This paper introduces a real-world cohort research model for community-acquired pneumonia （CAP） based on the Jiangsu Traditional Chinese Medicine （TCM） Dominant Diseases Diagnosis and Treatment Data Platform. Firstly， data cleaning is performed by standardizing diagnosis， symptoms， treatment and imaging， intelligently extracting unstructured information， and cleaning and constructing a standardized database. Secondly， for cohort establishment， CAP patients across the province are screened in accordance with CAP diagnostic criteria to build a high-quality disease-specific cohort. Lastly， in terms of protocol design， the characteristics of TCM research and the CAP disease profile are considered to determine appropriate inclusion and exclusion criteria， estimate sample size， define interventions， outcomes and economic evaluations， providing a reference for real-world TCM research on CAP.

This paper introduces a real-world cohort research model for community-acquired pneumonia （CAP） based on the Jiangsu Traditional Chinese Medicine （TCM） Dominant Diseases Diagnosis and Treatment Data Platform. Firstly， data cleaning is performed by standardizing diagnosis， symptoms， treatment and imaging， intelligently extracting unstructured information， and cleaning and constructing a standardized database. Secondly， for cohort establishment， CAP patients across the province are screened in accordance with CAP diagnostic criteria to build a high-quality disease-specific cohort. Lastly， in terms of protocol design， the characteristics of TCM research and the CAP disease profile are considered to determine appropriate inclusion and exclusion criteria， estimate sample size， define interventions， outcomes and economic evaluations， providing a reference for real-world TCM research on CAP.

ObjectiveHepatocellular carcinoma (HCC) represents 90% of all primary liver cancers. The main risk factors associated with HCC include viral hepatitis (B and/or C), alcohol abuse, and metabolic dysfunction-associated steatotic liver disease (MASLD), which progressively advance to liver fibrosis, cirrhosis, and ultimately evolve into HCC. Surgical resection represents the most effective treatment for HCC, while recent advances in immunotherapy, including immune checkpoint inhibitors and adoptive cell therapies, have provided improved treatment prospects for patients with unresectable HCC. However, the complex metabolic heterogeneity of HCC limits the therapeutic efficacy. Metabolic intermediates acyl-CoA not only provide energy and substrates for numerous biochemical reactions but also serve as donors for protein lysine acylation, a major class of post-translational modification (PTM). Therefore, a deeper understanding of the molecular mechanisms underlying protein lysine acylation and hepatocarcinogenesis is urgently needed. MethodsThe levels of protein lysine acylation and silence information regulator 5 (SIRT5) expression levels in clinical HCC samples were analyzed by Western blot. Quantitative malonylome and succinylome of HCC samples were analyzed by antibody-based affinity enrichment coupled with tandem mass spectrometry. The proliferation of HCC cells was analyzed with Cell Counting Kit-8 (CCK-8) assays, the apoptosis was quantified by Annexin V-FITC/propidium iodide (PI) staining coupled with flow cytometry, and the ability of cells to migrate was assayed by Transwell assays. The enzymatic activity of glutathione S-transferase Mu 1 (GSTM1) was quantified. Transgenic mice with hepatic overexpression of SIRT5 were constructed using CRISPR-Cas9, and primary hepatocarcinogenesis was induced by administration of diethylnitrosamine. ResultsWestern blot analysis indicated that the expression level of SIRT5 was elevated in clinical samples from HCC patients, and the levels of lysine malonylation, glutarylation, and succinylation were significantly reduced in HCC tissues. Knockout of SIRT5 in MHCC-97H and MHCC-97L hepatoma cells suppressed cell proliferation, and increased the percentage of apoptotic cells significantly. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analyses of the differentially malonylome and succinylome of HCC samples revealed significant enrichment in two major classes of biological processes: core energy metabolism (e.g., glycolysis/gluconeogenesis, tricarboxylic acid metabolic process, fatty acid beta oxidation) and detoxification and oxidative stress response (e.g., response to toxic substance, chemical carcinogenesis, reactive oxygen species (ROS)). SIRT5 removes malonylation from lysine residues in GSTM1 and restores its detoxification activity, which is crucial for the survival of hepatocytes under stressed conditions. More importantly, in vivo experiment indicated that hepatic-specific overexpression of SIRT5 in mice accelerated diethylnitrosamine-induced liver fibrosis and hepatocarcinogenesis, indicating the critical role of SIRT5 in HCC progression. ConclusionThis study highlights the previously unrecognized SIRT5-GSTM1 axis as a key regulator in hepatocarcinogenesis, and suggests a potential target for the treatment of patients with HCC.

Objective: To understand the correlation between autistic traits in children with autism spectrum disorder(ASD) and their parental behaviors, so as to provide evidence for improving social behavior in children with ASD. Methods: A total of 62 children aged 4-7 years diagnosed with ASD at Guangdong Provincial Work Injury Rehabilitation Hospital and Guangzhou Yuexiu District Children s Hospital from October 2021 to May 2025 were selected as the ASD group. A random number table method was used to select 62 healthy children of the same age from 3 ordinary kindergartens in Guangzhou as the control (typically developing,TD) group. The Parental Behavior Inventory and Social Responsiveness Scale were used to evaluate parental behaviors and autistic traits in both groups. The t-test and multiple linear regression were used to analyze the relationship between autistic traits in children with ASD and parental behaviors. Results: Compared with the TD group, the ASD group had significantly higher scores in social awareness, social cognition, social communication, social motivation, autistic behavior patterns, and the total score of social responsiveness, with statistically significant differences ( t =35.83, 46.17, 64.36, 41.45, 49.46,101.15, all P <0.01). The score of parental support/participation in the ASD group (24.61±4.30) was lower than that in the TD group (31.27±4.58), while the score of parental hostility/coercion in the ASD group (25.51±2.72) was higher than that in the TD group (12.75±2.72), with statistically significant differences ( t = -8.34, 26.14, both P <0.01). The total score of the Social Responsiveness Scale was negatively correlated with the dimension score of parental support/participation behaviors, and positively correlated with the dimension score of parental hostility/coercion behaviors ( r =-0.60, 0.91,both P <0.05). After adjusting for covariates such as children s age, gender, and primary caregiver, ASD children with exclusive breastfeeding ( β =-8.79) and parental support/participation behaviors ( β = -0.79 ) had a lower risk of autistic traits, while children with parental hostility/coercion behaviors ( β =4.62) had a higher risk of autistic traits (all P <0.05). Conclusion Autistic traits in children with ASD may be related to their parental behaviors and early feeding mode.

Iron overload is strongly associated with heart disease. Ferroptosis is a new form of regulated cell death indicated in cardiac ischemia-reperfusion (I/R) injury. However, the specific molecular mechanism of myocardial injury caused by iron overload in the heart is still unclear, and the involvement of ferroptosis in iron overload-induced myocardial injury is not fully understood. In this study, we observed that ferroptosis participated in developing of iron overload and I/R-induced cardiomyopathy. Mechanistically, we discovered that Parkin inhibited iron overload-induced ferroptosis in cardiomyocytes by promoting the ubiquitination of long-chain acyl-CoA synthetase 4 (ACSL4), a crucial protein involved in ferroptosis-related lipid metabolism pathways. Additionally, we identified p53 as a transcription factor that transcriptionally suppressed Parkin expression in iron-overloaded cardiomyocytes, thereby regulating iron overload-induced ferroptosis. In animal studies, cardiac-specific Parkin knockout mice (Myh6-CreER ^T2 /Parkin ^fl/fl ) fed a high-iron diet presented more severe myocardial damage, and the high iron levels exacerbated myocardial I/R injury. However, the ferroptosis inhibitor Fer-1 significantly suppressed iron overload-induced ferroptosis and myocardial I/R injury. Moreover, Parkin effectively protected against impaired mitochondrial function and prevented iron overload-induced mitochondrial lipid peroxidation. These findings unveil a novel regulatory pathway involving p53-Parkin-ACSL4 in heart disease by inhibiting of ferroptosis.

Varicocele (VC) is a common cause of male infertility, yet there is a lack of molecular information for VC-associated male infertility. This study investigated alterations in the seminal plasma metabolomic and lipidomic profiles of infertile male VC patients. Twenty infertile males with VC and twenty-three age-matched healthy controls (HCs) were recruited from Peking Union Medical College Hospital (Beijing, China) between October 2019 and April 2021. Untargeted metabolite and lipid profiles from seminal plasma were analyzed using mass spectrometry. Four hundred and seventy-six metabolites and seventeen lipids were significantly different in infertile male VC patients compared to HCs. The top enriched pathways among these significantly different metabolites are protein digestion and absorption, aminoacyl-transfer RNA (tRNA) biosynthesis, and biosynthesis of amino acids. Different key lipid species, including triglyceride (TG), diacylglycerol (DG), ceramides (Cer), and phosphatidylserine (PS), varied between VC and HC groups. The distinct metabolites and lipids were moderately correlated. DL-3-phenyllactic acid is a potential diagnostic biomarker for VC-related male infertility (area under the curve [AUC] = 0.893), positively correlating with sperm count, concentration, and motility. Furthermore, DL-3-phenyllactic acid is the only metabolite shared by all four comparisons (VC vs HC, VC-induced oligoasthenospermia [OAS] vs VC-induced asthenospermia [AS], OAS vs HC, and AS vs HC). DL-3-phenyllactic acid significantly decreased in OAS than AS. Metabolite-targeting gene analysis revealed carbonic anhydrase 9 (CA9) might be the strongest candidate associated with the onset and severity of VC. The seminal plasma metabolite and lipid profiles of infertile males with VC differ significantly from those of HCs. DL-3-phenyllactic acid could be a promising biomarker.
Humans ; Male ; Varicocele/complications* ; Infertility, Male/etiology* ; Semen/metabolism* ; Lipidomics ; Adult ; Metabolomics ; Case-Control Studies ; Biomarkers/metabolism*

OBJECTIVES: To study the clinical manifestations and genetic characteristics of children with maturity-onset diabetes of the young type 2 (MODY2), aiming to enhance the recognition of MODY2 in clinical practice. METHODS: A retrospective analysis was conducted on the clinical data of 13 children diagnosed with MODY2 at the Department of Pediatrics of Tongji Hospital of Tongji Medical College of Huazhong University of Science and Technology from August 2017 to July 2023. RESULTS: All 13 MODY2 children had a positive family history of diabetes and were found to have mild fasting hyperglycemia [(6.4±0.5) mmol/L] during health examinations or due to infectious diseases. In the oral glucose tolerance test, two cases met the diagnostic criteria for diabetes with fasting blood glucose, while the others exhibited impaired fasting glucose or impaired glucose tolerance. The one-hour post-glucose load (1-hPG) fluctuated between 8.31 and 13.06 mmol/L, meeting the diagnostic criteria for diabetes recommended by the International Diabetes Federation. All 13 MODY2 children had heterozygous variants in the glucokinase (GCK) gene, with Cases 6 (GCK c.1047C>A, p.Y349X), 11 (GCK c.1146_1147ins GCAGAGCGTGTCTACGCGCGCTGCGCACATGTGC, p.S383Alafs*87), and 13 (GCK c.784_785insC, p.D262Alafs*13) presenting variants that had not been previously reported. CONCLUSIONS This study enriches the spectrum of genetic variations associated with MODY2. Clinically, children with a family history of diabetes, incidental findings of mild fasting hyperglycemia, and negative diabetes-related antibodies should be considered for the possibility of MODY2.
Humans ; Diabetes Mellitus, Type 2/diagnosis* ; Male ; Female ; Child ; Retrospective Studies ; Glucokinase/genetics* ; Adolescent ; Child, Preschool ; Glucose Tolerance Test

Objective To investigate the association between gastroesophageal reflux disease(GERD)and the risk of incident chronic obstructive pulmonary disease(COPD)and explore potential effect modifiers influencing this association.Methods Clinical data from 476 175 participants in the UK Biobank(2006-2010)were collected.A Cox proportional hazards model was used to assess the relationship between GERD and the risk of incident COPD.Subgroup analyses were conducted to examine potential modifiers of the primary findings.Results A total of 11 587(2.43%)new COPD cases were diagnosed.The Cox proportional hazards model revealed that GERD was associated with an increased risk of incident COPD(HR=1.59,95%CI=1.46-1.74,P<0.001).GERD was linked to a higher risk of incident COPD in individuals aged<60 years(P<0.001)and non-smokers(P=0.011).No association was observed between GERD and the risk of incident COPD in current smokers with a daily cigarette consumption<10 cigarettes(P=0.261).Conclusion GERD may increase the risk of incident COPD.
Humans ; Pulmonary Disease, Chronic Obstructive/epidemiology* ; Gastroesophageal Reflux/epidemiology* ; Middle Aged ; Proportional Hazards Models ; Incidence ; Male ; Risk Factors ; Female ; Aged

Current ambient mass spectrometry ionization often requires external auxiliary equipment such as high-voltage power supply,gas cylinder,and syringe pump.Moreover,the process of sample preparation is cumbersome,and the experimental operations are complex,which makes it difficult to adapt to real-time on-site detection.In this work,a novel method was proposed,in which direct sampling of raw samples,online extraction of interest analytes,and ionization of target molecules were integrated into a single unit.With the developed method,the in-situ extraction and nano-electrospray ionization for both liquid and solid raw samples were achieved.Also,a handheld ion source and its pose adjustment device were developed,and the position and angle parameters were subsequently optimized.The performance of the ionization device was tested using standard solutions of caffeine and reserpine.The limits of detection(LODs)were 0.08 μg/L and 0.14 μg/L,with relative standard deviations(RSDs)≤3.7% and≤5.6%,respectively,indicating that the device possessed high sensitivity and stability.Using this device,three different concentrations of reserpine standard solutions were continuously tested for five days.The intra-day RSDs were consistently≤4.7% and the inter-day RSDs were all≤10.3%,showing the good working stability of the device.Without any pretreatment,a rapid qualitative detection of medicinal components including astragaloside II and cycloastragenol in five traditional Chinese medicines was carried out,with RSDs≤8.0% and≤7.1%,respectively.Additionally,rapid qualitative detection of gallic acid,a medicinal component,in white peony roots,and hypaphorine as well as quercetin in cowherb seeds were carried out,with RSDs≤7.0%,≤6.4% and≤6.1%,respectively.These results demonstrated that the ionization technology and device exhibited good stability during qualitative detection of raw samples.

Syringa pinnatifolia, belonging to the family Oleaceae, is a species endemic to China. It is predominantly distributed in the Helan Mountains region of Inner Mongolia and Ningxia of China. The peeled roots, stems, and thick branches have been used as a distinctive Mongolian medicinal material known as "Shan-chen-xiang", which has effects such as suppressing "khii", clearing heat, and relieving pain and is employed for the treatment of cardiovascular and pulmonary diseases and joint pain. Over the past five years, significant increase was achieved in research on chemical constituents and pharmacological effects. There were a total of 130 new constituents reported, covering sesquiterpenoids, lignans, and alkaloids. Its effects of anti-myocardial ischemia, anti-cerebral ischemia/reperfusion, sedation, and analgesia were revealed, and the mechanisms of agarwood formation were also investigated. To better understand its medical value and potential of clinical application, this review updates the research progress in recent five years focusing on the chemical constituents and pharmacological effects of S. pinnatifolia, providing reference for subsequent research on active ingredient and support for its innovative application in modern medicine system.
Medicine, Mongolian Traditional ; Humans ; Drugs, Chinese Herbal/pharmacology* ; Animals ; Syringa/chemistry*