ; Arbutin/administration & dosage* ; Male ; Toll-Like Receptor 4/immunology* ; Apoptosis/drug effects* ; Lung/metabolism* ; Signal Transduction/drug effects* ; Protective Agents/administration & dosage* ; Humans ; Macrophages/immunology* ; Drugs, Chinese Herbal/administration & dosage*

Varicocele (VC) is a common cause of male infertility, yet there is a lack of molecular information for VC-associated male infertility. This study investigated alterations in the seminal plasma metabolomic and lipidomic profiles of infertile male VC patients. Twenty infertile males with VC and twenty-three age-matched healthy controls (HCs) were recruited from Peking Union Medical College Hospital (Beijing, China) between October 2019 and April 2021. Untargeted metabolite and lipid profiles from seminal plasma were analyzed using mass spectrometry. Four hundred and seventy-six metabolites and seventeen lipids were significantly different in infertile male VC patients compared to HCs. The top enriched pathways among these significantly different metabolites are protein digestion and absorption, aminoacyl-transfer RNA (tRNA) biosynthesis, and biosynthesis of amino acids. Different key lipid species, including triglyceride (TG), diacylglycerol (DG), ceramides (Cer), and phosphatidylserine (PS), varied between VC and HC groups. The distinct metabolites and lipids were moderately correlated. DL-3-phenyllactic acid is a potential diagnostic biomarker for VC-related male infertility (area under the curve [AUC] = 0.893), positively correlating with sperm count, concentration, and motility. Furthermore, DL-3-phenyllactic acid is the only metabolite shared by all four comparisons (VC vs HC, VC-induced oligoasthenospermia [OAS] vs VC-induced asthenospermia [AS], OAS vs HC, and AS vs HC). DL-3-phenyllactic acid significantly decreased in OAS than AS. Metabolite-targeting gene analysis revealed carbonic anhydrase 9 (CA9) might be the strongest candidate associated with the onset and severity of VC. The seminal plasma metabolite and lipid profiles of infertile males with VC differ significantly from those of HCs. DL-3-phenyllactic acid could be a promising biomarker.
Humans ; Male ; Varicocele/complications* ; Infertility, Male/etiology* ; Semen/metabolism* ; Lipidomics ; Adult ; Metabolomics ; Case-Control Studies ; Biomarkers/metabolism*

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

Iron overload is strongly associated with heart disease. Ferroptosis is a new form of regulated cell death indicated in cardiac ischemia-reperfusion (I/R) injury. However, the specific molecular mechanism of myocardial injury caused by iron overload in the heart is still unclear, and the involvement of ferroptosis in iron overload-induced myocardial injury is not fully understood. In this study, we observed that ferroptosis participated in developing of iron overload and I/R-induced cardiomyopathy. Mechanistically, we discovered that Parkin inhibited iron overload-induced ferroptosis in cardiomyocytes by promoting the ubiquitination of long-chain acyl-CoA synthetase 4 (ACSL4), a crucial protein involved in ferroptosis-related lipid metabolism pathways. Additionally, we identified p53 as a transcription factor that transcriptionally suppressed Parkin expression in iron-overloaded cardiomyocytes, thereby regulating iron overload-induced ferroptosis. In animal studies, cardiac-specific Parkin knockout mice (Myh6-CreER ^T2 /Parkin ^fl/fl ) fed a high-iron diet presented more severe myocardial damage, and the high iron levels exacerbated myocardial I/R injury. However, the ferroptosis inhibitor Fer-1 significantly suppressed iron overload-induced ferroptosis and myocardial I/R injury. Moreover, Parkin effectively protected against impaired mitochondrial function and prevented iron overload-induced mitochondrial lipid peroxidation. These findings unveil a novel regulatory pathway involving p53-Parkin-ACSL4 in heart disease by inhibiting of ferroptosis.